| BR2823 |
C. elegans |
chn-1(by155) I. Show Description
989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.
|
|
| BR2958 |
C. elegans |
ceh-16(lg16) III; jcIs1 IV; ngEx1. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ngEx1[ceh-16::GFP]. ngEx1 rescues ceh-16(lg16) lethality. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Cassata et al. Development. 2005 Feb;132(4):739-49.
|
|
| BR4006 |
C. elegans |
pink-1(tm1779) II; byEx655. Show Description
byEx655 [pink-1p::pink-1::GFP + myo-2p::mCherry + herring sperm DNA]. Pick mCherry+ animals to maintain. pink-1 translational GFP (C-terminal GFP) fusion generated by cloning the complete pink-1 genomic fragment (3191 bp) with a 6-kb upstream promoter region and into pPD117.01. Reference: Sämann J, et al. J Biol Chem. 2009 Jun 12;284(24):16482-91.
|
|
| BR5270 |
C. elegans |
byIs161. Show Description
byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted (line A). Integration site not mapped. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
|
|
| BR5271 |
C. elegans |
byIs162. Show Description
byIs162 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line A). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
|
|
| BR6516 |
C. elegans |
byIs194. Show Description
byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line B). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
|
|
| brc-1(tm1145);syIs44 |
C. elegans |
Show Description
Strain contains deletion allele of brc-1 with syIs44 [hsp::lacI::GFP + lacO + dpy-20(+)] V.
|
|
| BRC566 |
C. elegans |
antIs31 II; unc-119(ed9) III. Show Description
antIs31 [attP-f + Cbr-unc-119(ant40) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. Unc. antIS31 has been found to self-excise; check for GFP expression periodically to retain the insertion. GFP expression in pharynx is very weak (as it is in single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. antIs31 was derived by CRISPR/Cas9 knockout of Cbr-unc-119 in antIs30 creating ant40, a 691 bp deletion in Cbr-unc-119. Because antIs31 does not rescue unc-119(ed3), BRC566 facilitates the use of Unc-119 rescue as a selection marker for transgene insertions. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.
|
|
| BS1175 |
C. elegans |
cdk-4(gv3) X; ozEx76. Show Description
ozEx76 [cdk-4p::CDK-4::GFP + sur-5::DsRed)]. Maintain by picking DsRed+. ozEx76 is unstable; strain exhibits high levels of lethality and sterilty. ~10% of progeny are fertile. Reference: Fox PM, et al. Development. 2011 Jun;138(11):2223-34.
|
|
| BS3348 |
C. elegans |
C07A4.1(ok144) X. Show Description
Primers used to detect the deletion: IQ789.E1: CACACATCGGTCTTCCACAC. IQ789.E2: AATGAAACACCGGAAACTCG. IQ789.I1: TGCAATTGTGTTGCAGGAAT. IQ789.I2: AAAAGAGTGGCTGGCTCGTA.
|
|
| BS3383 |
C. elegans |
pmk-3(ok169). Show Description
F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.
|
|
| BS3727 |
C. elegans |
lip-1(ok154) IV. Show Description
Temperature-sensitive allele. Can be grown at 20C with reduced fertility. Defects in pachytene progression, small oocyte formation and Emo are highly penetrant at 25C. ok154 is a null allele; 1504 bp deletion from -156 bp to +1348 bp, removes the start codon. Reference: Proc Natl Acad Sci USA. Das D, et al. 2022 Jan 18;119(3):e2113649119. PMID: 35022236
|
|
| BS518 |
C. elegans |
ozDf1/sdc-3(y52y180) unc-76(e911) V. Show Description
Heterozygotes are slow growing with WT phenotype. Hets segregate more slow growing WT, embryonic lethals (ozDf1/ozDf1) and DpyUncs which are sick and have a maternal effect lethal (none of the offspring from the DpyUncs survive to reproduce). Maintain by picking WT.
|
|
| BW1102 |
C. elegans |
dpy-5(e61) mei-2(ct102) unc-29(e1072) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals that have lost the duplication are DpyUncMel. mei-2 is non-conditional recessive maternal effect lethal.
|
|
| BW1341 |
C. elegans |
nob-1(ct223) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain; typically segregates about 50% wild type progeny and 50% Nob larvae.
|
|
| BW1561 |
C. elegans |
dpy-18(e364) nob-1(ct223) unc-25(e156) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain. The Dpy and Unc phenotypes are not visible in the Nob background. ct223 is recessive.
|
|
| BW1563 |
C. elegans |
pal-1(ct281)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct281 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct281 is a 4.7kb deletion removing intron 5, exon 6, and the 3'UTR of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
|
|
| BW1566 |
C. elegans |
pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
|
|
| BW1634 |
C. elegans |
nob-1(ct223)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
WT hermaphrodites that segregate WT, Dpy Steriles and Nob larvae. The Nob phenotype results in 100% lethality. Maintain by picking WT.
|
|
| BW1651 |
C. elegans |
nob-1(ct351) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain; segregates wild type progeny, Nob larvae, and occasional dead eggs. ct351 is recessive.
|
|
| BW1809 |
C. elegans |
gpa-16(it143) I; him-5(e1490) V. Show Description
Temperature-sensitve. Maintain at 15C. Slight Maternal Effect Lethal (Mel) at 15C, more pronounced at 20C. Highly penetrant Mel at 25C and a fraction of the survivors have reversed left-right organs.
|
|
| BW1927 |
C. elegans |
pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III; ctIs33. Show Description
ctIs33 [pal-1::GFP + rol-6(su1006)]. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. ctIs33 carries a non-rescuing pal-1::GFP fusion containing ~7kb 5' of the SL1 splice site through part of exon 5 fused to GFP. GFP expression is primarily embryonic and limited to a few cells; not visible except at high magnification. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
|
|
| BW219 |
C. elegans |
nDf31/unc-23(e25) sma-1(e30) V. Show Description
Heterozygotes are WT and segregate SmaUnc and Lethals. Lethal in L1. Maintain by picking WT.
|
|
| BW315 |
C. elegans |
mig-10(ct41) III. Show Description
Withered tail and Egl. Adults shorter than WT. Embryonic cell migrations affected: ALM and HSN with high penetrance, CAN with moderate penetrance. All misplaced nuclei at positions indicating incomplete migration.
|
|
| BW54 |
C. elegans |
ct350 II. Show Description
Maintain at 15C. Temperature sensitive embryonic lethal. Sterile at 25C. Congenic strain, N2 and Bergerac BE. This allele should NOT be assumed to define a gene to which someone gave the name zyg-12. This name should not be used unless someone finds a non-complementing Bristol mutation. There is no evidence at present that the ts results from a single gene defect. Has been backcrossed >6 times to Bristol strains and should only contain Bergerac DNA in the unc-85 to dpy-10 region.
|
|
| BX106 |
C. elegans |
fat-6(tm331) IV. Show Description
Received new stock with confirmed deletion from Jennifer Watts 07/16/2009.
|
|
| BX107 |
C. elegans |
fat-5(tm420) V. Show Description
Received new stock with confirmed deletion from Jennifer Watts 07/16/2009.
|
|
| BXN653 |
C. elegans |
scrm-1(cjn26) zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. mec-4::GFP is expressed in touch neurons. Null allele of scrm-1: 2501 bp deletion and 7 bp insertion (CACACAT) removes the entire scrm-1 coding sequence (position 11688933 - 11691433 of chromosome I).
|
|
| BXN723 |
C. elegans |
fzo-1(cjn20) II. Show Description
Animals display reduced body bends and thrash rates, slow growth, and fragmented mitochondria. cjn20 is a 2629 bp deletion removing nucleotides 25-2654 of the fzo-1 locus. Originally published as cjn020. Reference: Byrne JJ, et al. Cell Mol Life Sci. 2019 May;76(10):1967-1985. (PMID 30840087)
|
|
| BZ873 |
C. elegans |
aaim-1(ok295) X. Show Description
Dopamine receptor knockout. [NOTE: (3/3/2025) ok295 was previously described as an allele of dop-3/T14E8.4, but is actually an allele of aaim-1/T14E8.4.1 according to current gene models.] Derived by out-crossing parental strain RB563. Outer Left Sequence: ttgctccagcggttctagtt. Outer Right Sequence: gactgtctaagcgaccagcc. Inner Left Sequence: ttgtttgcgggtttgataca. Inner Right Sequence: agaagcacgcggtagttgat. Inner Primer PCR Length: 3254. Estimated Deletion Size: about 1000 bp.
|
|
| CA1219 |
C. elegans |
unc-119(ed3) III; ieSi21 IV. Show Description
ieSi21 [sun-1p::sun-1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. ieSi21 was inserted into cxTi10882 IV using MosSCI. Expression of the transgenic SUN-1::mRuby fusion protein complements the sun-1 deletion allele. SUN-1::mRuby is expressed throughout the germline and in the early embryo, where it localizes to nuclear envelope and associates with chromosome pairing centers during early meiotic prophase. Reference: Rog O, Dernburg AF. Cell Rep. 2015 Mar 10. pii: S2211-1247(15)00178-3.
|
|
| CA998 |
C. elegans |
ieDf2 [unc-119+]/mIs11 IV. Show Description
mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. Heterozygotes are wild-type with dim GFP signal in the pharynx. mIs11 homozygotes are wild-type with bright GFP in the pharynx. ieDf2 homozygotes (non-GFP) develop normally but produce 97.5% inviable embryos and a high frequency of males among the surviving self-progeny. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against. GFP expression in 4-cell embryos, pharyngeal muscle and gut. ieDf2 is a deficiency of zim-1, zim-2, zim-3, and him-8 generated by MosDel, resulting in single-copy insertion of a copy of the C. briggsae unc-119 gene on Chromosome IV. The deletion spans the sequences from the beginning of the zim-1 coding sequence through the ttTi22866 Mos1 insertion site.
|
|
| CB1066 |
C. elegans |
mec-1(e1066) V. Show Description
Mechanosensory abnormal. Small. Lethargic. M-MATING++ 1-10%WT.
|
|
| CB1282 |
C. elegans |
dpy-20(e1282) IV. Show Description
Dpy. Temperature sensitive. Lethal cold sensitive. Male lethal. M-MATING++ 1-10%WT.
|
|
| CB1292 |
C. elegans |
mec-1(e1292) V. Show Description
Touch insensitive; lethargic.
|
|
| CB1338 |
C. elegans |
mec-3(e1338) IV. Show Description
Mechanosensory abnormal. Neurons/Touch abnormal. Lethargic. M-MATING++ 1-10%WT.
|
|
| CB1340 |
C. elegans |
mec-5(e1340) X. Show Description
Mechanorsensory abnormal. Touch insensitive. Lethargic. M-MATING+++ 10-30%WT.
|
|
| CB1408 |
C. elegans |
unc-83(e1408) V. Show Description
Marginally Unc-cannot back. Lethargic. Migration pre VC defect. M-MATING+POOR <1%WT.
|
|
| CB1413 |
C. elegans |
lin-7(e1413) II. Show Description
Vulvaless. Incomplete penetrance. Recessive. Males can mate.
|
|
| CB1472 |
C. elegans |
mec-6(e1342) I. Show Description
Mechanosensory abnormal. Touch insensitive. Lethargic.
|
|
| CB1477 |
C. elegans |
mec-7(e1343) X. Show Description
Mechanosensory abnormal - semidominant. Lethargic at 25C. Neurons/Touch abnormal.
|
|
| CB1494 |
C. elegans |
mec-9(e1494) V. Show Description
Mechanosensory abnormal. Touch insensitive. Lethargic. Recessive. M-MATING++ 1-10%WT.
|
|
| CB1515 |
C. elegans |
mec-10(e1515) X. Show Description
Touch insensitive. Lethargic.
|
|
| CB1747 |
C. elegans |
unc-13(e309) I; sup-6(st19)/+ II; daf-1(e1146) IV. Show Description
Heterozygotes are WT and segregate WT, UncDaf and Lethals. Suppressed Unc in hets. Suppressed Daf in hets. sup-6 is recessive lethal.
|
|
| CB188 |
C. elegans |
dpy-14(e188) I. Show Description
Dpy. Abnormal larvae. Temperature sensitive: lethal at 25C. M-MATING-NO SUCCESS.
|
|
| CB2619 |
C. elegans |
eDf1 eDp21/dpy-11(e224) V. Show Description
Heterozygotes are WT and segregate WT, Dpy and lethals which die in larval development. See also WBPaper00001202.
|
|
| CB2620 |
C. elegans |
daf-9(e1406)/lon-2(e678) X. Show Description
Heterozygotes are WT and segregate WT, lethal dauers (DAUER-LIKE LARVAE) and Lon. Can recombine; check for correct segregation of progeny to maintain.
|
|
| CB2987 |
C. elegans |
unc-13(e309) I; dpy-10(e128) sup-6(st19)/dpy-10(e128) II. Show Description
Dominant suppressor of Unc. Dpy. sup-6 is recessive lethal. Heterozygotes are Dpy non-Unc. Pick Dpy non-Unc to maintain.
|
|
| CB3019 |
C. elegans |
unc-54(e1258) I; eDf1 eDp21/+ V. Show Description
Movement slow. Suppressed Unc. Revertant. Heterozygotes move slowly and segregate larval lethals (eDf1 eDp21 homozygotes), and paralyzed Uncs.
|
|
| CB3202 |
C. elegans |
hch-1(e1734) X. Show Description
Delayed hatching from egg shell. QL and descendant cells migrate forward instead of backward (incomplete penetrance).
|
|