| CZ3715 |
C. elegans |
gcy-33(ok232) V. Show Description
1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele.
|
|
| XA2262 |
C. elegans |
gcy-33(ok232) V; gcy-31(ok296) X; qaIs2241. Show Description
qaIs2241 [gcy-36p::egl-1 + gcy-35p::GFP]; causes genetic ablation of AQR, PQR, and URX neurons. Some residual neurons in the tail remain GFP+ from the gcy-35::GFP transgene.
|
|
| DA1290 |
C. elegans |
lin-15B&lin-15A(n765) X; adEx1290. Show Description
adEx1290 [gcy-33::GFP + lin-15(+)]. Maintain by picking non-Muv. gcy-33::GFP in BAG. n765 is temperature-sensitive.
|
|
| PS8562 |
C. elegans |
syIs663; syIs300. Show Description
syIs663 [gcy-33p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for BAG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
|
|
| RJP56 |
C. elegans |
egl-46(rp4) vsIs33 V; rpIs3. Show Description
rpIs3 [gcy-33p::GFP]. vsIs33 [dop-3::RFP] V. Loss of BAG neuron specification. egl-46(rp4) is a point mutation that causing a single amino acid change (C185Y) in the zinc finger domain of EGL-46; it behaves like a null for BAG specification phenotypes.
|
|