Strain Information
| Name | CZ3715 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | gcy-33(ok232) V. |
| Description | 1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele. |
| Mutagen | UV/TMP |
| Outcrossed | x4 |
| Made by | Martin Hudson |
| Laboratory | CX |
Sign in
or
register an account if you want to order this strain.