More Fields
Strain Species Genotype
AB2 C. elegans Show Description
Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII).
BB2 C. elegans adr-1(gv6) I. Show Description
Defective chemotaxis to volatile odorant. Low percentage (about 6%) have protruding vulva.
BC11061 C. elegans dpy-5(e907) I; sEx11061. Show Description
sEx11061 [rCes F39B2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11410 C. elegans dpy-5(e907) I; sEx11410. Show Description
sEx11410 [rCes M04B2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11841 C. elegans dpy-5(e907) I; sIs11122. Show Description
sIs11122 [rCes T22B2.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11928 C. elegans dpy-5(e907) I; sIs10491. Show Description
sIs10491[rCesR12B2.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12898 C. elegans dpy-5(e907) I; sIs11074. Show Description
sIs11074 [rCesC47B2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12995 C. elegans dpy-5(e907) I; sIs11076. Show Description
sIs11076 contains [rCes C47B2.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13135 C. elegans dpy-5(e907) I; sEx13135. Show Description
sEx13135 [rCesW05B2.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13307 C. elegans dpy-5(e907) I; sIs12976. Show Description
sIs12976 [rCes C34B2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13436 C. elegans dpy-5(e907) I; sEx13436. Show Description
sEx13436 [rCesT08B2.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14848 C. elegans dpy-5(e907) I; sEx14848. Show Description
sEx14848 [rCesC47B2.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15507 C. elegans dpy-5(e907) I; sEx15507. Show Description
sEx15507 [rCesT08B2.7b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC16016 C. elegans dpy-5(e907) I; sEx16016. Show Description
sEx16016 [rCesF19B2.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC5124 C. elegans sEx272. Show Description
sEx272 [R12B2 (III) + pCes1943[rol-6(su1006)]]. 8.2 ng/ul R12B2 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
CB2 C. elegans vab-1(e2) II. Show Description
Notched head. Penetrance <70%.
CB4613 C. elegans unc-32(e189) tra-1(e1575e1816e1831) III; eDp6 (III;f). Show Description
Unc-32 hermaphrodites segregating Unc hermaphrodites and Unc Tra homozygous XX pseudomales with variable male tails, hermaphroditic gonads and adult yolk production. Class B2 allele (male tail, sterile hermaphrodite gonad) derived by mutation of tra-(gf) allele e1575. Reference: Hodgkin (1987) PMID:3428597.
DH2 C. elegans zyg-11(b2) II. Show Description
Temperature sensitive. Leaky. Penetrance incomplete. Semi-dominant. Cleavage abnormal. Maternal effect(m,m). Received new stock from Edward Kipreos 7/2003.
DLW109 C. elegans wrdSi23 I; unc-104(knu973[unc-104::AID]) II. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
DLW110 C. elegans wrdSi23 I; unc-18(knu969[unc-18::AID]) X. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
DLW124 C. elegans wrdSi22 I; unc-52(knu968[AID::unc-52]) II. Show Description
wrdSi22 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
DM7133 C. elegans pha-1(e2123) III; raEx133. Show Description
raEx133 [C47B2.2::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
JK2906 C. elegans mep-1(q660) IV/nT1 [qIs51] (IV;V). Show Description
M04B2.1 Throws Steriles and GFP(+) nT1 heterozygotes and dead eggs. The nT1 chromosome is apparently homozygous lethal since Vul worms are not seen. For some reason, crosses with this nT1[qIs51] chromosome generate an excess of male progeny. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
KB2 C. elegans glh-2(um2) I. Show Description
MCJ11 C. elegans mir-35(cdb2 cdb4) II. Show Description
Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ13 C. elegans mir-35(cdb2 cdb6) II. Show Description
The seed region of the mature mir-35 is replaced with random nucleotides in mir-35(cdb2 cdb6). This mutant mir-35 has little impact on embryonic mir-35 abundance but strongly inhibits its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.
MCJ180 C elegans mir-35(cdb2 cdb72) II. Show Description
cdb2 cdb72 is a mutation to the 3' end of the mature mir-35 creating a 3’ end containing nucleotides that are not present or rare among all mir-35 family members at a given position, while preserving overall GC content. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.
MCJ191 C elegans mir-35(cdb2 cdb78) II. Show Description
cdb2 cdb78 is a mutation to the 3' end of the mature mir-35 creating a mutant with mir-35 seed sequence and mir-82 3’ end. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.
MCJ217 C. elegans mir-35(cdb2 cdb4) II; egl-1(cdb97) V. Show Description
Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ259 C. elegans cex-2(cdb130) mir-35(cdb2 cdb4) II; T28D6.4(cdb133) unc-49(cdb134) IV; egl-1(cdb97) V. Show Description
Superficially wild-type. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
NC1015 C. elegans unc-119(ed3) III; wdEx457. Show Description
wdEx457 [F39B2.8::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in pharyngeal muscles, posterior ventral cord motor neurons, tail neurons, and a few head neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.
NC138 C. elegans dpy-20(e1282) IV; wdIs3 X. Show Description
wdIs3[del-1::GFP + dpy-20(+)]. del-1 is expressed in the VB motor neurons beginning the the L2 larval stage. By the end of L2, del-1::GFP is also visible in a few VA motor neurons at the anterior end of the nerve cord. Expression of del-1::GFP in the VAs progresses in a wave from anterior to posterior, with all VAs expressing del-1::GFP by the adult stage. Thus, del-1::GFP is not expressed in the VAs during the L2 period in which unc-4 functions in those cells to establish synaptic inputs but is expressed in the VAs after they have been wired into the ventral cord circuit. del-1::GFP is also expressed in five neurons (VB1, VB2, SABVR, SABVL, VA1) in the retrovesicular ganglion at the anterior end of the ventral nerve cord. During the mid-L2 larval stage, del-1::GFP expression in the ventral nerve cord is largely restricted to the VB class of motor neurons.
OEB800 C. elegans tmem-107(oq100) I. Show Description
F39B2.9/TMEM-107 has been shown to control the localization of 4 peripheral ciliary transition zone proteins. tmem-107(oq100); nphp-4(tm925) double mutants display ultra-structural malformations in ciliary transition zones, and exhibit sensory abnormalities including roaming, chemoattractant, and dye-filling defects. TRAM-1::tdTomato leaks into cilia in oq100 mutants. Genotyping primers: Forward cgcggttcttcttgtttctt, Reverse wildtype gagatcgagacggcgacg, Reverse oq100 gaaaaacaacgtggaagtcca. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31.
OH4840 C. elegans otIs85. Show Description
otIs85 [F59B2.13::GFP + rol-6(su1006)]. Rollers. Not constipated.
PB2 C. elegans him-5(e1490) V; vab-3(bx23) egl-15(n484) X. Show Description
Type A Egl. Males abnormal-fused rays. See also WBPaper00002235.
PS2444 C. elegans dpy-20(e1282) IV; syIs36. Show Description
syIs36 [(pLB2) egl-30(+) + pBS + (pMH86) dpy-20(+)]. Integrated version of syEx126 (egl-30 over-expressing line). Easily reverted. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3722 C. elegans unc-119(ed4) III; syIs101 IV. Show Description
syIs101[T04B2.6::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3724 C. elegans unc-119(ed4) III; syIs102 X. Show Description
syIs102[T04B2.6::cfp + unc-119(+)] X. Expressed in vulB and vulD. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RB1112 C. elegans C45B2.6(ok1098) X. Show Description
C45B2.6 Homozygous. Outer Left Sequence: ACACAGTCCGACAAAACGTG. Outer Right Sequence: GTTTTCCCCGAAAAGGTTGT. Inner Left Sequence: TACGCGGATGCTCAACATAA. Inner Right Sequence: GAAAGGCACCGGTGATTAAA. Inner Primer PCR Length: 3227. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1164 C. elegans aly-2(ok1203) IV. Show Description
F23B2.6 Homozygous. Outer Left Sequence: atgcggaataacggagtgtc. Outer Right Sequence: atcagtttgcagcttccgat. Inner Left Sequence: cgcgaattcacacacaaagt. Inner Right Sequence: tggcttctggagggatagtg. Inner Primer PCR Length: 2266. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1177 C. elegans F23B2.3(ok1226) IV. Show Description
F23B2.3 Homozygous. Outer Left Sequence: tgcttcgattgattgctcac. Outer Right Sequence: ggaggttacgcatccaaaaa. Inner Left Sequence: tcggattttcctttgcattc. Inner Right Sequence: ttcgcctcctatatcccctt. Inner Primer PCR Length: 2845. Estimated Deletion Size: about 2050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1397 C. elegans F23B2.7(ok261) IV. Show Description
F23B2.7 Homozygous. Outer Left Sequence: atcggaagctgcaaactgat. Outer Right Sequence: ccttcgatttttccgattca. Inner Left Sequence: tacatgtcgtgcatggttcc. Inner Right Sequence: cgccagaatatccttttcca. Inner Primer PCR Length: 1915. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1483 C. elegans ifa-4(ok1734) X. Show Description
K05B2.3 Homozygous. Outer Left Sequence: atgtttcactttggcggttc. Outer Right Sequence: agagcgaataccgaagctca. Inner Left Sequence: cgagagtaattccgggttca. Inner Right Sequence: tcgcaagatggagaaggact. Inner Primer PCR Length: 2608. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1779 C. elegans fbxb-67(ok2287) I. Show Description
F49B2.2. Homozygous. Outer Left Sequence: ACAATGCAACACCCTGTCAA. Outer Right Sequence: TCACAGGTGAATGAGAAGCG. Inner Left Sequence: TATCCCAAACAGGTTGCACA. Inner Right Sequence: GGGAAATGAGCTAGAAGGGG. Inner Primer PCR Length: 2132 bp. Deletion Size: 1154 bp. Deletion left flank: CTACTCTTTGCCCCTTATTGCTCTTCTGTA. Deletion right flank: AGGTGAAAGTTTACATAGGACACCCCTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1792 C. elegans inx-7(ok2319) IV. Show Description
K02B2.4. Homozygous. Outer Left Sequence: AGCTAGTCATGGGGAGCAAA. Outer Right Sequence: ACGTCTGAAGGTTCGTGCTT. Inner Left Sequence: GGCTGTCTTCGGAATTTTTG. Inner Right Sequence: CAAGTGCGTCGTTCATCATC. Inner Primer PCR Length: 3021 bp. Deletion Size: 1610 bp. Deletion left flank: AGTTCTGAAAATTGAAATTATTTTAAATTT. Deletion right flank: TTTTTTGACAAATCTCGGTCGATTTCCACC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1806 C. elegans fbxb-8(ok2340) I. Show Description
F49B2.1. Homozygous. Outer Left Sequence: TCGATTCGAATGGTTGTTCA. Outer Right Sequence: ACGTCATATGTGGCGCATTA. Inner Left Sequence: ACATAGGACACCCCTTGTCG. Inner Right Sequence: CCCGCATTTTTGTAGATCGT. Inner Primer PCR Length: 2880 bp. Deletion Size: 1799 bp. Deletion left flank: AGCTTCGATCACGATTCAGAGCAGTTTTGT. Deletion right flank: TCAATCCCGGCAATTTGCCGATTTACTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1818 C. elegans C18B2.6(ok2353) X. Show Description
C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 2211 bp. Deletion left flank: CCGACTGTGTGACGTACTATTTCTGCGACG. Deletion right flank: AATATTCTCGAAAGGCAGATCCATGGACGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1824 C. elegans C18B2.6(ok2360) X. Show Description
C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 1608 bp. Deletion left flank: ATAGTATATGTCAAGTATAATTTTTCGTTT. Deletion right flank: ATGTTTCTCGTAATAGATATAAGCTGTCGT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1956 C. elegans C47B2.7(ok2572) I. Show Description
C47B2.7 Homozygous. Outer Left Sequence: ttggcgcgaaattacttttt. Outer Right Sequence: ttggaagctaaaaagccgac. Inner Left Sequence: caatatttagcgcgaaaccaa. Inner Right Sequence: aaaaaggctccaaaccttga. Inner Primer PCR Length: 1183. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1976 C. elegans uev-1(ok2610) I. Show Description
F39B2.2. Homozygous. Outer Left Sequence: GAAATGCGTACTCGCACTGA. Outer Right Sequence: GGAAAAGTTCGAGGGGAAAG. Inner Left Sequence: ACGGATTTATTCGGATGGGT. Inner Right Sequence: TACCGGGGAGAGTAAACTGG. Inner Primer PCR Length: 1301 bp. Deletion Size: 480 bp. Deletion left flank: CTTGTCCGAGAGGACTACACAGTTAGCCTT. Deletion right flank: CCGTTCGTTTCACCACCAAAGTTCACATGG. Insertion Sequence: TGCAAACGCGCTCCACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807