Search Strains

More Fields
Strain Species Genotype Add
LP307 C. elegans cpIs54 II; unc-119(ed3) III. Show Description
cpIs54 [mex-5p::mKate::PLC(delta)-PH(A735T)::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
LP308 C. elegans cpIs55 II; unc-119(ed3) III. Show Description
cpIs55 [mex-5p::mCherry-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
LP316 C. elegans hmp-2(cp78[GFP::hmp-2a + LoxP]) III. Show Description
cp78[gfp::hmp-2 + LoxP] III. GFP inserted at the N terminus of endogenous hmp-2 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar in the second synthetic intron of GFP. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
LP402 C. elegans cpIs64 II; unc-119(ed3) III. Show Description
cpIs64 [mex-5p::mYPet::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
LP462 C. elegans mrck-1(cp189[mrck-1::GFP::3xFlag]) V. Show Description
cp189[mrck-1::GFP::3xFlag]. GFP inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
LS721 C. elegans stn-1(ok292) I. Show Description
Viable allele of stn-1. dys-1-like. Hyperactive, tend to hypercontract, bends head when moving forward. F30A10.8.
LSD1091 C. elegans smg-1(cc546) I; xchEx91. Show Description
xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LSD1097 C. elegans smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LV15 C. elegans unc-45(st601)/daf-7(e1372) par-2(it46) III. Show Description
st601 is a non-conditional two-fold arrest lethal. Maintain at 25C to see daf-7 par-2 segregants (Daf-7(+) escapers will be Par). WT heterozygotes segregate WT, DafPar, 1/4 lethal eggs and two-fold arrest hatchlings. [3/97: dauers are not giving dead eggs-they are giving more dauers. The par-2 mutation may be lost.]
LV18 C. elegans unc-45(wc1) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (dauer escapers will be Par and give only dead eggs), and DpyUcs which arrest as dead eggs (range from twitching multicellulars to 3-folds that hatch). [There is a greater percentage of hatchlings when the mother is heterozygous (wc1 dpy-1/+). There may also be the possibility of near complete maternal rescue (near full-sized, sterile Dpys), but this has not been routinely observed in the balanced strain (as opposed to wc1 dpy-1/+).] Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: The dauers are not giving dead eggs-they are giving other dauers. Appears that the Par mutation is no longer present.]
LV19 C. elegans unc-45(wc2) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (escapers will be Par and give only dead eggs) and DpyUncs which are dead eggs (a range of embryonic lethality from multicellular twitchers to 3-folds that do not hatch). Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: the dauers are giving dead eggs.]
LW905 C. elegans lmn-1(tm1502) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1502 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
LX1270 C. elegans rsbp-1(vs163) I. Show Description
vs163 is a 169 bp deletion removing exon 2 and causing frameshift.
LX160 C. elegans rgs-2(vs17) X. Show Description
rgs-2=F16H9.1, a C. elegans RGS (Regulator of G protein Signaling) gene. vs17 is a presumptive null allele. vs17 is a 1136 bp deletion of sequences with limits: ATATATATATCTCATTACTGG...AATCAAGTGTAACACTAATAT. rgs-1;rgs-2 double mutants fail to rapidly turn on egg-laying behavior when fed after starvation.
LX1918 C. elegans vsIs164 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs164 [unc-103p(E)::GCaMP5 + unc-103p(E)::mCherry + lin-15(+)] X. Integrated transgene using unc-103e promoter to drive GCaMP5 and mCherry expression in vulval muscles; useful for visualizing and quantitating calcium influx in vulval muscle cells. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX1960 C. elegans lite-1(ce314) lin-15B&lin-15A(n765) X; vsIs172. Show Description
vsIs172 [lin-11(enhancer)::pes-10p::GCaMP5 + lin-11(enhancer)::pes-10p::mCherry + lin-15(+)]. Integrated transgene using lin-11 enhancer region fused to the pes-10 basal promoter to drive GCaMP5 and mCherry expression in VC motor neurons; useful for visualizing and quantitating calcium influx in VC motor neurons. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX1986 C. elegans vsIs177 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs177 [ocr-2p::GCaMP5::ocr-2 3'UTR + ocr-2p::mCherry::ocr-2 3'UTR + lin-15(+)] X. Integrated transgene using ocr-2 promoter to drive GCaMP5 and mCherry expression in uv1; useful for visualizing and quantitating calcium influx in uv1 cells. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX2004 C. elegans vsIs183 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs183 [nlp-3p::GCaMP5::nlp-3 3'UTR + nlp-3p::mCherry::nlp-3 3'UTR + lin-15(+)] X. Integrated transgene using nlp-3 promoter to drive GCaMP5 and mCherry expression in HSN; useful for visualizing and quantitating calcium influx in HSN. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX242 C. elegans rgs-3&heri-1(vs19) II. Show Description
Healthy and appears grossly WT. This allele is a 1563 bp deletion of sequences AATTGAGTAGACAAC....GTGTCTTAAATAT. Removes almost all of the 2nd RGS domain. Previously known as cec-9.
MAH235 C. elegans sqIs19. Show Description
sqIs19 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Rollers. Slightly longer lived at 20C. hlh-30::GFP expression should be visible at relatively low magnification. [NOTE: the array does not segregate 100% in original stock; pick GFP+ and check for correct segregation to maintain the array. New stock recevied at CGC June, 2016.] Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.
MAH240 C. elegans sqIs17. Show Description
sqIs17 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Rollers. Slightly longer lived at 20C. hlh-30::GFP expression should be visible at relatively low magnification. Derived from JIN1679. Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.
MCJ180 C elegans mir-35(cdb2 cdb72) II. Show Description
cdb2 cdb72 is a mutation to the 3' end of the mature mir-35 creating a 3’ end containing nucleotides that are not present or rare among all mir-35 family members at a given position, while preserving overall GC content. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.
MCJ317 C. elegans gldr-2(cdb187) I. Show Description
Superficially wild-type. Reference: Vieux K-F, et al. Nucleic Acids Res. 2021. doi:10.1093/nar/gkab840 PMID: 34586415
MD4195 C. elegans unc-119(ed3) III; bcSi69 IV. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. [NOTE: MD4195 can be maintained at 20C instead of 15C because it does not carry an array with guide RNAs targeting essential genes.] Generated in parental strain EG8081. Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4571 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1367. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1367 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1367 array contains a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4572 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1368. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4574 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1370. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1370 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-1 locus) + U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1370 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I) and a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MG278 C. elegans K08E3.5(ok233) III. Show Description
TI223.E1: AGACTTGAAGGAAACGCGAA. TI223.E2: AATCAAATTGAAACGGCTCG. TI223.I1: AATCCTTGCCAACCAAACAG. TI223.I2: CGTAGCATCCTTGGACCAGT. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
MG685 C. elegans xsSi43 II; unc-119(ed3) III. Show Description
xsSi43 [cyk-4p::cyk-4::GFP::pie-1 3'UTR + Cbr-unc-119(+)] II. CYK-4::GFP fusion protein expressed in germline and embryo. [NOTE: previously published as mgSi43.] Reference: Zhang D & Glotzer M. Elife. 2015 Aug 7;4.
MG827 C. elegans unc-119(ed3) III; xsSi36 IV. Show Description
xsSi36 [myo-2p::GFP(Y66C)::let-858 3'UTR + Cbr-unc-119(+) IV:13,048,924]. This strain contains a non-fluorescent GFP that can be used to enrich for CRISPR mediated, oligodirected homologous recombination. [NOTE: previously published as mgSi36.]  Reference: Zhang D & Glotzer M. 2014. Efficient site-specific editing of the C. elegans genome. doi: http://dx.doi.org/10.1101/007344.
MH1019 C. elegans soc-2(ku167) IV. Show Description
No obvious phenotype alone. ku167 suppresses let-60(n1046). Previously called sur-8.
MH1131 C. elegans soc-2(ku167) let-60(n1046) IV. Show Description
Less than 5% Muv. Previously called sur-8(ku167).
MH1157 C. elegans him-5(e1490) V; egl-13(ku194) X. Show Description
ku194 is a loss of function allele, likely to be molecular null. Connection of gonad defective, >95% Egl. Anchor cell and uterine seam cell do not fuse. Males can mate. Hermaphrodites are very difficult to mate. Previously called cog-2(ku194).
MH2805 C. elegans kuIs70. Show Description
kuIs70 [alr-1p::GFP + rol-6(su1006)]. Rollers. alr-1p::GFP expression is visible in embryonic and adult tissues. Reference: Tucker M, et al. Mol Biol Cell. 2005 Oct;16(10):4695-704.
MH5015 C. elegans kuIs118 II; unc-119(ed3) III. Show Description
kuIs118 [daf-15p::daf-15::mCherry + Cbr-unc-119(+)] II. kuIs118 is a single copy insertion into ttTi5605 via CRISPR/Cas9. Superficially wild-type. mCherry expression observed throughout the body. mCherry detected throughout development by western blot with anti-mCherry antibody, with highest expression levels in early larval stages. Reference: Sewell AK, et al. "The TORC1 phosphoproteome in C. elegans reveals roles in transcription and autophagy” iScience, 20 May 2022, 104186. https://www.sciencedirect.com/science/article/pii/S2589004222004564.
MH801 C. elegans sur-7(ku119) X. Show Description
No obvious morphological phenotype on its own. Good suppressor of Muv of let-60(n1046).
MIR262 C. elegans risls32. Show Description
risls32 [grh-1p::grh-1b::GFP + unc-119(+)]. Over-expression of grh-1 from its endogenous promoter. Short lived, no GFP signal visible. Reference: Grigolon G, et al. Nat Commun. 2022 Jan 10;13(1):107. doi: 10.1038/s41467-021-27732-4. PMID: 35013237.
ML503 C. elegans tra-2(q276)/rol-6(e187) II; mcDf2/dpy-8(e130) X. Show Description
Segregates WT, males, Dpy, Rol, DpyRol, dead eggs (mcDf2). Use XX tra-2 males to move mcDf2 around. mcDf2 is an approx. 500 kb deficiency removing a large chunk between mec-2 and sup-7 (non-inclusive).
MLC1092 C. elegans lucSi100 II; unc-119(ed3) III. Show Description
lucSi100 [hsp16.41::vhhGFP4::zif-1::SL2::mCherry::his-11::tbb-2 3'UTR] II. Superficially wild-type morphology. Single-copy insertion of a GFP-nanobody::zif-1 fusion transgene under a heat-shock promoter. Allows conditional depletion of GFP-tagged proteins in all tissues via heat-shock expression of anti-GFP nanobody fusion to ZIF1 (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). (Wang et al. (2017). A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development 144, 2694-2701.)
MLC1094 C. elegans lucSi102 II; unc-119(ed3) III. Show Description
lucSi102 [hsp16.41::zif-1::SL2::mCherry::his-11::tbb-2 3'UTR] II. Superficially wild-type morphology. Single-copy insertion of a zif-1 transgene under a heat-shock promoter. Used as control for MLC1092 or for conditional depletion of ZF1 degron-tagged proteins (aka ZF) in all tissues via heat-shock expression of ZIF-1. (Wang et al. (2017) A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development 144, 2694-2701.)
MLC1729 C. elegans drsh-1(luc82[myc::AID*::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID*::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.
MLC2230 C. elegans vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MLC2543 C. elegans dct-1(luc194) X. Show Description
CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MLC603 C. elegans lucEx421. Show Description
lucEx421 [mir-4813p::myr::GFP::unc-54 3’UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Reporter contains 1kb upstream mir-4813 promoter sequence and 1kb unc-54 3’UTR downstream sequence. Provides a marker for pharyngeal muscle cell-cell fusion. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MLC903 C. elegans nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X, lucIs24. Show Description
lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Pick GFP+ animals to maintain balanced line. Balanced mir-51 family mutant expressing a mirtron-version of mir-51. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP mir-51 family homozygous mutants. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Non-GFP mir-51 family homozygous mutants rescued by mirtron-51 transgene are viable, but slow-growing and sick. Strain is derived from injection into parental strain MT17143. lucIs24 is a spontaneous integrant originating from a complex extra-chromosomal array, the genomic location of the transgene is unknown. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLY80 C. elegans Probably has multiple mutations. Show Description
Slow generation time, 6-7 days. Progeny production and survival to reproduction are reduced.
MP108 C. elegans ndg-4(lb108) III; bus-1(lb201) V. Show Description
lb108 is inseparable from dpy-17(e164). Brood size is less than 25% of wild type. Eggs display a variable pale color. 70-95% of adults survive overnight incubation with 0.5 ug/ul nordihydroguairetic acid.
MQ141 C. elegans dpy-17(e164)/clk-1(e2519) clk-2(qm37) III. Show Description
Hets are WT and segregate WT, Dpys and maternally rescued clk double mutants (WT). To study clk double mutants, pick WT worms singly onto plates. Maternally rescued clk-1 clk-2 worms segregate very slow hatching and developing progeny and no Dpys. Double mutants do not give a viable strain but rather die out over a few generations.
MQ1766 C. elegans sod-2(ok1030) I; sod-5 (tm1146) sod-1(tm783) II; sod-4(gk101) III; sod-3(tm760) X. Show Description
Normal lifespan. Increased sensitivity to oxidative stress, osmotic stress, cold stress, and heat stress. Slow development, slow physiological rates (thrashing, defecation), and reduced fertility. van Raamsdonk J & Hekimi S. Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5785-90.
MQ452 C. elegans aptf-2(qm27) IV. Show Description
Dorsal protrusions on head and tail. Head frequently twisted. 30% of embryos die. 86% of larvae die. 44% of adult survivors show a mutant phenotype. Full zygotic and maternal rescue.