| JDW766 |
C. elegans |
piit-1(wrd302[piit-1::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous piit-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW767 |
C. elegans |
ctsa-1.1(wrd303[ctsa-1.1::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous ctsa-1.1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW769 |
C. elegans |
lon-8(wrd305[lon-8::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous lon-8 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW778 |
C. elegans |
K10D3.4(wrd296 wrd310[K10D3.4::mScarlet::2xOLLAS]) I. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous K10D3.4 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd296.
|
|
| JDW780 |
C. elegans |
col-125(wrd300 wrd312[col-125::mScarlet::2xOLLAS]) IV. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-125 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd300.
|
|
| JDW781 |
C. elegans |
col-103(wrd301 wrd313[col-103::mScarlet::2xOLLAS]) IV. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-103 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd301.
|
|
| JDW782 |
C. elegans |
piit-1(wrd302 wrd314[piit-1::mScarlet::2xOLLAS]) V. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous piit-1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd302.
|
|
| JDW783 |
C. elegans |
ctsa-1.1(wrd303 wrd315[ctsa-1.1::mScarlet::2xOLLAS]) II. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous ctsa-1.1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd303.
|
|
| JDW785 |
C. elegans |
lon-8(wrd305 wrd317[lon-8::mScarlet::2xOLLAS]) V. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous lon-8 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd305.
|
|
| JDW786 |
C. elegans |
srap-1(wrd318[srap-1::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted in the first exon after the signal sequenceof the endogenous srap-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW788 |
C. elegans |
col-166(wrd319[col-166::mNG::3xFLAG]) X. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally to produce a translational fusion after amino acid 120 in the endogenous col-166 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW789 |
C. elegans |
lrp-1(wrd320[lrp-1::mNG::3xFLAG]) I. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in the last exon of the endogenous lrp-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW794 |
C. elegans |
dpy-14(wrd229 wrd325[dpy-4::mScarlet::2xOLLAS) I. Show Description
mScarlet::2xOLLAS tag inserted at the C-terminus of the endogenous dpy-14 locus by CRISPR. Generated by replacing mNG::3xFLAG with mScarlet::2xOLLAS in parental strain JDW651.
|
|
| JDW802 |
C. elegans |
dao-2(wrd328[dao-2::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dao-2 locus by CRISPR using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW820 |
C. elegans |
col-159(wrd339)[col-159::linker::mNG::3xFLAG::linker]) V Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-159 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW827 |
C. elegans |
col-118(wrd343[col-118::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-118 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW828 |
C. elegans |
col-13(wrd344[col-13::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-13 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW829 |
C. elegans |
col-10(wrd345[col-10::linker::mNG::3xFLAG::linker (internal)]) V Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 2 of the endogenous col-10 locus by CRISPR which will produce a translational fusion after amino acid 89. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW834 |
C. elegans |
unc-119(kst33) col-97(wrd346[col-97::internal mNG::3xFLAG + unc-119(+)]) III. Show Description
Superficially wild type. Modular linker::mNeonGreen::3xFLAG::linker tag inserted in the endogenous col-97 locus by CRISPR to produce a translational fusion inserted internally near the C-terminus (after amino acid 288). Allele obtained using plasmid-based unc-119 selection. Injection of a Cre recombinase plasmid failed to excise the loxP-flanked unc-119(+) cassette for unknown reasons. The insert was verified to be correct through Sanger sequencing. Knock-in is linked to the temperature-sensitive unc-119(kst33) allele. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW850 |
C. elegans |
col-75(wrd349[col-75::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-75 locus by CRISPR. Allele obtained using plasmid-based unc-119 selection in a temperature-sensitive unc-119(kst33) III background The unc-119(+) cassette was removed through Cre-mediated excision and the unc-119(kst33) allele was removed by outcrossing. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW877 |
C. elegans |
wrt-2(wrd365[linker::mNG::3xFLAG::linker (internal)]) X Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 1 in the endogenous col-75 locus by CRISPR; produces a translation fusion after amino acid 18, immediately following the signal peptide.. Allele obtained using plasmid-based unc-119 selection in a temperature-sensitive unc-119(kst33) III background The unc-119(+) cassette was removed through Cre-mediated excision and the unc-119(kst33) allele was removed by outcrossing. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW894 |
C. elegans |
cpz-1(wrd128 wrd379[cpz-1::internal mScarlet::2xOLLAS]) I. Show Description
Superficially wild type. Linker::mScarlet::2xOLLAS::linker inserted internally, to produce a translational fusion 11 amino away from the C-terminus of the endogenous cpz-1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd128.
|
|
| JDW910 |
C. elegans |
crim-1(wrd384[crim-1::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous crim-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. Superficially wild type.
|
|
| JDW92 |
C. elegans |
wrdSi19 nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I; him-5(e1490) V. Show Description
wrdSi19 [mex-5p::TIR1:F2A:mTagBFP2:AID*::NLS::tbb-2 3'UTR] (I:-5.32). Strain allows germline-specific depletion of NHR-23::AID*LLTEV::3xFLAG using the auxin-inducible degron system. wrdSi19 was made by crossing parental strain KRY87 to JDW83 [wrdSi10 (mex-5p::TIR1:F2A:mTagBFP2:tbb-2 3?UTR+SEC, I:-5.32); him5(e1490) V] and using heatshock to remove the SEC. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.
|
|
| JH2800 |
C. elegans |
unc-119(ed3) III; axIs1964. Show Description
axIs1964 [mex-5p::GFP::TEV::FLAG::mex-5::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
|
|
| JH2801 |
C. elegans |
unc-119(ed3) III; axIs1965. Show Description
axIs1965 [mex-5p::GFP::TEV::FLAG::mex-5::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
|
|
| JH2932 |
C. elegans |
unc-24(e1172) mbk-2(pk1427) IV/nT1[let-?(m435)] (IV;V); ddEx16. Show Description
ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.
|
|
| JH3186 |
C. elegans |
gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3188 |
C. elegans |
mex-5(ax2041[3xFLAG::mex-5]) IV. Show Description
Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3193 |
C. elegans |
nos-2(ax2049[3XFLAG::nos-2]) II. Show Description
Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3247 |
C. elegans |
meg-4(ax2080[meg-4::FLAG]) X. Show Description
C-terminal FLAG insertion in endogenous meg-4 locus. Reference: Wang JT, et al. eLife 2014;3:e04591.
|
|
| JH4008 |
C. elegans |
htp-3 (ax3010[htp-3::TEV::eGFP::myc::3Xflag]) I. Show Description
Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54.
|
|
| JH4072 |
C. elegans |
pgl-3(ax4517[pgl-3::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. Show Description
3xFlag tag inserted at C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)11291140. DOI: 10.1038/s41556-022-00940-w.
|
|
| JH4073 |
C. elegans |
pgl-3(ax4516[pgl-3(delta448-693)::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. Show Description
3xFlag tag inserted at truncated C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)11291140. DOI: 10.1038/s41556-022-00940-w.
|
|
| JH4484 |
C. elegans |
npp-11(4585[npp-11::AID*::3xFLAG]) I. Show Description
AID*::3xFLAG tags inserted at C-terminus of endogenous npp-11 locus. AID* is a minimal AID construct of 44 amino acids (https://academic.oup.com/genetics/article/217/3/iyab006/6104563). Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
|
|
| JIM173 |
C. elegans |
unc-119(tm4063) III; ujEx173. Show Description
ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
|
|
| JIM193 |
C. elegans |
ujIs113 II; ujIs193. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs193 [nhr-67::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0633cC01 by recombineering. Expression of transgene confirmed by GFP.
|
|
| JIM220 |
C. elegans |
ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
|
|
| JIM356 |
C. elegans |
ujIs113 II; ujIs153. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs153 [ceh-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0622c06 by recombineering. Expression of transgene confirmed by GFP.
|
|
| JJ2286 |
C. elegans |
unc-119(ed3) III; zuIs263. Show Description
zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
|
|
| JJ2300 |
C. elegans |
unc-119(ed3) III; zuIs258; zuIs263. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
|
|
| JJ2586 |
C. elegans |
cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Show Description
cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Endogenous cox-4 locus tagged with eGFP via genome editing. Mitochondria in all cell types are labeled with GFP. Reference: Raiders SA, et al. PLoS Genet. 2018 Jul 19;14(7):e1007417.
|
|
| JK4626 |
C. elegans |
cku-80(ok861) unc-119(ed3) III; qIs170. Show Description
qIs170 [gld-1p::gld-1::GFP::FLAG + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. Reference: Jeong J, Verheyden JM, Kimble J. PLoS Genet. 2011 Mar;7(3):e1001348.
|
|
| JK4871 |
C. elegans |
fog-3(q520) I; qSi41 II. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
|
|
| JK4942 |
C. elegans |
sygl-1(tm5040) I; qSi49 II; unc-119(ed3) III. Show Description
qSi49 [sygl-1p::3xFLAG::sygl-1::sygl-1 3UTR + unc-119(+)]. Superficially wild-type. Unknown whether or not unc-119(ed3) is still present in the background. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
|
|
| JK4996 |
C. elegans |
lst-1(ok814) I; qSi69 II; unc-119(ed3) III Show Description
qSi69 [lst-1p::lst-1::3xFLAG::lst-1 3UTR + unc-119(+)]. Superficially wild-type. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
|
|
| JK5028 |
C. elegans |
qSi77 II; unc-119(ed3) III. Show Description
qSi77 [mex-5p::eGFP::3xFLAG::tbb-1 3'utr::gpd-2 SL2 splice site::mCherry::3xMyc::pgl-1 RGG repeat::tbb-1 3'utr and intergenic region + unc-119(+)] inserted into ttTi5605 on LG II. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
|
|
| JK5200 |
C. elegans |
fog-1(q785) fog-3(q520) I; qSi41 II; qSi140 IV. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
|
|
| JK5500 |
C. elegans |
sygl-1(q828) I; qSi150 II. Show Description
qSi150 [sygl-1p::3X flag::sygl-1::tbb-2 3' UTR + Cbr-unc-119(+)] II. Phenotypically gravid, grows as a homozygote. Increased SYGL-1 protein expression, expanded progenitor zone, expanded GSC pool. Reference: Shin H. et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
|
|
| JK5758 |
C. elegans |
lst-1(q895[lst-1(long)::3xFLAG]) I. Show Description
3xFLAG tag inserted at the C terminus of the endogenous lst-1 locus, after V398 of the long isoform. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205
|
|