Search Strains

Unc. Roller. Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen).

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles and Uncs which give only dead eggs. This strain was mistakenly called emb-30 in the paper; it is not an emb-30 allele.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Wild type at 15C. Maternal effect embryonic lethal at 25C. Temperature sensitive period in oocyte and early embryogenesis.

Temperature sensitive. Maintain at 15C. pha-1(e2123) is embryonic lethal at 25C. Hermaphrodites have an abnormal tail: sometimes twisted, tail whip never formed, often bobbed; sometimes uncoordinated with bent tail. Adult male tail deformed also.

Dpy. cib-1 is a temperature sensitive maternal effect lethal. Grow at 15C. Produces dead eggs at 25C.

Temperature sensitive, maintain at 15C. At 25C, arrests at 1 to 24 cell stage. Will grow at 20C.

Temperature sensitive. Maintain at 15C. Will also grow at 20C, but not 25C.

Temperature sensitive. Maintain at 15C. At 25C the embryos arrest in late morphogenesis.

ts. Maintain at 15C. Some growth at 20C.

Temperature sensitive. Maintain at 15C. Embryonic lethal at 25C. Grows at 20C.

Temperature sensitive. Maintain at 15C. Some growth at 20C.

Temperature sensitive. Maintain at 15C, will not grow at 25C.

ts. Maintain at 15C. Some growth at 20C. 96% Emb at 25.6C and 25.8C.

Temperature sensitive. Maintain at 15C. Will grow at 20C, but not at 25C. [11/93: Not behaving as described. Very sick at 25C, but giving some live offspring which in turn give a few more live offspring.]

Temperature sensitive. Maintain at 15C. Embryonic lethal at 25C. Some growth at 20C.

Temperature sensitive. Maintain at 15C. At 25C the animals die as pretzels; a few hatch and die as L1. Will grow at 20C.

Temperature sensitive. Maintain at 15C. Embryonic lethal.(Some growth at 20C.) [11/93: Not behaving as described. Very sick at 25C, but giving some live offspring which in turn give a few more live offspring.]

Temperature sensitive. Maintain at 15C. Some growth at 20C and 25.4C--very leaky.

Temperature sensitive. Accumulates dead eggs at permissive temperature (15C). Will grow at 20C, but not 25C. [5/95: Not tight at 25C - a few embryos are surviving and reproducing.]

Temperature sensitive. Maintain at 15C. Some growth at 20C.

Temperature sensitive, maintain at 15C. At 25.6C 80% of the eggs arrest at lima bean and have abnormal gut granule birefringence. Leaky at 25C. Will grow somewhat at 20C also.

ts. Maintain at 15C. Some growth at 20C.

Temperature sensitive. Maintain at 15C. Will grow at 20C, but not at 25C.

ts. Maintain at 15C. (Some growth at 20C and 25.4C. 72% Emb at 25.6C and 25.8C)

Temperature sensitive. Maintain at 15C. Will also grow at 20C, but not 25C.

Temperature sensitive, maintain at 15C. At 25C the eggs arrest at lima bean and have normal gut granule birefringence. Will grow at 20C.

Temperature sensitive. Maintain at 15C. Will grow at 20C, but not 25C.

Temperature sensitive. Grow at 15C. Some growth at 20C. Does not grow at 25C.

Accumulates dead eggs at permissive temperature (15C). Will grow at 20C, but not at 25C. g60 pka emb-33.

Temperature sensitive-maintain at 15C. Some growth at 20C. Does not grow at 25C.

Temperature sensitive. Maintain at 15C. Embryonic lethal at 25C.

Temperature sensitive. Maintain at 15C. Will grow at 20C, but not at 25C.

gjIs140 [gpa-4::GFP + dpy-20(+)]. Reporter construct includes 2.5 kb upstream and the first exon of gpa-4 fused in frame with GFP. Reference: Burghoorn et al. Proc. Natl. Acad. Sci. USA 2007 Apr; 104(17):7157-62.

C-terminal GFP tag inserted into endogenous aco-2 locus. ACO-2::GFP is a mitochondrial marker allowing the examination of native mitochondrial morphology in live animals. Reference: Begelman DV, et al. 2022 Jul 17;2022:10.17912/micropub.biology.000599. doi: 10.17912/micropub.biology.000599. eCollection 2022. PMID: 35903774

Superficially wild-type. N-terminal tag of RAB-7 via CRISPR/Cas9 knock-in of mNeonGreen at rab-7 locus. Insertion verified by PCR. Left flank: 5' gcacaacaaaaaggcttccagtgaacaaaa 3'; Right flank: 5' ATGTCGGGAACCAGAAAGAAGGCGCTGCTC 3'. sgRNA: 5' cttccagtgaacaaaaATGT 3'

Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.

Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.

Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.

pgIs2 [gcy-8p::TU#813 + gcy-8p::TU#814 + unc-122p::GFP + gcy-8p::mCherry + gcy-8p::GFP + ttx-3p::GFP]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the gcy-8 promoter. Expression of GFP in coelomocytes and AIY neuron, and mCherry in AFD neuron when caspase activity is lost. Reference: Glauser DA, et al. Genetics. 2011 May;188(1):91-103.

uIs31 [mec-17p::GFP] III. pg79[TBB-1::TagRFP-T + loxP] is a CRISPR-mediated c-external tag in the endogenous tba-1 locus. Reference: Lockhead D. et al Mol Biol Cell. 2016 Nov 15; 27(23): 3717–3728.

GFP inserted into the endogenous vab-10a gene at its C-terminus by Cas9-triggered homologous recombination.

vab-10a(cas627 [vab-10a::TagBFP]) I.

mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.

Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.

mgEx470 [pdk-1(+) + ttx-3::GFP]. Pick GFP+ to maintain. 9.2-kb PCR product of genomic DNA from the pdk-1(+) genomic region containing 2.7 kb of 5' upstream regulatory sequence, 6.1 kb of coding sequencing containing introns and exons, and 0.4 kb of pdk-1 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.

yzIs71 [tph-1p::GFP + rol-6(su1006)] V. Rollers. tph-1 transcriptional reporter containing 3.1kb of tph-1 5’ regulatory sequence through the beginning of exon 4. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Sze JY, et al. Nature. 2000 Feb 3;403(6769):560-4.

xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. GFP expressed in many tissues. Partially rescued for daf-16 (daf-d).

mgIs45 [mir-84(+) + tub-1::GFP] I. mir-84 over-expressing line. Reference: Hayes GD, Riedel CG, Ruvkun G. Genes Dev. 2011 Oct 1;25(19):2079-92.