More Fields
Strain Species Genotype
BA1083 C. elegans F43G6.6(hc184) II. Show Description
Deletion allele of F43G6.6. No obvious phenotype in hermaphrodites. HES primers 162/163 outer and 164/165 inner.
BC10011 C. elegans dpy-5(e907) I; sEx842. Show Description
sEx842 [rCesC34G6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10146 C. elegans dpy-5(e907) I; sEx10146. Show Description
sEx10146 [rCesF58G6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11267 C. elegans dpy-5(e907) I; sEx11267. Show Description
sEx11267 [rCesK10G6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11369 C. elegans dpy-5(e907) I; sEx11369. Show Description
sEx11369 [rCesT03G6.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11513 C. elegans dpy-5(e907) I; sIs10779. Show Description
sIs10779 [rCes C04G6.3::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11787 C. elegans dpy-5(e907) I; sEx11787. Show Description
sEx11787 [rCes C34G6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12310 C. elegans dpy-5(e907) I; sEx12310. Show Description
sEx12310 [rCesR05G6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12956 C. elegans dpy-5(e907) I; sIs12739. Show Description
sIs12739 [rCesF25G6.5::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13491 C. elegans dpy-5(e907) I; sIs12001. Show Description
sIs12001 [rCes T06G6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13956 C. elegans dpy-5(e907) I; sEx13956. Show Description
sEx13956 [rCesC04G6.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14325 C. elegans dpy-5(e907) I; sEx14325. Show Description
sEx14325 [rCesR05G6.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14931 C. elegans dpy-5(e907) I; sEx14931. Show Description
sEx14931 [rCesC34G6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15233 C. elegans dpy-5(e907) I; sEx15233. Show Description
sEx15233[rCesC24G6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15287 C. elegans dpy-5(e907) I; sEx15287. Show Description
sEx15287 [rCesC24G6.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15653 C. elegans dpy-5(e907) I; sEx15653. Show Description
sEx15653[rCesC03G6.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC16070 C. elegans dpy-5(e907) I; sEx16070. Show Description
sEx16070 [rCes C41G6.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC16071 C. elegans dpy-5(e907) I; sEx16071. Show Description
sEx16071 [rCes C41G6.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC5373 C. elegans sEx443. Show Description
sEx443 [T11G6 (IV) + pCes1943[rol-6(su1006)]]. 20 ng/ul T11G6 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BFF68 C. elegans mjIs134 II; hrde-1(pig6[degron::ha::hrde-1]) III. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala/his-58/tbb-2 3'UTR + Cbr-unc-119(+)] II. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. gfp fluorescence in germline (mex-5::gfp). Control strain for BFF69; does not carry TIR1 transgene necessary for the degradation. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. (2020). Transgenerational Regulation of Sexual Attractiveness in C. elegans Nematodes. bioRxiv.
BFF69 C. elegans mjIs134 II; hrde-1(pig6[degron::ha::hrde-1]) III; ieSi38 IV. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala/his-58/tbb-2 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. Germline-expressed TIR1 and germline GFP. Allows for the degradation of hrde-1 and heritable RNAi deficiency in the presence of auxin. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. (2020). Transgenerational Regulation of Sexual Attractiveness in C. elegans Nematodes. bioRxiv.
DM7213 C. elegans raEx213. Show Description
raEx213 [T03G6.3 ORF::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.
DM7272 C. elegans pha-1(e2123) III; raEx272. Show Description
raEx272 [T11G6.8::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7338 C. elegans pha-1(e2123) III; raEx338. Show Description
raEx338 [C04G6.4::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
EG8844 C. elegans unc-119(ed3) III; oxTi889 V. Show Description
oxTi889 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:1.44). Insertion into F25G6.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
GG6 C. elegans emb-13(g6) III. Show Description
Temperature sensitive. Grow at 15C. Some growth at 20C. Does not grow at 25C.
IG6 C. elegans smf-1(eh5) X. Show Description
No phenotype. Contains a 2063 bp deletion in the smf-1 locus (K11G12.4) from position 17016 to position 19079 on the K11G12 cosmid. eh5 was obtained from the Sanger Centre Knockout Service in strain HX104. Reference: Au C, et al. PLoS One. 2009 Nov 18;4(11):e7792.
NC865 C. elegans unc-119(ed3) III; wdEx359. Show Description
wdEx359 [F29G6.2::GFP + unc-119(+)]. GFP+ seen in ventral nerve cord. Pick non-Unc worms that are GFP+.
OP713 C. elegans unc-119(tm4063) III; wgIs713. Show Description
wgIs713 [T11G6.8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
PS7960 C. elegans C04G6.4(sy1165) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C04G6.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGAAGCCACTTTCTTTCGAAATGCCAAAACCGCCA Right flanking sequence: GTTCTCCAGCCAAATATTGCCTCACTTCTACAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATATTTGGCTGGAGAACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
RB1136 C. elegans R05G6.10(ok1159) IV. Show Description
R05G6.10 Homozygous. Outer Left Sequence: tcttcgtcttgccatctgaa. Outer Right Sequence: agcagcatgttgttgtgctc. Inner Left Sequence: gggaacaatgatgagatggg. Inner Right Sequence: ccccttcttcttgacacgag. Inner Primer PCR Length: 3193. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1172 C. elegans acr-15(ok1214) V. Show Description
F25G6.4 Homozygous. Outer Left Sequence: ctctgcgcttcaagctctct. Outer Right Sequence: cagcagggaggtgtaccaat. Inner Left Sequence: gtgatgctcttgcccatttt. Inner Right Sequence: tgctctttttcaggaaggga. Inner Primer PCR Length: 3055. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1173 C. elegans plc-4(ok1215) IV. Show Description
R05G6.8 Homozygous. Outer Left Sequence: gctgaaacatgccaaggatt. Outer Right Sequence: tcaaaatgtttctctggccc. Inner Left Sequence: ctatgcgaaagaaagggcag. Inner Right Sequence: tggcgttggtgacaataaaa. Inner Primer PCR Length: 2912. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1211 C. elegans C34G6.5(ok1267) I. Show Description
C34G6.5 Homozygous. Outer Left Sequence: ccgtatcacacactcatcgg. Outer Right Sequence: attgctaaaacccgcagaaa. Inner Left Sequence: agaaggacaactggctccaa. Inner Right Sequence: caacacagcaagcgagaaaa. Inner Primer PCR Length: 2678. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1217 C. elegans F25G6.2(ok1233) V/nT1 [qIs51] (IV;V). Show Description
F25G6.2 Heterozygotes are WT and GFP+ in the pharynx. ok1233 homozygotes arrest at the L1 stage. Outer Left Sequence: TGAACTCACGAAAATGACGG. Outer Right Sequence: ATACAGGTTCCAATGAGCGG. Inner Left Sequence: CTCGGTGCACGAAGTGTAAA. Inner Right Sequence: GCCAAAAAGGAATTGCAAAA. Inner Primer PCR Length: 3056. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1224 C. elegans C34G6.2(ok1227) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C34G6.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: agatgggatgatggagcaag. Outer Right Sequence: caagaggtccggatcaaaag. Inner Left Sequence: gctgaggttgcttaggttgc. Inner Right Sequence: atctccgaaatcgtcacgtc. Inner Primer PCR Length: 3245. Estimated Deletion Size: about 2250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1270 C. elegans C03G6.13(ok1361) V. Show Description
C03G6.13 Homozygous. Outer Left Sequence: tgcaaaacgtcacgctctta. Outer Right Sequence: atttccgggtcctcaatacc. Inner Left Sequence: tgtcgtcacccgtagtgtgt. Inner Right Sequence: aacaaaacagatcggccaac. Inner Primer PCR Length: 2599. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1715 C. elegans aqp-2(ok2159) II. Show Description
C01G6.1. Homozygous. Outer Left Sequence: ACAGAGAAAAGGTGCAACCG. Outer Right Sequence: CTGCTCAAGGGTCACAATGA. Inner Left Sequence: CAGGGTGAGAAAGGATTTCG. Inner Right Sequence: CCTCCCAACTTCACCTTTCA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1238 bp. Deletion left flank: AACAATTGGAACCCAGAACCACTTGCTGAA. Deletion right flank: TTTATTACCAGTAAATTGTCCACTCTTCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1737 C. elegans pld-1(ok2222) II. Show Description
C04G6.3. Homozygous. Outer Left Sequence: CCACTTGCCACGTATTCCTT. Outer Right Sequence: GAAGATGAAGAGTCGCGGAG. Inner Left Sequence: GGACAACGACTCCACCAGTT. Inner Right Sequence: GGTCATCTGGAACCGAAAGA. Inner Primer PCR Length: 3066 bp. Deletion Size: 1430 bp. Deletion left flank: TTGAAATCACGATCCATTAGCAATACCATC. Deletion right flank: GAATGATTCCTTAACCAAACACGTTTAATA. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1788 C. elegans cyp-35A1(ok2306) V. Show Description
C03G6.14. Homozygous. Outer Left Sequence: AAAGCTTTTGTTGGAGGTGC. Outer Right Sequence: TGATTCCTTTTGGAGTTGGG. Inner Left Sequence: GATGCATAGTAAGGAAATCTGGG. Inner Right Sequence: TCCACTACCGAGCTTATGCC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1494 bp. Deletion left flank: TTGATATCCTCAATTCTAAATCAAGCAATC. Deletion right flank: TCACCAGAATACAATTTAAAAACCTTTAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1862 C. elegans F07G6.2(ok2408) X. Show Description
F07G6.2. Homozygous. Outer Left Sequence: AGTATGCTAGCCCGGAAGGT. Outer Right Sequence: GTCTCAGCAAAACCAGGGAG. Inner Left Sequence: TGCGCTGTTTAGAATTGTGC. Inner Right Sequence: CGATGTTTGGGTGTCACATT. Inner Primer PCR Length: 3052 bp. Deletion Size: 1625 bp. Deletion left flank: ATTTTTGCCGACATTAGTTTAAAAAATTAA. Deletion right flank: GTGCTAGGACGTAGCGCTTTCATGCAGGCG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2169 C. elegans F29G6.3(ok2936) X. Show Description
F29G6.3 Homozygous. Outer Left Sequence: tgtggtgctcatgcttcttc. Outer Right Sequence: tcacacacctacaggtccca. Inner Left Sequence: ctcaaactttctgcgaaggg. Inner Right Sequence: tccgctttgactcatgacag. Inner Primer PCR Length: 1207. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2204 C. elegans W10G6.1(ok2984) X. Show Description
W10G6.1 Homozygous. Outer Left Sequence: tgcatgcaactggaaacatt. Outer Right Sequence: ttatcacgtcggaagaggct. Inner Left Sequence: tgtgaatcagcagaaatgtcaa. Inner Right Sequence: accttcaactgcaggacgat. Inner Primer PCR Length: 1190. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2435 C. elegans C24G6.3(ok3345) V. Show Description
C24G6.3 Homozygous. Outer Left Sequence: aaaattggattttggagggg. Outer Right Sequence: gccattattgccgattttct. Inner Left Sequence: tctttgacggtttttctgaatg. Inner Right Sequence: tttgaaaagttaaaaacatacagatgc. Inner Primer PCR Length: 1193. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2488 C. elegans F58G6.1(ok3443) IV. Show Description
F58G6.1 Homozygous. Outer Left Sequence: tttgataaacgctgttggca. Outer Right Sequence: ttcattgcacttttcccctc. Inner Left Sequence: cgaagaatgtgatacgactgtca. Inner Right Sequence: cgcattttcttcattcggtt. Inner Primer PCR Length: 1279. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB582 C. elegans C04G6.1(ok219) II. Show Description
C04G6.1 Homozygous. Outer Left Sequence: ACCCGTCATTTCTGAAAACG. Outer Right Sequence: GCCAACCTGGTGTCGTAGTT. Inner Left Sequence: GACGTGCTTTGTGCGAATTA. Inner Right Sequence: CACTTGAGCTCCCTCGAATC. Inner Primer PCR Length: 2564. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB592 C. elegans srp-6(ok319) V. Show Description
C03G6.19. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB635 C. elegans F07G6.2(ok362) X. Show Description
F07G6.2. Homozygous. Outer Left Sequence: tgcgctgtttagaattgtgc. Outer Right Sequence: ctcattgggcaaagtctggt. Inner Left Sequence: tgcgcagtgttccaataaag. Inner Right Sequence: atccgaaccattgactgagg. Inner primer WT PCR product: 2748. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB674 C. elegans stam-1(ok406) I. Show Description
C34G6.7. Homozygous. Outer Left Sequence: gctcaagagtgtggaggagg. Outer Right Sequence: gctcggaaaaatcactgctc. Inner Left Sequence: gattaatgggagaatgccga. Inner Right Sequence: ctgttgagaattgggaggga. Inner primer WT PCR product: 2799. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB799 C. elegans C25G6.5(ok594) X. Show Description
C25G6.5. Homozygous. Outer Left Sequence: CAGGGTCTTAACACGGCAAT. Outer Right Sequence: TGCCTTCAATTTCATCTCCC. Inner Left Sequence: CAAAAATTGGAAGGTGAGCC. Inner Right Sequence: AAATGGGATCGGTGAATGAA. Inner primer WT PCR product: 2691. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807