More Fields
Strain Species Genotype
GG27 C. elegans emb-20(g27) I. Show Description
ts. Maintain at 15C. Some growth at 20C. 96% Emb at 25.6C and 25.8C.
EG2710 C. elegans unc-57(ok310) I. Show Description
T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu
EG276 C. elegans exp-1(ox276) II. Show Description
Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52.
EG2762 C. elegans oxEx166. Show Description
oxEx166 [HSP::MosTransposase + coelomocyte::GFP + lin-15(+)]. Should be grown at 25C.
GR1432 C. elegans let-7(mg279) X. Show Description
Weakly retarded differentiation of the hypodermis and exit from the molting cycle. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.
GR1433 C. elegans let-7(mg279) mir-84(tm1304) X. Show Description
Retarded differentiation of the hypodermis and supernumerary molt that results in adult lethality. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.
IG274 C. elegans frIs7. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. The nlp-29p::GFP reporter is induced in the epidermis upon infection with Drechmeria coniospora, wounding and osmotic stress. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.
KG2730 C. elegans clu-1(ok2). Show Description
Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype more severe than ok3. ok2 is a 1189 bp deletion (III:9519159-9520346) removing amino acids 314-693 and inserting a glutamic acid at the deletion site. Flanking sequence: GACCGACTTCCAACCAGTTACCCAG...ATGTTATGAAGTTCAATCCGGATTGTTTCTC ATCAAATGT.
KG2731 C. elegans clu-1(ok3). Show Description
Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype less severe than ok2. ok3 is a 1047 bp deletion (III:9518654-9519699) and 13 nucleotude insertion (producing two termination codons) resulting in a protein truncated at amino acid 693 plus an inserted glutamic acid. Flanking sequence: GCTCGAGGATGCTGCTCACAAACTGAAAATG...GAATAGTATCCGTGAATAGTATCCG TGAAGATTCTG.
MG278 C. elegans K08E3.5(ok233) III. Show Description
TI223.E1: AGACTTGAAGGAAACGCGAA. TI223.E2: AATCAAATTGAAACGGCTCG. TI223.I1: AATCCTTGCCAACCAAACAG. TI223.I2: CGTAGCATCCTTGGACCAGT. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
TQ10521 C. elegans gsr-1(xu414) III. Show Description
gsr-1(xu414) is a G279E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443