More Fields
Strain Species Genotype
GG31 C. elegans emb-21(g31) II. Show Description
Temperature sensitive. Maintain at 15C. Will grow at 20C, but not at 25C. [11/93: Not behaving as described. Very sick at 25C, but giving some live offspring which in turn give a few more live offspring.]
JH1986 C. elegans unc-119(ed3) III; axIs1437. Show Description
axIs1437 [pCG31; LAP::lsm-1 + unc-119(+)]. GFP expression appears granular in somatic blastomeres at the 4-cell stage. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.
MIR250 C. elegans hif-1(ia4) V; risIs33. Show Description
risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and ZG31.
ZG31 C. elegans hif-1(ia4) V. Show Description
Healthy and fertile in standard lab conditions, but unable to adapt to 1% oxygen. When hif-1(+) animals are incubated in1% oxygen, >94% will complete embryogenesis and larval development. In contrast, hif-1(ia4) mutants exhibit 66% embryonic lethality and 9% larval lethality in 1% oxygen. The requirement of hif-1 is alleviated if the oxygen level is increased to 2%. The ia4 mutation is a 1231 bp deletion of the second, third, and fourth exons, which encode much of the helix-loop-helix and PAS domains. Analysis of ESTs suggests that there are at least 4 alternatively spliced hif-1 transcripts. The ia4 deletion introduces a frameshift and a premature stop in the three longest forms.
GR1371 C. elegans lars-2(mg312) unc-29(e1072) I; nDp4 (I;V)/+. Show Description
lars-2(mg312) unc-29(e1072) homozygotes are Unc, slow growing, sterile, and have extended life span. Balanced worms are slightly Egl, otherwise WT.
NG3124 C. elegans dsh-2(or302)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
mIs14 [myo-2p::GFP + pes-10p::GFP]. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP or302 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. or302 homozygotes are GFP- and are Emb, ABar and have EMS spindle misalignment. or302 is a deletion starting at 503 and ending at 1578 of C27A2.6.
RG3100 C. elegans icmt-1(ve600[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1396 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gattattataaaaagcgtgaaaacgtgaaa ; Right flanking sequence: tggaaaaacaaatagttacgcattatttcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3101 C. elegans F11A10.5(ve601[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2313 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tggcacgtcaccaacaaccaccaaccggct ; Right flanking sequence: ttgtactcttccttccaaacttcgtgttcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3102 C. elegans elo-2(ve602[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous unhealthy. Deletion of 1650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sickly animals that can grow up to lay small broods (ve602 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: accgggaaaaatgtgaaattgcgaaactag ; Right flanking sequence: ggagggcaaagtgtattttttaaatgattt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3103 C. elegans +/mT1[umnIs52] II; aco-2(ve603[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 3465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve603 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaataggttctatttctttccctttgtcgg ; Right flanking sequence: tgagattgtttttatgtatgagtagatatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3104 C. elegans cwc-15(ve604[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous larval arrest. Deletion of 1421 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear young larvae easiest to see at the edge of the lawn (ve604 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aactcatattcaaaactcgcgccgaaatgt ; Right flanking sequence: gtaggccgtatcgacttttcaagtactttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3105 C. elegans nduf-6(ve605[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous late larval arrest. Deletion of 560 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve605 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gctcttttatattgaattcaaagttgtatc ; Right flanking sequence: tggttttattttttagtatgtatacaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3106 C. elegans rpa-1(ve606[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1[dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 2554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve606 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttctacgccattttttttggcgcgtatccg ; Right flanking sequence: atccacaatcgctgattttgtacaatgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3107 C. elegans rpb-12(ve607[loxP+myo2-p::GFP+NeoR+loxP])/nT1[umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 437 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve607 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaagatcaagtatgaaatttaaaattcaac ; Right flanking sequence: ttgttaatgaaatgcgaaacgataaatttt. rpb-12 sgRNA #1: ggctgaacctgtatcatttt; rpb-12 sgRNA #2: ttaaagatattcagaATGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3108 C. elegans F11G11.5(ve608[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 956 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acgttttcagatttctagaaATGACCGGTC ; Right flanking sequence: tcctaccaagtagacatattaactgttcca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3109 C. elegans F23F1.5(ve609[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sqt-2(sc3) II. Show Description
Homozygous sterile. Deletion of 1538 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ sterile adults (ve609 homozygotes) and non-Rol non-GFP adults (sc3 homozygotes). Maintain by picking Rol GFP+ adults.
RG3110 C. elegans rpt-4(ve610[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sqt-2(sc3) II. Show Description
Homozygous larval arrest. Deletion of 1568 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ ve610 homozygotes (larval arrest) and non-Rol non-GFP adults (sc3 homozygotes). Maintain by picking Rol GFP+ adults. Left flanking Sequence: aaaaattactataatatttcgcgatttttt ; Right flanking sequence: aggaaagaacgtcagaaatgaaaatcagaa. rpt-4 sgRNA #1: ttacgaggctcgtcattatt; rpt-4 sgRNA #2: gaaaaaacgaggttctcatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3111 C. elegans F56C11.5(ve611[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Mel. Deletion of 3345 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that lay dead eggs (ve611 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: GATCAATCGCTGGTCCAGAAGGTTCCACTA ; Right flanking sequence: TCAGGCCACCGATTTTTAGtctatatttta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3112 C. elegans gcsh-2(ve612[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile. Deletion of 773 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve612 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: CATACTGTTCCTCGTTAAGAAGTTTTTCCA ; Right flanking sequence: agggcaatgattgtcttggagttttttttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3113 C. elegans col-133(ve613[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3100 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggagtacacggaagaagatgcaatgataaa ; Right flanking sequence: gatcgtagcgagacccactctgaaaaaccg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3114 C. elegans col-154(ve614[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1367 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aagagggaggatgaacagcgggcggtgcca ; Right flanking sequence: acattttgaaaaaaaagctcgagaacgagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3115 C. elegans vha-11(ve615[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25[unc-5(tm9708)]. Show Description
Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP unc-5(tm9708) homozygotes, and GFP+ dead embryos(ve615).
RG3116 C. elegans +/mT1[umnIs52] II; rpl-23(ve616[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 483 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve616 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaacaacagcTTAAGCGATGGATCCAGCG ; Right flanking sequence: CGTCCTCTCTTCGACATtttacctgaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3117 C. elegans +/mT1[umnIs52] II; dars-1(ve617[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1747 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve617 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ATGGTAACTCGCTCAAGTCCGATGCCTCCT ; Right flanking sequence: TGGAGAGTTTTGGTTGTTCACCTTCGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3118 C. elegans col-155(ve618[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1138 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaattctgaatcatatatttttcaatcat ; Right flanking sequence: gtattgcaattacacttggcagatgcaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3119 C. elegans +/mT1[umnIs52] II; cpf-2(ve619[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1981 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve619 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TTTCTCTTCAACTGCTGTCTCAGCTCTATT ; Right flanking sequence: tagctccacccacattttttgtgacgtcac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3120 C. elegans F52G2.3(ve620[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 7573 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgtttttccagttgctcacggtaccttca ; Right flanking sequence: gcgggtttggtgcggtttttacgtattcag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3121 C. elegans F53A3.7(ve621[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous Sterile. Deletion of 465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve621 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: agggtttctaaatatcttttaaaacctttg ; Right flanking sequence: AACGTCGTGACACGATAAAGAACGAGAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3122 C. elegans F53B7.7(ve622[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaaaaagtgcaacgtgcggaattccctaa ; Right flanking sequence: GATACACTTATTCACACATACTATCCAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3123 C. elegans veDf1 [LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] IV. Show Description
Homozygous viable. Deficiency of 4040 bp, removes his-55, his-56, his-58 and his-57, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaacgtggtactgtaatcgttgcgagacct ; Right flanking sequence: actgtttaattttaaaagcgtctataacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3124 C. elegans +/nT1[umnIs49] IV; isy-1(ve624[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1033 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve624 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GACGAATAGTCATTGGTCGTCCATCCTCTC ; Right flanking sequence: attggcggttattcaaattcaatattttac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3125 C. elegans +/mT1[umnIs52] II; prx-19(ve625[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 1698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 most are sterile adults, but escapers do lay small broods (ve625 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tggaaaataactgaggacacttattgctac ; Right flanking sequence: tttggatcgataaaacacacaatcggtgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3126 C. elegans ints-11(ve626[LoxxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous arrested larvae. Deletion of 2171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve626 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny.
RG3127 C. elegans rpt-5(ve627[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Larval lethal w/ escapers that show pleiotropic phenotypes. Deletion of 1521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae with occasional escapers (ve627 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gattcaaagggaacacagtgacaaccggga ; Right flanking sequence: tctggggcctgaaaattagttgtaattgct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3128 C. elegans +/mT1[umnIs52] II; vha-14(ve628[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve628 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atgtttttttcatagaaataacaaactttt ; Right flanking sequence: caccctccgatgttcttcctgttttctatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3129 C. elegans clec-178(ve629[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
homozygous viable. Deletion of 954 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacttacgcaataggtatattccctaaa ; Right flanking sequence: gtaggataggttttactgtcagaagcttcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3130 C. elegans col-157(ve630[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
homozygous viable. Deletion of 1753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: attttgatgattcctcttgcaaatccagac ; Right flanking sequence: gttggcaaaaaaacaatattttttcctgat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3131 C. elegans ears-2(ve631[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) /dpy-9(e12) IV. Show Description
Homozygous sterile, Pvl. Deletion of 1629 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ non-Dpy Pvl sterile adults (ve631 homozygotes), Dpy non-GFP (dpy-9(e12) homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: acaatggaaatcggagTTATAATAATTCCT ; Right flanking sequence: CGGTTAGCTTCATaatttctattgaggggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3132 C. elegans erh-1(ve632[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
homozygous viable. Deletion of 566 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggaaagagatagaagtgagaaacccatatg ; Right flanking sequence: tttggtgttcgggcaatttttatttttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3133 C. elegans fndc-1(ve633[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
homozygous viable. Deletion of 641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgaagaaaaaaatagacagcatgactagac ; Right flanking sequence: gctggaacaatcacagtactacattactcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3134 C. elegans czw-1(ve634[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC5 IV. Show Description
Homozygous larval arrest. Deletion of 3125 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ non-Mec non-Unc arrested larvae (ve634 homozygotes) and non-GFP Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+.
RG3135 C. elegans +/mT1[umnIs52] II; F54C8.1(ve635[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve635 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGCAAAGTGTGCCATGCAAAACATCAGAAA ; Right flanking sequence: GTAGATAAGCTGGTTGCCGAGGGAAAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3136 C. elegans +/mT1[umnIs52] II; F54C8.4(ve636[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1778 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve636 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaagatcaaaagttgaacagggagaacat ; Right flanking sequence: gggacttgaattttcggagaaagaagacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3137 C. elegans +/nT1[umnIs49] IV; cct-7(ve637[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 2891 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve637 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caagATGATGCGCCCACCAATTATCCTGCT ; Right flanking sequence: CAATAAggagatcaatgtgcccctctgtgc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3138 C. elegans klp-3(ve638[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 3142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttttgtctccgttttttgcgttgttttcct ; Right flanking sequence: tccattctagtccatgaaaaatttcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3139 C. elegans pigv-1(ve639[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1[umnIs58] I; +/hT1[unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile. Deletion of 2451 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve639 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: tattgatctgttttctaaaatgattaatac ; Right flanking sequence: cattaattaatttccttatccgtttaacta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3140 C. elegans +/hT1[umnIs58] I; T10B5.3(ve640[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1[unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval lethal. Deletion of 2913 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve640 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gatattatgatattagagagacggcgggga ; Right flanking sequence: tctggaaactgcaaaaaaatattggaaaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3141 C. elegans +/mT1[umnIs52] II; popl-5(ve641[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 2064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve641 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: caatgcgcctacatgcctacctacatgcca ; Right flanking sequence: AGGCTCATTTTCAAAATAGAATATCCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3142 C. elegans gtf-2E2(ve642[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1[dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 1631 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve642 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaaaataacttgaaacttcaaaagaaata ; Right flanking sequence: TTCGCTTTTGCTGCTTCTGAAGAGTATGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3143 C. elegans +/nT1 [umnIs49] IV; hpo-31(ve643[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 2300 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve641 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).