Search Strains

GFP tag inserted at C-terminus endogenous vglu-3 locus. Reference: Serrano-Saiz E, et al. Genetics. 2019 Nov 27. pii: genetics.302855.2019. PMID: 31776169

Deletion of the cup homology domain (CHD; 196-217aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.

Deletion of the Poly Q region (PolyQ; 527-644aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.

GFP tag inserted at C-terminus of endogenous cone-1 locus by CRISPR. Broad nuclear GFP expression in non-neuronal cells. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

Deletion of the Nuclear Localization Sequence (NLS; 220-235aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. No embryonic viability defect in hermaphrodites. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.

Deletion of the coiled coil domain (CC; 664-691aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.

oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. fig-1(syb6983) is an engineered deletion removing teh fig-1 coding sequence. fig-1 loss of function causes VAP-1::sfGFP accumulation and dye filling defects. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

sfGFP tag inserted into endogenous wrt-10 locus using CRISPR/Cas9. Tagged inserted at C-terminus immediately preceding the stop codon. Reference: Serra ND, et al. 2024 Development. Aug 7;227(4):iyae081. doi: 10.1093/genetics/iyae081. PMID: 38739761.

sfGFP tag inserted into endogenous grl-2 locus using CRISPR/Cas9. Tag inserted immediately following the signal peptide. Reference: Serra ND, et al. 2024 Development. Aug 7;227(4):iyae081. doi: 10.1093/genetics/iyae081. PMID: 38739761.

sfGFP tag inserted at C-terminus of endogenous fig-1 locus. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

Broad puncate expression in non-neuronal cells, later expression initiatiated ~1.5-2 fold stage. wrmScarlet tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

AID*::mScarlet tag inserted into endogenous dve-1 locus via CRISPR/Cas9 engineering. Reference: Alexander, K.D. et al. Nat Commun 2023 Nov 18;14(1):7520. PMID: 37980357.

GFP tag inserted in exon 4 of endogenous ceh-44 locus. Broad, weak, punctate GFP expression in non-neuronal cells. Please contact Oliver Hobert prior to publishing work using this strain.

mNeonGreen tag inserted into endogenous cutl-18 locus using CRISPR/Cas9. mNeonGreen tag inserted just after endogenous signal sequence. Reference: Schmidt HF, et al. 2025 Jan:517:265-277. doi: 10.1016/j.ydbio.2024.10.008. PMID: 39489317.

SL2::GFP::H2B tag inserted at the C-terminus of the endogenous degt-1 locus. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted at 3' end of endogenous src-1 locus using CRISPR/Cas9 engineering. gRNA sequence: AGCACAATTTTTTAGGCACT

sfGFP tag inserted at the N-terminus of the endogenous NHR-49 gene (long isoform c). Derived by out-crossing parental strain PHX9542. Reference: Tatge L & Douglas PM. MicroPubl Biol. 2025 Aug 1. doi: 10.17912/micropub.biology.001655.

3xHA::TurboID tag with GGCG linker sequence inserted at the N-terminus of the endogenous NHR-49 gene (long isoform c). Derived by out-crossing parental strain PHX10203. Reference: Tatge L & Douglas PM. MicroPubl Biol. 2025 Aug 1. doi: 10.17912/micropub.biology.001655.

mCherry tag inserted at the C-terminus of the endogenous NHR-49 locus. Derived by out-crossing parental strain PHX5674. Reference: Tatge L & Douglas PM. MicroPubl Biol. 2025 Aug 1. doi: 10.17912/micropub.biology.001655.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-26. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTGCTCAAGACATGCGAAATAACATGCAACCTGAA right flanking sequence: CGTGAGCGCCGGCAAAGGGAGCTTGAAGCTTTAG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTTGCCGGCGCTCACGTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-59; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCACCGTCTTCAAAACGGCTGGACCTTCAAGGCAT. Right flanking sequence: TAGAGGGTTGGCAATTCTATCAGTTCTGGGATTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGACCTTCAAGGCATTAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-14. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGATATTTTGCAATTCCTGTTTGGGATCCACAG right flanking sequence: ATCCAGAATATTTGgtgagtttaggcttaggcttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACCAAATATTCTGGATCTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-56; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTTTACTATTTCACTTGAACCCTAACCTATT Right flanking sequence: TGTTAATGGATTTCTCGGTGTTGATATgtaagccc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctag. sgRNA : CGAGAAATCCATTAACAAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: TTGGTATGTGCAGTTACTAACGATATTGAAGACGC right flanking sequence: TAGTGGAGAGACACCTGGAATTGTTTCTCAAATTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGATATTGAAGACGCTAG Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-24. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGTCACAATGGGAAACGGGAAAAAGCTTCACGG right flanking sequence: TTTTGgtgagttttatttttcatatgttgattattag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGGAAAAAGCTTCACGGTTT Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGTATCAGAGCAGTTGAAGGATGTTCTTATGGAA right flanking sequence: Ggttggtattgatttagttcaccaaaaagagtttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGGATGTTCTTATGGAAGGT Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-12; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGCCGTTTCACTACTATATATTCACTTCCTTAG Right flanking sequence: TTGTTTTGCATTTTTTGCAAATATTATGATTGTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAAAAAATGCAAAACAACTA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTAAGTTTCTTTGCAAATGCTCTTATCGCTATAG Right flanking sequence: TTCTGGCAAACAAGGTTATGAGGATTTCTGGAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGCTCTTATCGCTATAGTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATCACCCACACATCATCATGAACTCTACCGACGA Right flanking sequence: CCTTGGATTCATGAGCCAAGAGCCACgtaagtctag inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATGAACTCTACCGACGACCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-45. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTTGGATTTCATTTCTACCCTAATCAGTTTCCC right flanking sequence: AATGGGTACCTTGGAGTTGATCAgtaaggtttttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCCTAATCAGTTTCCCAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srd-32. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACCATATACTGTATTCTTGGCGAACACCTCTA right flanking sequence: TAACGCAGCTAGGGTATTGCATATGTTTCCTCTTAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATACCCTAGCTGCGTTATAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of dhp-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACCACTTGTTATCAAGAATGGAACTGTCGTCAATGA. Right flanking sequence: AGATGGAATGTTTAAAGCTGATGTTCTTGTTAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAACTGTCGTCAATGAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

mNeonGreen tag inserted into endogenous nekl-4 locus by CRISPR/Cas9 engineering. Very faint mNeonGreen expression in the dendrites, soma, and axons of all ciliated neurons. Reference: Power KM, et al. PLoS Genet. 2020 Oct 16;16(10):e1009052. PMID: 33064774

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility. AID* tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.

fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility and reversible male sterility. Him: males produced at ~30%. AID* tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.

fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

The fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65°C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgtag; et46_mut:atcccccaaaaaacccaatttttttgtaa; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349

RFP tag inserted at C-terminus of endogenous hum-1 via CRISPR/Cas9 editing.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.

ZK455.1. Previously called gei-22. Homozygous. Outer Left Sequence: CACACACAAAAACGGACAGG. Outer Right Sequence: TCGTTGCTCCAAATCACAAA. Inner Left Sequence: AGACGAGCTTCCAATCTCCA. Inner Right Sequence: TTCCTCCGTTGCGGTAATAG. Inner Primer WT PCR product: 2984. Deletion size: 540 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22E10.4. Homozygous. Outer Left Sequence: GATCTCGAACCAACGCTCTC. Outer Right Sequence: TGGAGTCGCAATGCTTGTAG. Inner Left Sequence: CCTTCTCTCCGACGTCAGTC. Inner Right Sequence: CGTTGCACCCACTTGTATTG. Inner Primer WT PCR product: 3156. Deletion size: 2256 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15C11.2a. Homozygous. Outer Left Sequence: AGCTGCTCTTGAACGGTTGT. Outer Right Sequence: TGAATAAAAGGGGAACGTCG. Inner Left Sequence: CAGGAGCCCTTGCTCAATAG. Inner Right Sequence: GCTTATTAAAGGGGCCGAAG. Inner Primer WT PCR product: 2991. Deletion size: 1147 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02F12.4 Homozygous. Outer Left Sequence: GCAAATACCACCACCACACA. Outer Right Sequence: TATAAACGACGGGAAAACGC. Inner Left Sequence: AAGCTCACCGCAAACTCAAT. Inner Right Sequence: ACATACAGCACGGCATTTGA. Inner Primer PCR Length: 2998. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14F5.2 Homozygous. Outer Left Sequence: tggttacccatctgcgtgta. Outer Right Sequence: gcatgttccttcatttccgt. Inner Left Sequence: ttcgcgcacattttgagtag. Inner Right Sequence: gacaagatcattggcgaggt. Inner Primer PCR Length: 2296. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C24B5.2. Homozygous. Outer Left Sequence: TCCGTTGCGACTTCTTTTCT. Outer Right Sequence: GCCACGTGATGATCAATCTG. Inner Left Sequence: CAGTTCCAATGTTCGCCTTT. Inner Right Sequence: CAAATTGAAATGGAATCGCA. Inner Primer PCR Length: 2282 bp. Deletion Size: 627 bp. Deletion left flank: GTTTGTTTGATTATTGCCGGCAATATTGAT. Deletion right flank: AAAACGGGTCAAAGTCGACAAGGTGTTTAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03A11. Homozygous. Outer Left Sequence: ACAACGCCAAATTCGGTTAG. Outer Right Sequence: TGGTCTAGAGCAAATGCGTG. Inner Left Sequence: TCTATGCTTTGCAAATCCCC. Inner Right Sequence: TCATGTGCTCTACGCGTTTC. Inner Primer PCR Length: 2374 bp. Deletion Size: 773 bp. Deletion left flank: TCTTCTATGCTTGTCCTTGCGACGCTTCTC. Deletion right flank: GTGGACATTGGGAACAAAGCTTCAGTATTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.3 Homozygous. Outer Left Sequence: aaaatcgaaccacggtcttg. Outer Right Sequence: tctctgcgacaaatgtctgg. Inner Left Sequence: agggcacggaaatgtgatag. Inner Right Sequence: tactccctgtgtccctttgc. Inner Primer PCR Length: 2921. Deletion size: 905 bp. Left flank: AGGGGAAAAAGGGAAAAAACGGCTGAAATT. Right flank: TTTTTCCATTTCTAAACTCGCGTAGTTGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11G12.4. Homozygous. Outer Left Sequence: TCGTGGTGTCAAAATAGCCA. Outer Right Sequence: GTGAAGATTGCCGGAAGAAC. Inner Left Sequence: TCAGTTTGGCACCACGTTAG. Inner Right Sequence: CGACAATCACCCACTGTTTG. Inner Primer PCR Length: 3158 bp. Deletion Size: 959 bp. Deletion left flank: ATTTTCAGATTGTAGGCGGATATCATTGTC. Deletion right flank: GACTCAAGTGTGAAATATTTGTTGGCCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807