Search Strains

Y75B12B.6 Homozygous. Outer Left Sequence: cttaatgcgggctctcaaag. Outer Right Sequence: aagtggcggacatattacgg. Inner Left Sequence: agagcttgccgtgagcttag. Inner Right Sequence: gcaaatattggacgcttcgt. Inner Primer PCR Length: 3106. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B9.2 Homozygous. Outer Left Sequence: tttttcccgcttacctctga. Outer Right Sequence: tctgcagttgttgcgaaatc. Inner Left Sequence: ggttcagatcatcttcggga. Inner Right Sequence: tcttcgaccaacatgcgtag. Inner Primer PCR Length: 2826. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12G11.1. Homozygous. Outer Left Sequence: CGGATAAACCATGCAAGACA. Outer Right Sequence: CATCACGCATTGTTGGGTAG. Inner Left Sequence: CCCCAATTTCTTAAGGCACA. Inner Right Sequence: TACCAGCTTAAAGCGGCAAT. Inner Primer PCR Length: 2943 bp. Deletion Size: 2119 bp. Deletion left flank: AACTTCCAGGCATGCCAGTTTAGGTATGTA. Deletion right flank: AACACTCATTCTCCTGATATTTTATCTCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R10E11.3. Homozygous. Outer Left Sequence: GGCGGCAATTTGAACTTTTA. Outer Right Sequence: CGTTTCAGAAGAGTCTCGGG. Inner Left Sequence: GAGAAGGTGCTAATGCGCTC. Inner Right Sequence: TTGGATCATCAGCAGCGTAG. Inner Primer PCR Length: 2429 bp. Deletion Size: 1440 bp. Deletion left flank: TTGGAAATACATGTTACTGCAACTCAGTGA. Deletion right flank: CGCAGCATAATAATGATCAAATTTTCAGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK822.5. Homozygous. Outer Left Sequence: GCGATTTTTGGATTGAGCAT. Outer Right Sequence: TTTCAAATTTCCGGATCACC. Inner Left Sequence: GCTTTTCATTGCGATTTCGT. Inner Right Sequence: CACGCAATTTGTCATGCTTT. Inner Primer PCR Length: 2857 bp. Deletion Size: 1318 bp. Deletion left flank: TCGAGGGGACAGAACAGCAAAAGAGGAATA. Deletion right flank: GGCAATTTATGAAGATTTCTTGAAAAATAG. Insertion Sequence: AAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27E9.9 Homozygous. Outer Left Sequence: cgtcctcgccattctcttag. Outer Right Sequence: tttcgccaaaattatctccg. Inner Left Sequence: atccgaggacacagatttgg. Inner Right Sequence: tggccttcgttgtcttcttt. Inner Primer PCR Length: 3018. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27A2.1. Homozygous. Outer Left Sequence: ATGCAACGTGCTAAAGCAAA. Outer Right Sequence: GTGGTTCCATTCCACATTCC. Inner Left Sequence: AAGCTCGAGCGAGACTTCAG. Inner Right Sequence: ACATCTGAATGGAACTGGGC. Inner Primer PCR Length: 3285 bp. Deletion Size: 2424 bp. Deletion left flank: AAATAATATTTATTTTTGTTGAAAAATTAG. Deletion right flank: TTGAAAACCGTGCACGTATCCACGATAAAC. Insertion Sequence: CTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40E10.1. Homozygous. Outer Left Sequence: AGCTTGGGTAGTGGTGGTTG. Outer Right Sequence: AACGCGATGGTTTCCTACTG. Inner Left Sequence: TGTAGATGTGCGAGCGGTAG. Inner Right Sequence: GCCGACTTCGTTAATGGAAA. Inner Primer PCR Length: 3007 bp. Deletion Size: 1611 bp. Deletion left flank: CAAGGCACCTGATGCAGAAATAGTTTGAAT. Deletion right flank: CCTTCGAAAAGATACGGAATTTCATCGGGT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04E12.8. Homozygous. Outer Left Sequence: AGTTGTTCGCATCCCTTTTG. Outer Right Sequence: ACACAACCCGGACACCTTTA. Inner Left Sequence: CAAAACCCCTGGATCAACTG. Inner Right Sequence: CATGCTTCTCGCACATTTTG. Inner Primer PCR Length: 3140 bp. Deletion Size: 1880 bp. Deletion left flank: CCTGACCGACCTTGTGCATACCGATCCACG. Deletion right flank: GTGATAACGTTAAAGAATGGTGCCATATAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W06E11.5. Homozygous. Outer Left Sequence: GCTCTTTTTCCGACACTTGC. Outer Right Sequence: CCTCGTCGTTTGACCATTTT. Inner Left Sequence: TCTCCTTTGTCGAGAATCTGAA. Inner Right Sequence: TCATGTCAGCCACACCATTT. Inner Primer PCR Length: 3192 bp. Deletion Size: 1425 bp. Deletion left flank: AAAGTAGATATATTTTTCAAAATTTTAAAG. Deletion right flank: TTGAAAATGTTTTAGAAAATTCATAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07D4.1. Homozygous. Outer Left Sequence: TTGGTTGGATCAGAAAGTGATG. Outer Right Sequence: GATTGCATGGTAAGACAGTGGA. Inner Left Sequence: ACCATTACGAATAGCATTGGCT. Inner Right Sequence: TTGTTCTGCTCTCGACATGTTT. Inner Primer PCR Length: 2673 bp. Deletion Size: 1767 bp. Deletion left flank: GTACAAGTGTTTGAAAAACCCTATAAGTAG. Deletion right flank: TTTTAACATCCACTTCACTTTGATTCCTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C48B4.1. Homozygous. Outer Left Sequence: TTTCCCCAACACAAACCATT. Outer Right Sequence: TGACGTGGATGGCTTAAACA. Inner Left Sequence: CCAATGGTGCCATTTCTTCT. Inner Right Sequence: ATGAAGTAACCAAGCGGTGG. Inner Primer PCR Length: 3288 bp. Deletion Size: 1509 bp. Deletion left flank: TACGAACAGCTGAATATCGAATTGAAATAG. Deletion right flank: AGTTCCGTTTGGGCATAAGTTCCAATGATC. Insertion Sequence: GTTCCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22F7.4. Homozygous. Outer Left Sequence: CGTGACGTCAGCACACTTTT. Outer Right Sequence: AATTTTCTTGCCCCCTTCTC. Inner Left Sequence: ACGCGTCGCAATTTTTGTAG. Inner Right Sequence: CGTTTCGCTCGTTTATGTTG. Inner Primer PCR Length: 1283 bp. Deletion Size: 491 bp. Deletion left flank: ATTAATTTTTGTGAACGCCTATTTTAGAGG. Deletion right flank: AAAAAAATTTTTGAAAAAAAAATTTTTTTT. Insertion Sequence: GG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07C4.4 & T07C4.1 Homozygous. Outer Left Sequence: agaaccgaggagcttcaaca. Outer Right Sequence: acgagaagcgacgatagcat. Inner Left Sequence: gatgctgcgttgtccagtag. Inner Right Sequence: tgaaaaatccggagagccta. Inner Primer PCR Length: 1229. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC123.4. Homozygous. Outer Left Sequence: CGACTCCCCTGCAAAGTTAG. Outer Right Sequence: AAGCTGGGGGAAGGATCTTA. Inner Left Sequence: CCACATATCCAGGGAAGTTGA. Inner Right Sequence: GCAACGGTGTATAAGTGCGA. Inner Primer PCR Length: 1173 bp. Deletion Size: 306 bp. Deletion left flank: TCAAGAGTTATGGCCGCAACGGCGCCTCCG. Deletion right flank: AACAACTCCCTTTCGCAATACGTTGAGCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50F4.14. Homozygous. Outer Left Sequence: AAGCAGTGGCTACCAACCAT. Outer Right Sequence: CCCGCCTTAACTACCATTCA. Inner Left Sequence: AAATGCAAACTTCGAGCAGC. Inner Right Sequence: GAATCCAACCAAATGGGAGA. Inner Primer PCR Length: 1274 bp. Deletion Size: 722 bp. Deletion left flank: GCTTCACTTTGTCAGATTTTGCCTCGCTAG. Deletion right flank: AAAACGGTCGTTAAACTACGTCCAACATAG. Insertion Sequence: TTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59D6.7. Homozygous. Outer Left Sequence: ACGGGCAAATTCCACATATT. Outer Right Sequence: AATACAAAACGGTATGCGCC. Inner Left Sequence: TTCATACATTTGATTGGTGTACTAA. Inner Right Sequence: AAATGCACACGTGGGGTTAG. Inner Primer PCR Length: 1297 bp. Deletion Size: 570 bp. Deletion left flank: TAGAAATTAATTCAAAAATCGCATCGACAT. Deletion right flank: CTGGGACATTCAAGAAGTCGTCACGTGACA. Insertion Sequence: CATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11A8.5 Homozygous. Outer Left Sequence: gccaccattcagcaattttt. Outer Right Sequence: accgatccgttgtgtttttc. Inner Left Sequence: tgaacgctgagcatccatag. Inner Right Sequence: cgcccgttttcttttaatg. Inner Primer PCR Length: 1218. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK353.8 Homozygous. Outer Left Sequence: tggcccatcgtttttcttag. Outer Right Sequence: agatggccagattttcgatg. Inner Left Sequence: tcgagtcttgttgttttccg. Inner Right Sequence: ggcaacatatcgattcgtca. Inner Primer PCR Length: 1251. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39D8.4 Homozygous. Outer Left Sequence: ttttgggaagtggagcaatc. Outer Right Sequence: ttgtgtctgcctactgctgg. Inner Left Sequence: tgaatgcagttggagcgtag. Inner Right Sequence: ccttctccacccttcctctt. Inner Primer PCR Length: 1128. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02E7.11 Homozygous. Outer Left Sequence: cacatatcagggcggaaatc. Outer Right Sequence: tccgtcgggtctgaaagtag. Inner Left Sequence: cgagatgaaccagagaaagttg. Inner Right Sequence: cgctttgaatcagaagactcc. Inner Primer PCR Length: 1238. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK757.2 Homozygous. Outer Left Sequence: acacacacacacacacacgg. Outer Right Sequence: ccaacgggaccatttatcac. Inner Left Sequence: cacaagcaaatcacttccga. Inner Right Sequence: gggggtggaatggagagtag. Inner Primer PCR Length: 1293. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E5.4 Homozygous. Outer Left Sequence: acatgttgtgcagcattggt. Outer Right Sequence: gcaaagatatcgtggctggt. Inner Left Sequence: gcgacctacggcaaaattag. Inner Right Sequence: gcaacagaaaccattctagcac. Inner Primer PCR Length: 1264. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C31C9.1. Homozygous. Outer Left Sequence: AATGTGCTAATCCGCAAACC. Outer Right Sequence: TAATCATTTTCCAGCCCTCG. Inner Left Sequence: CCTGGGATATTTTCGCAGAC. Inner Right Sequence: CGATCATCCACTCGTCATTG. Inner primer WT PCR product: 2333. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33A11.4/tag-97. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33A11.4/tag-97. Homozygous. Outer Left Sequence: GTTTATAGTCTGGTCTCACACAAGG. Outer Right Sequence: AATCGTCTGGTGTCTGTTTGACC. Inner Left Sequence: TACGAGCTGCACCAGATCTCG. Inner Right Sequence: TTACAGATTCTTCGTGAGACC. Inner primer WT PCR product: 3537. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01D7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44G3.6. Homozygous. Outer Left Sequence: tgtaccaccgtgaggaaaca. Outer Right Sequence: atgcacacattacccccatt. Inner Left Sequence: gcgactcattcagcatcaga. Inner Right Sequence: tggcataggtcctggcttag. Inner primer WT PCR product: 2405. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44D12.1. Homozygous. Outer Left Sequence: AAGAGAGGGATCGACTGCAA. Outer Right Sequence: AGGCAATGAGACGACGGTAG. Inner Left Sequence: AAACTGCTCAGGCAAATGCT. Inner Right Sequence: CCTTGAGCCGTGATATCCAT. Inner primer WT PCR product: 2735. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y57G11C.24c. Homozygous. Outer Left Sequence: TGGAAAGGGAGAGTCGTTTG. Outer Right Sequence: ACCAACCTGCTTCTGCTGTT. Inner Left Sequence: TCTCCACCACCACAACGTAA. Inner Right Sequence: GCGGAGCAACTCTTCCATAG. Inner primer WT PCR product: 2814. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17H12. Homozygous. Outer Left Sequence: GAAATCCGCCTGAAAAATCA. Outer Right Sequence: GTGAAAACCAAGTGCAGGGT. Inner Left Sequence: AGCATTATCCCCGCATGTAG. Inner Right Sequence: AAACTGGGCGAGGGATTTAG. Inner primer WT PCR product: 2532. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C31C9.1a. Homozygous. Outer Left Sequence: AGGCCTTCAGCAAATCACAT. Outer Right Sequence: TCCCAATTTCCAGAATGAGC. Inner Left Sequence: ATCAATTCAACTCGTTCGCC. Inner Right Sequence: ATCGAGGTGACCGTGAAGAC. Inner primer WT PCR product: 2812. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T04D3.4 Homozygous. Outer Left Sequence: CCGTAGGTGACTGTCGGTTT. Outer Right Sequence: TAGAAGGCTAACCCACGCAT. Inner Left Sequence: GTAGTTGACGGCAAAACCGT. Inner Right Sequence: GCGAAAAAGGCTTGTGGTAG. Inner Primer PCR Length: 3123. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41E6.6 Homozygous. Outer Left Sequence: TGTTAACTGCTGCTGCGTCT. Outer Right Sequence: AGCAATTGTTCGAAGATCCG. Inner Left Sequence: CCTTGGGAGACACCACAACT. Inner Right Sequence: CCTGCACTCCACACACATTC. Inner Primer PCR Length: 2729. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41E6.6. Homozygous. Outer Left Sequence: TGTTAACTGCTGCTGCGTCT. Outer Right Sequence: AGCAATTGTTCGAAGATCCG. Inner Left Sequence: CCTTGGGAGACACCACAACT. Inner Right Sequence: CCTGCACTCCACACACATTC. Inner Primer WT PCR product: 2729. Deletion size: 898 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41E6.6. Homozygous. Outer Left Sequence: TGTTAACTGCTGCTGCGTCT. Outer Right Sequence: AGCAATTGTTCGAAGATCCG. Inner Left Sequence: CCTTGGGAGACACCACAACT. Inner Right Sequence: CCTGCACTCCACACACATTC. Inner Primer WT PCR product: 2729. Deletion size: 898 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32E8.7. Homozygous. Outer Left Sequence: TGGGAAAGCTCGAACAAAGT. Outer Right Sequence: ATAAGAAAGGAGGGTGCCGT. Inner Left Sequence: ATTTCGCATGGTTAAGACCG. Inner Right Sequence: AGCGGGATGAATGCAGATAG. Inner Primer WT PCR product: 3019. Deletion size: 1671 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcagtttcaagatttcATGGCTACCATAG ; Right flanking sequence: ataggctgaaccaaaaaagtacatcgagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2168 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: GTTTCACAAAATGAATAAATTGAGCGATAG ; Right flanking sequence: TGATGCCTGTGATGTGTTGAGTAATGAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Emb. Deletion of 898 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead eggs (ve579 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atcggctcgtaaatctacacgaaaacctag ; Right flanking sequence: CACAAATCGGCTTCTCGTTCATGAAATCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous unhealthy. Deletion of 1650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sickly animals that can grow up to lay small broods (ve602 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: accgggaaaaatgtgaaattgcgaaactag ; Right flanking sequence: ggagggcaaagtgtattttttaaatgattt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3602 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctttggaaagttattcggtttgaagagtac ; Right flanking sequence: cagtgcagtacccctttcatggaagcccta. sgRNA #1: attcggtttgaagagtacga; sgRNA #2: aaaggggtactgcactgtag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2275 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtgttaaacggctataaaaaattcgtcca ; Right flanking sequence: aggttcatttaagaatgcctcttattcaaa. sgRNA #1: acaactatgggacaacgtag; sgRNA #2: CTATTAGGCAGCATTCAGgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2965 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttcattccttgttcttctttgtcacaATG ; Right flanking sequence: CGGAAAATGAATAGgaattgttttctttct. sgRNA #1: CCACGTGGTGTACAGgttag; sgRNA #2: ACAATTGTCATCGAAGCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 5117 bp  with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATACTTGTATCAGAATTTCCACGTGTCAGA ; Right flanking sequence: cggcgtcctggagagcccgacgccagaaat. sgRNA #1: GTTGAATCATTTTGCCATAG; sgRNA #2: ttctggtgtgtatgagtgtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 6712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve745 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tgggaataattttctctcgaatcaatatct ; Right flanking sequence: tttaattttttaaagttaaaaattttctag. sgRNA #1: atgaaacttgcacttcaccg; sgRNA #2: aagcggagtcgggaagaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaatcgatcccttttaatcactttttcct ; Right flanking sequence: TGGAGAGCAAGAAAGAGAAAATGGCAGAAA. sgRNA #1: taattaaacgctagaagaat; sgRNA #2: TAGGAAAATGTGTGAAAGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6742 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCCGGAGAACGACTATTGGAAGTGCTCCG ; Right flanking sequence: cggaatcggaaaattcagaaaatttcagtt. sgRNA #1: TTGAGCACCACATCACAGGT; sgRNA #2: aaatcatgttacagctgtag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 11823 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve842 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  [NOTE: xpd-1 is located near the end of the region of LG III balanced by sC1, thus not known if truly balanced by sC1.] Left flanking Sequence: CCGGATAAGCTTGATAAGCTTGTCTATTGT; Right flanking sequence: AGTTATTACGCTATCATGTCATGATGCTTC. xpd-1 sgRNA #1: TCCAGAACTATTCCAGGTAG; xpd-1 sgRNA #2: GCCAGTTGACTACCATCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.