Search Strains

More Fields
Strain Species Genotype Add
KR1626 C. elegans unc-74(x19) dpy-5(e61) I; hDp77 (I;f). Show Description
WT strain which segregates DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1754 C. elegans unc-74(x19) dpy-5(e61) I; hDp29 (I;f). Show Description
Unc. Segregates DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1949 C. elegans hIn1 I. Show Description
WT phenotype. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR2839 C. elegans hDf15 unc-75(e950)/hIn1 [unc-54(h1040)] I. Show Description
Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf15 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.
KR472 C. elegans unc-73(h142) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile adults.
LE137 C. elegans unc-73(rh40) I. Show Description
24% PDE axon guidance errors, 28% ectopic axons. Reference: Lundquist et al. Development. 2001 Nov;128(22):4475-88.
LE2418 C. elegans unc-73(rh40) tiam-1(ok772) I; lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)]. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
LE2717 C. elegans unc-73(rh40) tiam-1(tm1556) I; lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)]. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
LIU1 C. elegans ldrIs1. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Reference: Zhang P, et al. Mol Cell Proteomics. 2012 Aug;11(8):317-28.
LIU104 C. elegans dhs-28(ldr6) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr6 is G-to-A causing a G158E substitution. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G158E substitution site of the ldr6 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
LIU2 C. elegans ldrIs2. Show Description
ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. mdt-28::mCherry is expressed ubiquitously in the intestine, muscle, hypodermis, and embryos, and localized primarily to the lipid droplets. Reference: Na H, et al. Biochimica et Biophysica Acta. 2015 S0167-S4889.
LIU65 C.elegans dhs-28(ldr5) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr5 is C-to-T substitution causing a premature stop (Q139*). Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The Q139* premature stop in the ldr5 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
LIU86 C. elegans dhs-28(ldr4) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr4 is a G-to-A mutation in the splice donor site of Intron 1. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G-to-A mutation in the splice donor site is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
MH1317 C. elegans kuIs29 V. Show Description
kuIs29 [egl-13p::GFP + unc-119(+)] V. egl-13 is the new gene name for cog-2. Transcriptional fusion of GFP to egl-13 gene. Nuclear localized. Bright expression in body wall muscles, expressed in uterine pi lineage, extensive neuronal expression. Note that a very low penetrance Cog phenotype is seen in this strain. Transgenes with egl-13 promoter can cause Cog phenotype. Conflicting map data: Wendy Hanna-Rose mapped kuIs129 to the left of dpy-11; Shi lab reported it close to gon-10 and unc-76.
ML653 C. elegans vab-10(mc44)/unc-75(e950) unc-101(m1) I. Show Description
Heterozygotes are WT and segregate WT, Uncs and dead eggs and larvae with severe body morphology defects that do not develop beyond the L2 stage. A few very rare mc44 larvae reach adulthood but they become sterile. mc 44 is a deletion affecting the downstream transcription unit of vab-10 named vab-10b. Fails to complement the vab-10 null reference allele vab-10(h1356), but complements the vab-10a alleles vab-10a(e698) and vab-10a(ju281).
ML691 C. elegans vab-10(ok817)/unc-75(e950) unc-101(m1) I. Show Description
Heterozygotes are WT and segregate WT, Uncs, and severely Lumpy arrested L1s (ok817). m1 can easily get lost through recombination.
ML743 C. elegans rdy-2(mc40)/sqt-3(sc63) him-5(e1467) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Rol Uncs, and dead L2 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).
MSB115 C elegans unc-70(mir6[loxP] mir16[loxP]) V. Show Description
Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
MT10408 C. elegans lin-53(n833) I; unc-76(e911) V; lin-15A(n767) X; nEx998. Show Description
nEx998 [lin-53::GFP + unc-76(+)]. Pick non-Unc, non-Muv to maintain.
MT10865 C. elegans unc-76(e911) V; nEx1039. Show Description
nEx1039 contains [ced-10p::GFP::ced-10 + unc-76(+)]. Maintain at 20 C. Described in Lunquist et al., Development 128, 4475-4488 (2001).
MT1676 C. elegans unc-70(n493) dpy-11(e224) V. Show Description
DpyUnc. Semidominant Unc.
MT1790 C. elegans unc-78(e1217) lin-18(e620) lon-2(e678) X. Show Description
Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture; temperature sensitive. Unc. Lon.
MT2550 C. elegans unc-79(e1068) ced-4(n1162) III. Show Description
Unc. Cells that normally die survive.
MT2590 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1171)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1171 homozygotes) and dead eggs.
MT2591 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1172)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1172 homozygotes) and dead eggs.
MT2592 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1173)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygtes), arrested larvae (n493n1173 homozygotes) and dead eggs.
MT2663 C. elegans sqt-3(sc63) him-5(e1467) egl-1(n986) unc-76(e911) V. Show Description
Dominant Egl. Unc. Dpy (ts). Throws males.
MT3553 C. elegans egl-43(n997) II; unc-76(e911) V. Show Description
n997: Egl, 5HT-S, IMIP-R.
MT3618 C. elegans unc-75(e950) ced-1(n1506) unc-59(e261) I. Show Description
MT3637 C. elegans lin-11(n566) unc-75(e950) I. Show Description
MT4552 C. elegans unc-74(e883) bli-4(e937) unc-87(e1459) I. Show Description
Blistered Uncs.
MT4818 C. elegans unc-70(n493) V. Show Description
Semi-dominant Unc.
MT5439 C. elegans sqt-3(sc8) unc-76(e911) V; lon-2(e678) xol-1(y70) X. Show Description
Roller. Long. Unc. XO Lethal. sc8 previously called rol-4(sc8).
MT6160 C. elegans unc-76(n2397) V. Show Description
Unc. Null allele of unc-76.
MT6161 C. elegans unc-76(n2398) V. Show Description
Unc. Weak allele of unc-76.
MT6292 C. elegans unc-76(n2457) V. Show Description
Unc.
MT6550 C. elegans lam-3(n2561)/dpy-5(e61) unc-75(e950) I. Show Description
Heterozygotes are WT. Segregate Dpy Uncs. Segregate L1 lethal: starved, uncoordinated, defective pharyngeal basement membrane.
MT6940 C. elegans dpy-20(e1282) IV; unc-76(e911) V. Show Description
Unc. Temperature sensitive Dpy.
MT8186 C. elegans mpk-1(oz140)/dpy-17(e164) unc-79(e1068) III. Show Description
Heterozygotes are WT and segregate WT, Vul and DpyUncs. oz140 homozygotes are Vul and Sterile.
MT8388 C. elegans dpy-17(e164) mpk-1(oz140)/dpy-17(e164) unc-79(e1068) III. Show Description
Heterozygotes are Dpy and segregate Dpy, DpyUncs and DpyVulSterile. oz140 homozygotes are Vul and Sterile.
MT9926 C. elegans efl-1(n3318)/unc-76(e911) dpy-21(e428) V. Show Description
Heterozygotes are WT and segregate WT, UncDpy and Mel. Received new stock from the Horvitz lab 5/04.
NG2473 C. elegans unc-73(gm123) I; sDp2 (I;f). Show Description
Animals with sDp2 are WT. Animals without the duplication are severe Uncs with withered tails, are small and often have lateral ectopic vulvae. gm123 does not survive through more than 1-2 generations. Many cell migrations defects in gm123 animals.
NG2501 C. elegans epi-1(gm121) kyIs5 IV. Show Description
kyIs5 [ceh-23p::unc-76::GFP + lin-15(+)] IV. kyIs5 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons.
NG2837 C. elegans dpy-5(e61)/unc-73(gm40) I. Show Description
Heterozgyotes are WT and segregate WT, Dpys and Uncs. Recombination occurs in this strain so pick individual WT animals and score the progeny for both Dpys and Uncs.
NG33 C. elegans unc-73(gm33) I. Show Description
EXTREMELY sick - Ham, lateral vulvae, grow at 20C. Very difficult to maintain. CGC received new stock 1/01.
NJ388 C. elegans unc-76(rh116) V. Show Description
Unc. Loss-of-function or null allele.
NW424 C. elegans unc-76(ev424) V. Show Description
Unc. Loss-of-function or null allele.
OC235 C. elegans sun-1(bs12) unc-76(e911) V. Show Description
Unc. bs12 mutation causes sublethal defect in attachment of centrosome to the nucleus in early embryos. Viable 15-25 C. Reference: Kemp et al. (2007) Genetics 176:95-113.
OH18203 C. elegans ceh-44(ot1294[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH18268 C. elegans ceh-44(ot1402[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1402 is a deletion removing the UNC-75 binding site within intron 7 of the endogenously-tagged ceh-44 locus. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.