paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. ech-7(et6) suppresses the cold-adaptation defect of paqr-2(tm3410) and partially suppresses the tail tip defect. ech-7(et6); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

Heterozygotes are WT and segregate WT, Unc and adult steriles (cul-2 homozygotes). cul-2 homozygotes have large germ cells and lay few eggs (slightly temperature sensitive, with more eggs at lower temperatures) that arrest early in development with multiple nuclei.

Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat.

Homozygous viable. Deletion of 1579 bp in parental strain N2. Left flanking sequence: gcaaaaaaaaacataccaga; Right flanking sequence: cgtggtttcaggccattacg. sgRNA #1: cctcactgatgatcgtcatc; sgRNA #2: aaaggttcagcattcacacg.

Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.

Homozygous viable. Deletion of 796 bp in parental strain N2, with insertion of 13 nucleotides(tcaacaaaatgcc) at break. Left flanking sequence: taatatcctccggaccgata; Right flanking sequence: gtcctgactgataatcatcaac. sgRNA #1: tgtgtagtataaacgattat; sgRNA #2: cgggtcacgagtagagatgg.