Laboratory Information
| Name | OH View on WormBase |
|---|---|
| Allele designation | ot |
| Head | Oliver Hobert |
| Institution | Columbia University, New York, NY |
| Address | 1212 Amsterdam Ave. Mail Code: 2431 Fairchild Bldg. Rm 805 New York 10027 United States |
| Website | http://hobertlab.org/ |
| Gene classes | acly aexr anat anmt arid best camt cnih cof comt cpd dmsr dop dopy dpff dpt drap egas elk eno exl eyg fozi frpr gipc glna gmeb gmps gopc gras hat homt hse igdb igeg iglr irld josd lol lsl lsy lurp maf magu men nap neto nfx npax oig pin psmd secr sipa srq sssh suds sul svop tmc trpl ubql vglu vnut wrk zhit zig alfa bnc fezf hasp hinf lmd peli piez row slc trak pals vpat nova slrp sgnh pno lido wac |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| BFF40 | mjIs134 II; meg-3(tm4259) meg-4(ax2026) X. | C. elegans | mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Germ granule defective. ~30% sterility, maintain by picking gravid adults with visible embryos. Nuclear GFP expression in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614 |
| BFF48 | mjIs134 II; hrde-1(tm1200) III. | C. elegans | mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, Mortal germline (Mrt) at 25C. Expressing nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614 |
| BFF49 | mjIs134 II; hrde-1(tm1200) III; meg-3(tm4259);meg-4(ax2026) X. | C. elegans | mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, germ granule defective, high sterility. Expresses nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614 |
| BFF53 | bqSi577 IV. | C elegans | bqSi577 [myo-2p::GFP + unc-119(+)] IV. Expresses GFP in pharyngeal muscles. Single-copy insertion in the MosSCI locus cxTi10882 on chromosome IV. Obtained via the outcrossing of strain BN578 with N2. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343. |
| BFF57 | srd-1(eh1) II; bqSi577 IV; meg-3(tm4259) meg-4(ax2026) X. | C. elegans | bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germline granules defective, ~30% sterility. Males fail to be attracted by hermaphrodite-secreted volatile sex pheromones. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343 |
| BFF70 | bqSi577 IV; meg-3(tm4259) meg-4(ax2026) X. | C. elegans | bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germ granule defective, ~30 sterility. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343 |
| DA1519 | lin-15B&lin-15A(n765) X; adEx1519. | C. elegans | adEx1519 [M03F4.3::GFP + lin-15(+)]. Putative serotonin receptor. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1616 | lin-15B&lin-15A(n765) X; adEx1616. | C. elegans | adEx1616 [ser-4::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1641 | lin-15B&lin-15A(n765) X; adEx1641. | C. elegans | adEx1641 [C09B7.1::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1644 | lin-15B&lin-15A(n765) X; adEx1644. | C. elegans | adEx1644 [K02F2.6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1646 | lin-15B&lin-15A(n765) X; adEx1646. | C. elegans | adEx1646 [T02E9.3::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1647 | lin-15B&lin-15A(n765) X; adEx1647. | C. elegans | adEx1647 [dop-1(trans)::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1648 | lin-15B&lin-15A(n765) X; adEx1648. | C. elegans | adEx1648 [F01E11.5::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1649 | lin-15B&lin-15A(n765) X; adEx1649. | C. elegans | adEx1649 [F14D12.6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| EK123 | cmEx6. | C. elegans | cmEx6 [(pBR126) mbk-2p::GFP + rol-6(su1006)]. Maintain by picking Rollers. |
| EK224 | cmIs6 I; unc-4(e120) II. | C. elegans | cmIs6 [mbk-1::GFP + unc-4(+)]. Reference: Raich WB, et al. Genetics. 2003 Feb;163(2):571-80. doi: 10.1093/genetics/163.2.571. PMID: 12618396. |
| GS10011 | arTi479 [unc-47p::cre::unc-54 3'UTR] I. | C. elegans | miniMOS insertion expressing cre recombinase specifically in GABAergic neurons. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| JN1194 | gcy-14(pe1102) V. | C. elegans | Reference: Ortiz CO, et al., Curr Biol. 2009 Jun 23;19(12):996-1004. |
| MOS284 | dmd-10(ety5) V. | C. elegans | CRIPSR/Cas9-engineered dmd-10 null mutant. Generated in N2 background. crRNA1: ATTCTTAAATTGATACAGAA. crRNA2: GGAAACGTGGATAGTTTGAG. ssODN: TAACTTCCAAACCTTCGAAATTCTTAAATTGATACAACTATCCACGTTTCCACCCACCACTTCATCTTAC. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| MT1191 | exc-4(n561) I. | C. elegans | Exc canal outgrowth abnormal. |
| NIC203 | Caenorhabditis tropicalis wild isolate. | C. tropicalis | Caenorhabditis tropicalis wild isolate. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| NW1229 | dpy-20(e1362) IV; evIs111. | C. elegans | evIs111 [F25B3.3::GFP + dpy-20(+)]. Pan-neural expression. |
| OH1003 | eno-9(ot9) oxIs12 X. | C. elegans | oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
| OH10050 | otIs317. | C. elegans | otIs317 [mgl-1::mCherry + pha-1(+)]. |
| OH10051 | unc-119(ed3) III; sox-2(ot640[unc-119(+)])/+ X. | C. elegans | ot640 was generated by using MosDel removing the entire sox-2 locus and insert unc-119(+). Heterozygotes are WT and segregate WT heterozygotes, Uncs and ot640 homozygous that arrest in L1 with a pharynx unattached (Pun) phenotype. Maintain by picking WT and check for correct segregation of progeny to maintain. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77. |
| OH10053 | unc-119(ed3) III; sox-2(ot640[unc-119(+)]) X; otEx4454. | C. elegans | otEx4454 [sox-2(fosmid)::mCherry + elt-2p::DsRed]. ot640 was generated by using MosDel removing the entire sox-2 locus and insert unc-119(+). ot640 homozygous arrest in L1 with a pharynx unattached (Pun) phenotype. Maintain by picking WT to maintain (transgene should be required for viability). Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77. |
| OH101 | mgIs20. | C. elegans | mgIs20 [K03E6::GFP + rol-6(su1006)]. |
| OH10101 | otIs323. | C. elegans | otIs323 [cho-1p(SL2 bicistronic)::2xNLS::GFP + elt-2::DsRed2]. Fosmid-based reporter labels virtually all cholinergic neurons. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10221 | ccIs4251 I; otIs77 II; ruIs37 III; jcIs1 IV; vsIs33 V. | C. elegans | ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. ruIs37 [myo-2p::GFP + unc-119(+)] III. jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. vsIs33 [dop-3::RFP] V. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91. |
| OH10237 | otIs326 X. | C. elegans | otIs326 [ins-1::GFP + rol-6(su1006)] X. Rollers. |
| OH10243 | pha-1(e2123) III; otEx4548. | C. elegans | otEx4548 [tbb-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10247 | pha-1(e2123) III; otEx4552. | C. elegans | otEx4552 [unc-11(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10248 | pha-1(e2123) III; otEx4553. | C. elegans | otEx4553 [unc-64(fosmid; isoform B)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10250 | pha-1(e2123) III; otEx4555. | C. elegans | otEx4555 [unc-104(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10252 | pha-1(e2123) III; otEx4557. | C. elegans | otEx4557 [shn-1(fosmid)::SL2::NLS::YFP::H2B + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Nuclear YFP expression in muscle. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10255 | pha-1(e2123) otIs314 III; otEx4560. | C. elegans | otIs314 [rab-3p(prom1)::2xNLS::TagRFP] III. otEx4560 tbb-5(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx4560. Broad neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10260 | pha-1(e2123) III; otIs356 V; otEx4553. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx4553 [unc-64A(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx5924. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH103 | mgIs21. | C. elegans | mgIs21 [lin-11(ABCDE)::GFP + rol-6(su1006)]. Rollers. |
| OH10330 | otIs333 II. | C. elegans | otIs333 [sox-2(fosmid)::mCherry + rol-6(su1006)]. Rollers. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77. |
| OH10331 | otIs334. | C. elegans | otIs334 [sox-3(fosmid)::mCherry + rol-6(su1006)]. Rollers. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77. |
| OH10425 | otIs337. | C. elegans | otIs337 [unc-86(fosmid)::NLS:::YFP::H2B + ttx-3::mCherry]. |
| OH10434 | otIs232. | C. elegans | otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL. |
| OH105 | mgIs23 ; him-5(e1467) V. | C. elegans | Rollers. Throws males. mgIs23[lin-11DE::GFP; rol-6(su1006)]. |
| OH10535 | pha-1(e2123) otIs314 III; otEx4681. | C. elegans | otIs314 [rab-3p(prom1)::2xNLS::TagRFP] III. otEx4681 [snn-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx4681. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10545 | otIs341 X. | C. elegans | otIs341 [mgl-1::GFP + pha-1(+)]. |
| OH10596 | otEx4720. | C. elegans | otEx4720 [YFP::hlh-2(+)(fosmid; N-terminal fusion)+ rol-6(su1006)]. Rollers. Maintain at 15-20C by picking rollers. Fosmid was recombineered in Greenwald Lab. |
| OH10667 | pha-1(e2123) III; otEx4767. | C. elegans | otEx4767 [trp-1p(1.5kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10684 | pha-1(e2123) III; otIs350. | C. elegans | otIs350 [ric-4(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10686 | pha-1(e2123) III; otIs352. | C. elegans | otIs352 [ric-4(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10687 | pha-1(e2123) III; otIs353. | C. elegans | otIs353 [ric-4(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10689 | otIs355 IV. | C. elegans | otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. Pan-neuronal nuclear RFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10690 | otIs356 V. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. Pan-neuronal nuclear RFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH10712 | pha-1(e2123) III; otEx4794. | C. elegans | otEx4794 [del-1p(2.6kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10720 | pha-1(e2123) III; otEx4802. | C. elegans | otEx4802 [T13G4.3p(3kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10721 | pha-1(e2123) III; otEx4803. | C. elegans | otEx4803 [twk-7p(3kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10722 | pha-1(e2123) III; otEx4804. | C. elegans | otEx4804 [twk-13p(2.5kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10723 | pha-1(e2123) III; otEx4805. | C. elegans | otEx4805 [twk-40p(2.5kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10724 | pha-1(e2123) III; otEx4806. | C. elegans | otEx4806 [twk-43p(4.9kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10733 | cnd-1(ot704) III; otIs341 X. | C. elegans | otIs341 [mgl-1::GFP + pha-1(+)]. cnd-1(ot704) is Q118=>STOP. |
| OH10739 | cnd-1(ot705) III; otIs341 X. | C. elegans | otIs341 [mgl-1::GFP + pha-1(+)]. cnd-1(ot705) is L42=>F. |
| OH10754 | pha-1(e2123) III; otEx4818. | C. elegans | otEx4818 [del-1p(2.6kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10765 | pha-1(e2123) III; otIs358. | C. elegans | otIs358 [ser-2(prom2)::GFP + pha-1(+)]. |
| OH1078 | ttx-3(ot22) X; otEx621. | C. elegans | otEx621 [(pAIY-MCS) ttx-3(cDNA) + unc-47(long)::GFP]. Maintain by picking GFP+. |
| OH10799 | otEx4844. | C. elegans | otEx4844 [acr-14p(300bp promoter)::DsRed2 + pha-1(+)]. Maintain by picking DsRed2(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10819 | unc-3(e151) X; vsIs48; otEx4441. | C. elegans | otEx4441 [hsp-16.2p::unc-3(cDNA) + ttx-3::mCherry]. vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. Maintain by picking mCherry(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10847 | otEx4539. | C. elegans | otEx4539 [unc-3p(SL2 fosmid)::mCherry + myo-2::GFP]. Fosmid-based reporter. Maintain by picking GFP(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10849 | otEx4793. | C. elegans | otEx4793 [ceh-36p::unc-3(cDNA) + rol-6(su1006)]. Maintain by picking rollers. ceh-36p::unc-3(cDNA) construct made by P. Sengupta. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10850 | unc-3(e151) X; otEx4432. | C. elegans | otEx4432 [ace-2p(SL2 fosmid)::GFP + elt-2::DsRed2]. Fosmid-based reporter. Maintain by picking DsRed2(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10851 | juIs14 IV; unc-3(e151) X; otEx4812. | C. elegans | otEx4812 [unc-30p(2.6kb promoter)::unc-3(cDNA)::unc-54 3'UTR + myo-2::GFP]. juIs14 [acr-2p::GFP + lin-15(+)]. Maintain by picking myo-2::GFP(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989. |
| OH10892 | otIs374. | C. elegans | otIs374 [unc-47p(300bp)::mChopti::unc-54 3'UTR + pha-1(+)]. mChopti is visible under dissecting scope. |
| OH1092 | otIs131. | C. elegans | otIs131 [gcy-7::RFP + rol-6(su1006)]. Rollers. |
| OH10953 | hlh-16(ot711) I; otIs341 X. | C. elegans | otIs341 [mgl-1::GFP + pha-1(+)]. hlh-16(ot711) is R21=>STOP. |
| OH10969 | unc-42(ot712) vsIs33 V; otIs341 X. | C. elegans | vsIs33 [dop-3::RFP] V. otIs341 [mgl-1::GFP + pha-1(+)] X. unc-42(ot712) is W181=>STOP. |
| OH10972 | otIs376. | C. elegans | otIs376 [eat-4(prom4)::GFP + rol-6(su1006)]. Rollers. Reference: Serrano-Saiz E, et al. Cell 2013. Oct; 155(3):659-73. |
| OH1098 | otIs133 II. | C. elegans | otIs133[pttx-3::RFP + unc-4(+)]. RFP expressed in AIY only. |
| OH10993 | otEx4944. | C. elegans | otEx4944 [lin-53::GFP + rol-6(su1006)]. Rollers. Maintain at 25C; pick Rollers. GFP recombineered at C-terminus of lin-53 in fosmid WRM0634aA12. otEx4945 was generated as a complex array with digested bacterial genomic DNA. |
| OH10997 | otIs264 III; ntIs1 V; otIs305. | C. elegans | otIs264 [ceh-36p::tagRFP] III. ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. Maintain at 15-20C. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8. |
| OH110 | lim-6(nr2073) X. | C. elegans | Egl. Exp. Syn daf-c. 1.7 kb deletion in lim-6 locus. |
| OH11020 | otEx4961. | C. elegans | otEx4961 [lsy-6(300bp 3')::GFP::unc-54 3'UTR + ttx-3:mCherry]. Maintain by picking animals with mCherry in the AIY neurons. |
| OH11025 | otIs252; otEx4965. | C. elegans | otEx4965 [tbx-38p::mCherry::unc-54 3'UTR + ttx-3::mCherry]. Maintain otEx4965 by picking animals with mCherry in the AIY neurons. otIs252 [lsy-6(fosmid)::YFP + rol-6(su1006)]. Rollers. YFP expression in ASEL. |
| OH11030 | otIs379 otIs317. | C. elegans | otIs379 [cho-1(-3006/-2642)::GFP + rol-6(su1006)]. otIs317 [mgl-1::mCherry + pha-1(+)]. otIs379 appears to be linked to otIs317. Rollers. |
| OH11053 | ntIs1 otIs305 otIs355 V. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)] V. otIs355 [rab-3::tagRFP] V. Maintain at 15-20C. Rollers. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8. |
| OH11054 | pha-1(e2123) III; him-8(e1489) IV; ntIs1 V; otIs305; otEx4445. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. otEx4445 [snb-1::NLS::RFP + pBX]. Rollers. Maintain by picking RFP+ Rollers. Maintain at 20C to maintain extrachromosomal array. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8. |
| OH11061 | otIs381 V. | C. elegans | otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH11092 | pha-1(e2123) III; otEx5012. | C. elegans | otEx5012 [lsy-6p::YFP::unc-54 3'UTR + ttx-3p::mCherry + pha-1(+)]. Maintain at 25C; pick mCherry(+). |
| OH11094 | pha-1(e2123) III; otEx5014. | C. elegans | otEx5014 [lsy-6p::YFP::lsy-6 3' sequence + ttx-3p::mCherry + pha-1(+)]. Maintain at 25C; pick mCherry(+). |
| OH11096 | pha-1(e2123) III; otEx5016. | C. elegans | otEx5016 [lsy-6 300bp 3'::lsy-6p::YFP::unc-54 3'UTR + ttx-3p::mCherry + pha-1(+)]. Maintain at 25C; pick mCherry(+). Some rescued worms do not have ttx-3::mCherry expression. |
| OH11098 | pha-1(e2123) III; otEx5018. | C. elegans | otEx5018 [lsy-6p::YFP::lsy-6(300bp 3')::unc-54 3'UTR + ttx-3:mCherry + pha-1(+)]. Maintain by picking animals with mCherry in the AIY neurons. Maintain at 25C to select for pha-1(+) array. |
| OH11101 | otEx5021. | C. elegans | otEx5021 [lsy-6(fosmid - delta 300 bp 3')::GFP + ttx-3::mCherry]. Maintain by picking animals with mCherry expression in the AIY neurons. |
| OH11102 | lsy-6(ot71) otIs3 V; otEx5022. | C. elegans | otEx5022 [lsy-6(fosmid - delta 150 bp 3') + ttx-3::mCherry]. otIs3 [gcy-7p::GFP + lin-15(+)] V. Maintain by picking animals with mCherry expression in the AIY neurons. Fosmid with 150 bp deletion does not rescue ASE asymmetry. |
| OH11104 | lsy-6(ot71) otIs3 V; otEx5024. | C. elegans | otEx5024 [lsy-6(fosmid) + ttx-3::mCherry]. Maintain otEx5024 by picking animals with mCherry in the AIY neurons. otIs3 [gcy-7p::GFP + lin-15(+)] V. Integrated from adEx1288; genetically mapped between 3.05 m.u. (T19B10) and 5.86 m.u. (AH10) on V. GFP expression appears in ASEL and the excretory cell in adult animals. |
| OH11107 | otEx5027. | C. elegans | otEx5027 [lsy-6(fosmid - delta 3 kb 3')::YFP + ttx-3::mCherry]. Maintain by picking animals with mCherry expression in the AIY neurons. |
| OH11111 | lsy-6(ot71) otIs3 V; otEx5028. | C. elegans | otIs3 [gcy-7p::GFP + lin-15(+)] V. otEx5028 [lsy-6p::lsy-6(hairpin) + ttx-3::mCherry]. |
| OH11113 | lsy-6(ot71) otIs3 V; otEx5030. | C. elegans | otIs3 [gcy-7p::GFP + lin-15(+)] V. otEx5030 [lsy-6p::lsy-6(hairpin)::lsy-6 1kb 3' + ttx-3::mCherry]. |
| OH11115 | otIs286. | C. elegans | otIs386 [lsy-6(fosmid - delta 150 bp 3')::GFP + ttx-3::mCherry]. |
| OH11117 | otIs306, otEx4963. | C. elegans | otEx4963 [lsy-6p(fosmid delta 150bp downstream)::GFP + ttx-3:mCherry]. Maintain otEx4963 by picking animals with mCherry in the AIY neurons. otIs306 [hsp-16.2::che-1::3xHA + rol-6(su1006)]. Rollers. |
| OH11119 | otIs377; otEx4945. | C. elegans | otIs377 [myo-3p::mCherry]. otEx4945 [hsp16-2p::hlh-1::2xFLAG + rol-6(su1006)]. Rollers. Maintain at 15-20C; pick Rollers. Both otIs377 and otEx4945 were generated as complex arrays with digested bacterial genomic DNA. |
| OH11124 | otIs388 pha-1(e2123) III. | C. elegans | otIs388 [eat-4(fosmid)::SL2::YFP::H2B + pha-1(+)] III. Reference: Serrano-Saiz E, et al. Cell 2013. Oct; 155(3):659-73. |
| OH11152 | otIs392. | C. elegans | otIs392 [eat-4(prom6)::GFP + ttx-3::DsRed]. Reference: Serrano-Saiz E, et al. Cell 2013. Oct; 155(3):659-73. |
| OH11157 | pha-1(e2123) III; otIs393. | C.elegans | otIs393 [ift-20p::NLS::tagRFP + pha-1(+)]. Maintain at 25C to retain array. Pan-sensory neuronal GFP expression. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979. |
| OH11166 | vab-3(ot569); otIs138. | C. elegans | otIs138 [ser-2(prom3)::GFP + rol-6(su1006)]. Rollers. Reference: Serrano-Saiz E, et al. Cell 2013. Oct; 155(3):659-73. |
| OH11319 | otIs412 X. | C. elegans | otIs412 [unc-3p::GFP + rgef-1p::DsRed] X. GFP expression in DA/DB/VA/VB class neurons. Reference: Kerk SY, et al. Neuron 2017 (in press). |
| OH11350 | otIs235; otIs252; otEx5141. | C. elegans | otEx5141 [hsp::tbx-37 + hsp::tbx-38 + elt-2p::DsRed]. Maintain by picking animals with dsRed in intestinal nuclei. Transcription factors TBX-37 and TBX-38 are ectopically expressed under control of a heat shock-inducible promoter. otIs235 [che-1p::mCherry + rol-6(su1006)]. otIs252 [lsy-6(+)(fosmid)::YFP + rol-6(su1006)]. Rollers. YFP expression in ASEL. |
| OH11410 | pha-1(e2123) III; otEx5173. | C. elegans | otEx5173 [nsf-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH11411 | pha-1(e2123) III; otEx5174. | C. elegans | otEx5174 [unc-31(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH11412 | pha-1(e2123) III; otEx5175. | C. elegans | otEx5175 [maco-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH11416 | otIs419. | C. elegans | otIs419 [snb-1p(prom17)::2xNLS::GFP + elt-2::DsRed2]. Ubiquitous GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH11462 | swsn-2.2(ok3161) I; otEx5094. | C. elegans | otEx5094 [swsn-2.2p::swsn-2.2::mChopti + ttx-3::GFP]. Pick GFP+ to maintain. ok3161 homozygotes arrest in early larval development. otEx5094 rescues lethality, but animals are still somewhat sick at 25C. |
| OH11496 | otEx5208. | C. elegans | otEx5208 [inx-17(fosmid)::GFP + rol-6(su1006)]. Strain does not roll well, but GFP expression is easily detected. GFP tag inserted into fosmid WRM0619cH12. |
| OH11620 | otIs429; otIs337. | C. elegans | otIs429 [pag-3(fosmid)::mChOpti + ttx-3::GFP]. otIs337 [unc-86(fosmid)::NLS:::YFP::H2B + ttx-3::mCherry]. |
| OH11630 | lsy-27(ot108) II; ntIs1 V. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. 2 ASER. |
| OH11674 | otIs437 V. | C. elegans | otIs437 [unc-3p::rab-3::GFP + ttx-3p::mCherry] V. Reporter contains 558bp upstream of unc-3 start site; marks presynapses of DA/DB class motor neurons innervating muscle and VD motor neurons in dorsal nerve cord. Reference: Kratsios P, et al. Curr Biol. 2015 May 18;25(10):1282-95. |
| OH11704 | ham-3(tm3309) III. | C. elegans | Egl. Slow growing. Lethal/sterile at 25C. Maintain at 15-20C. |
| OH11705 | ham-3(n1654) III; otEx5093. | C. elegans | otEx5093 [ham-3p::ham-3::GFP + elt-2::DsRed]. Strain can be maintained at 25C to increase frequency of array transmission. Pick GFP+ or DsRed+ to maintain. DsRed expression is difficult to detect at low magnification. otEx5093 rescues n1654; animals carrying the array are essentially wild-type. n1654 homozygotes without the array are Egl, slow growing, and lethal/sterile at 25C. |
| OH11738 | otIs439. | C. elegans | otIs439 [lad-2p::GFP + pha-1(+)]. |
| OH11744 | otIs445; gwIs39. | C. elegans | otis445 [ace-2p::RFP + LacO repeats]. gwIs39 [baf-1p::GFP::lacI::let-858 3'UTR + vit-5p::GFP]. RFP expression in cholinergic motor neurons. LACI::GFP aggregates on LacO repeats to form two dots in every nucleus. vit-5::GFP is expressed in intestine at L4 stage and later. Reference: Patel T & Hobert O. eLife 2017. |
| OH11746 | pha-1(e2123) III; otIs447 IV. | C. elegans | otIs447 [unc-3p::mCherry + pha-1(+)] IV. DA/DB/VA/VB motor neuron class-specific red fluorescent reporter. Reference: Kerk SY, et al. Neuron 2017 (in press). |
| OH11809 | otIs450. | C. elegans | otIs450 [oig-1(fosmid)::SL2::GFP + rol-6(su1006)]. Rollers. Integrated fosmid-based oig-1 transcritpional reporter. |
| OH12050 | otEx5449. | C. elegans | otEx5449 [fozi-1(fosmid)::YFP + che-1p::mCherry]. otEx5449 is a complex array derived from injection with PvuII-digested E. coli genomic DNA. Onset of fozi-1::YFP expression is around 3-fold stage in embryos. Pick animals with che-1p::mCherry exprssion in ASE neurons to maintain. |
| OH122 | mgIs25. | C. elegans | mgIs25 [unc-97::GFP]. Translational fusion of the complete encoding sequence of unc-97. |
| OH12312 | otIs388 pha-1(e2123) III; him-5(e1490) V. | C. elegans | otIs388 [eat-4(fosmid)::SL2::YFP::H2B + pha-1(+)] III. Him. Reference: Serrano-Saiz E, et al. Cell. 2013 Oct 24;155(3):659-73. |
| OH12343 | lin-13(ot785) III; otIs476 V. | C. elegans | otIs476 [glr-4p::TagRFP] V. ot785 is a H2121Y missense mutation in the DNA-binding site. De-repression of ectopic effector genes in AS class motor neurons. Reference: Kerk SY, et al. Neuron. 2017 93(1):80-98. |
| OH12344 | cfi-1(ot786) I. | C. elegans | De-repression of ectopic effector genes in DA/DB class motor neurons. Reference: Kerk SY, et al. Neuron. 2017 (in press). |
| OH12372 | otIs494 [flp-6fosmid::sl2::1xNLS::mChOpti]. | C. elegans | otIs494 [flp-6(fosmid)::sl2::1xNLS::mChOpti]. Cytoplasmic mChOpti expression in ASE, AFD, ASG, I1, PVT and VC neurons. Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision) |
| OH12389 | mab-9(ot788) II; hdIs1 X. | C. elegans | hdIs1 [unc-53p::GFP + rol-6(su1006)] X. Rollers. De-repression of ectopic effector genes in DA/DB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press). |
| OH12412 | otIs502. | C.elegans | otIs502 [hlh-2(fosmid)::YFP + myo-3p::mCherry]. Broad embryonic expression; later in development transgene is expressed in DTCs, vulva, and some gland cells in pharynx. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979. |
| OH12495 | otIs517. | C. elegans | otIs517 [tph-1(fosmid)::SL2::YFP::H2B + ttx-3::mCherry]. Fosmid-based tph-1 reporter expresses YFP in NSM, ADF, and HSN neurons, as well as in R1B, R3B, and R9B (in males). Adult animals roll, though for reasons unknown. |
| OH12499 | otEx5663. | C. elegans | otEx5663 [unc-30p::GFP::rab-3::unc-10 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Synaptic GFP marker in D-type motor neurons. |
| OH12500 | otEx5664. | C. elegans | otEx5664 [oig-1(fosmid)::GFP + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Fosmid-based oig-1 transcritpional reporter. |
| OH12531 | otIs527. | C. elegans | otIs527 [nlr-1p::GFP::unc-54 3'UTR + pha-1(+)]. Reporter contains 150bp upstream of the nlr-1 start codon. Derived from injection of pMG144; line 4-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH12541 | otIs532. | C. elegans | otIs532 [cho-1(fosmid)::SL2::NLS::YFP::H2B]. YFP expression in cholinergic neurons. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH12543 | otIs534. | C. elegans | otIs534 [cho-1(fosmid)::SL2::NLS::YFP::H2B]. YFP expression in cholinergic neurons. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH12644 | otEx5765. | C. elegans | otEx5765 [lin-14(fosmid)::GFP + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. mCherry might be difficult to see at lower magnification. Fosmid-based lin-14 transcritpional reporter; see Li and Greenwald, Current Biology 2010, Oct 26;20(20):1875-9. |
| OH127 | him-5(e1490) V; otIs14. | C. elegans | otIs14 [zig-3::GFP + rol-6(su1006)]. Rollers. |
| OH12734 | unc-86(n846) III; otEx5851. | C. elegans | otEx5851 [unc-86(fosmid)::NLS::mChopti + lin-44::YFP]. Pick YFP+ to maintain. |
| OH12737 | uIs115; otIs14; otEx5853. | C. elegans | uIs115 [mec-17::RFP]. otIs14 [zig-3::GFP + rol-6(su1006)]. Rollers. otEx5853 [hsp::unc-86 + ttx-3::mCherry]. Temperature-sensitive. Maintain at 15C. Pick ttx-3::mCherry-positive animals to maintain array. Expresses unc-86 ubiquitously upon heat shock. |
| OH12738 | otIs545; otIs593. | C. elegans | otIs545 [gcy-5p::RFP + LacO repeats]. otIs593 [let-858p::GFP::LacI + ttx-3p::mCherry]. Maintain at 20C; otIs545 is very unstable at lower temperatures. RFP expression in ASER neuron. LACI::GFP aggregates on LacO repeats to form two dots in every nucleus. otIs545 is unstable, presumably due to the highly repetitive nature of the LacO array. Stock should be periodically examined for RFP expression and GFP localization to retain expression of the array. Reference: Patel T & Hobert O. eLife 2017. |
| OH1277 | otEx669. | C. elegans | otEx669 [exc-4p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Transcriptional GFP fusion expresses in the excretory cell, excretory pore cell, excretory duct cell, rectal gland cell, hypodermis, seam cells, innerlabial sheath cells, and phasmid sheath cells. |
| OH1279 | otEx671. | C. elegans | otEx671[exc-4p::exc-4::GFP + rol-6(su1006)]. Maintain by picking Rollers. Translational GFP fusion localizes to the lumenal membrane of the excretory cell, to the apical junction of the seam cells, and to the tips of the inner labial and phasmid sheath cells. |
| OH128 | otIs39 II; him-5(e1490) V. | C. elegans | otIs39 [unc-47(delta)::GFP + lin-15(+)]. Expressed in RMEL/R, AVL, RIS, DVB, PVT and unidentified amphid sensory neuron pair. |
| OH12849 | pha-1(e2123) III; otIs356 V; otEx5886. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx5886 [unc-57(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH12857 | pha-1(e2123) III; otIs356 V; otEx5894. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx5894 [egl-3(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH12860 | pha-1(e2123) III; otIs356 V; otEx5897. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. Pan-neuronal nuclear RFP expression. otEx5897 [egl-21(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH12863 | pha-1(e2123) III; otIs356 V; otEx5900. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx5900 [tbb-4(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH12867 | pha-1(e2123) III; otEx5904. | C. elegans | otEx5904 [rgef-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH12884 | pha-1(e2123) III; otEx5921. | C. elegans | otEx5921 [syd-2(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH12887 | otIs476 II; otIs498. | C. elegans | otIs476 [glr-4::TagRFP] II. otIs498 [rab-3(fosmid)::SL2::NLS::YFP::H2B + hygR]. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH12888 | pha-1(e2123) III; otIs356 V; otEx5924. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx5924 [snt-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx5924. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH12889 | pha-1(e2123) III; otIs356 V; otEx5925. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx5925 [unc-18(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH12930 | pha-1(e2123) III; evIs82b IV; otEx5966. | C. elegans | evIs82b [unc-129::GFP + dpy-20(+)] IV. otEx5966 [bnc-1p::mChOpti + pha-1(+)]. Maintain at 25C to select for presence of otEx5966 array. VA/VB motor neuron class-specific red fluorescent reporter. Reference: Kerk SY, et al. Neuron 2017 (in press). |
| OH13027 | otIs569. | C. elegans | otIs569 [snf-11(fosmid)::SL2::H2B::mChopti + pha-1(+)]. Reporter tag inserted into fosmid WRM064dH02. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH13083 | him-5(e1490) V; otIs576. | C. elegans | otIs576 [unc-17(fosmid)::GFP + lin-44::YFP]. Him. GFP expression in all cholinergic neurons. Reference: Pereira L, et al. Elife. 2015 Dec 25;4. |
| OH13098 | che-1(ot75) I. | C. elegans | che-1(ot75) is a null allele caused by an early STOP codon in exon 1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37. |
| OH13099 | otIs583. | C. elegans | otIs583 [gcy-5p*::GFP + ttx-3p::mCherry]. Robust GFP expression in both ASE neurons. mCherry expression in AIY meurons. *This strain contains a short gcy-5 promoter with the CHE-1 binding ASE motif multimerized. GFP expression is strong enough to visualize morphology of both ASE neurons simultaneously. Reference: Patel T & Hobert O. eLife 2017. Etchberger JF, et al. Development. 2009 Jan;136(1):147-60. |
| OH13102 | otIs586 X. | C. elegans | otIs586 [gcy-6(fosmid)::SL2::NLS::GFP + ttx-3p::mCherry] X. Reporter tag inserted into gcy-6(+) fosmid; expressed only in the ASEL neuron during normal growth conditions. Reference: Patel T & Hobert O. eLife 2017. |
| OH13104 | him-5(e1490) V; otIs565. | C. elegans | otIs565 [unc-47(fosmid)::SL2::H2B::mChopti + pha-1(+)]. Reporter tag inserted into fosmid WRM0626bG04. Him. Line 5-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH13105 | him-5(e1490) otIs564 V. | C. elegans | otIs564 [unc-47(fosmid)::SL2::H2B::mChopti + pha-1(+)] V. Reporter tag inserted into fosmid WRM0626bG04. Him. Line 2-2. Inserted near unc-42. Brighter mCherry expression than in OH13104. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH13106 | him-5(e1490) V; otIs568. | C. elegans | otIs568 [unc-46(fosmid)::SL2::H2B::mChopti + pha-1(+)]. Reporter tag inserted into fosmid WRM0611dE07. Him. Line 19-2. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH13107 | otIs570 I; him-5(e1490) V. | C. elegans | otIs570 [snf-11(fosmid)::SL2::H2B::mChopti + pha-1(+)] I. Reporter tag inserted into fosmid WRM064dH02. Him. Line 14-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH13290 | pha-1(e2123) III; otEx6176. | C. elegans | otEx6176 [ric-19(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH13333 | him-5(e1490) V; otIs514. | C. elegans | otIs514 [unc-25p::unc-25(partial)::GFP::unc-54 3'UTR + pha-1(+)]. Him. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 6. Derived from injection of pMG89; line 14-12. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH134 | pha-1(e2123) III; otEx57. | C. elegans | otEx57 [ttx-3::GFP + pha-1(+)]. Full-length rescuing ttx-3 genomic construct fused to GFP using PCR. Maintain at 25C to select for transgenic animals. |
| OH13405 | inx-6(ot804 [inx-6::SL2::NLS::yfp::H2B]) IV. | C. elegans | inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH13421 | pha-1(e2123) III; otIs356 V; otEx6254. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6254 [snb-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6254. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH13422 | pha-1(e2123) III; otIs356 V; otEx6255. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6255 [unc-31(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6254. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH13423 | pha-1(e2123) III; otIs356 V; otEx6256. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6256 [unc-10a(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6256. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH13425 | pha-1(e2123) III; otIs356 V; otEx6258. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6258 [unc-108(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6258. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Neuron. 2015 Aug 19;87(4):733-50. |
| OH13426 | pha-1(e2123) III; otIs356 V; otEx6259. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6259 [unc-10B(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6259. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH13470 | him-5(e1490) V; otIs354. | C. elegans | otIs354 [cho-1(fosmid)::SL2::YFP::H2B]. Him. |
| OH13476 | tab-1(ot796) II; otIs549 X. | C. elegans | otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. Derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH13513 | otIs597. | C. elegans | otIs597 [ser-7p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M4 pharyngeal neuron. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH13517 | otIs601. | C. elegans | otIs601[ceh-19p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for MC pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH13518 | otIs602. | C. elegans | otIs602 [mnm-2p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M3 pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH13525 | inx-6(ot805 [inx-6::gfp]) IV. | C. elegans | inx-6(ot805) was generated by the insertion of GFP into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH13526 | him-5(e1490) V; otIs549 X. | C. elegans | otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. Him. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. Derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH1353 | exc-4(rh133) I; bgIs312. | C. elegans | bgIs312 [pes-6::GFP]. GFP expression in excretory cell only. |
| OH1358 | kyIs123. | C. elegans | kyIs123 [trp-1::GFP]. |
| OH1360 | bgIs312; otEx718. | C. elegans | bgIs312 [pes-6::GFP]. GFP expression in excretory cell only. otEx718 [exc-4p::exc-4::DsRed2 + rol-6(su1006)]. Maintain by picking Rollers. Roller phenotype most penetrant at 20C. |
| OH13605 | otIs619 X. | C. elegans | otIs619 [unc-11(prom8)::2xNLS::TagRFP] X. Pan-neuronal RFP expression. Reference: Stefanakis N, et al. Neuron. 2015 Aug 19;87(4):733-50. |
| OH13606 | otIs620. | C. elegans | otIs620 [unc-11(prom8)::2xNLS::GFP]. Pan-neuronal nuclear GFP expression. Reference: Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545. |
| OH13645 | pha-1(e2123) III; him-5(e1490) V; otIs518. | C. elegans | otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. Him. Reference: Serrano-Saiz E, et al. Cell. 2013 Oct 24;155(3):659-73. |
| OH13646 | pha-1(e2123) III; him-5(e1490) V; otIs544. | C. elegans | otIs544 [cho-1(fosmid)::SL2::mCherry::H2B + pha-1(+)]. Him. Reference: Serrano-Saiz E, et al. Cell. 2013 Oct 24;155(3):659-73. |
| OH13787 | otEx6368. | C. elegans | otEx6368 [GFP::oig-8(fosmid) + ttx-3p::mCherry]. Pick ttx-3p::mCherry to maintain. Fosmid-based oig-8 translational reporter (GFP inserted in N-terminus of OIG-8 after peptide sequence). |
| OH13795 | pha-1(e2123) III; otEx6374. | C. elegans | otEx6374 [acc-1(fosmid)::GFP + pha-1(+)]. Maintain at 25C. GFP expression in a few neurons. Reference: Pereira L, et al. Elife. 2015 Dec 25;4. |
| OH13796 | pha-1(e2123) III; otEx6375. | C. elegans | otEx6375 [acc-2(fosmid)::GFP + pha-1(+)]. Maintain at 25C. GFP expression in a few neurons. Reference: Pereira L, et al. Elife. 2015 Dec 25;4. |
| OH13797 | pha-1(e2123) III; otEx6376. | C. elegans | otEx6376 [acc-4(fosmid)::GFP + pha-1(+)]. Maintain at 25C. Broad neuronal GFP expression. Reference: Pereira L, et al. Elife. 2015 Dec 25;4. |
| OH13813 | oig-8(ot818) II. | C. elegans | |
| OH13830 | sax-7(ot820) IV; oyIs14 V. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)] V. ot820 is an 8bp deletion 15bp from the start of the sax-7S start codon, resulting in a frameshift and sax-7S isoform-specific null allele. |
| OH13833 | pha-1(ee2123) III; otEx6397. | C. elegans | otEx6397 [srh-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13835 | pha-1(e2123) III; otEx6399. | C. elegans | otEx6399 [srh-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13837 | pha-1(e2123) III; otEx6401. | C. elegans | otEx6401 [srh-7p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13839 | pha-1(e2123) III; otEx6403. | C. elegans | otEx6403 [sri-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13841 | pha-1(e2123) III; otEx6405. | C. elegans | otEx6405 [sri-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13843 | pha-1(e2123) III; otEx6407. | C. elegans | otEx6407 [sri-9p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13845 | pha-1(e2123) III; otEx6409. | C. elegans | otEx6409 [sri-12p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13848 | pha-1(e2123) III; otEx6411. | C. elegans | otEx6412 [sri-18p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13849 | pha-1(e2123) III; otEx6413. | C. elegans | otEx6413 [sri-21p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13851 | pha-1(e2123) III; him-5(e1490) V; otEx6415. | C. elegans | otEx6415 [sri-36p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13853 | pha-1(e2123) III; him-5(e1490) V; otEx6417. | C. elegans | otEx6417 [sri-39p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13855 | pha-1(e2123) III; him-5(e1490) V; otEx6419. | C. elegans | otEx6419 [sri-62p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13857 | pha-1(e2123) III; otEx6421. | C. elegans | otEx6421 [srd-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13859 | pha-1(e2123 III; otEx6423. | C. elegans | otEx6423 [srd-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13861 | pha-1(e2123) III; otEx6425. | C. elegans | otEx6425 [srd-10p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13863 | pha-1(e2123) III; otEx6427. | C. elegans | otEx6427 [srd-11p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13865 | pha-1(e2123) III; him-5(e1490) V; otEx6429. | C. elegans | otEx6429 [srx-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13867 | pha-1(e2123) III; him-5(e1490) V; otEx6431. | C. elegans | otEx6431 [srx-3p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13869 | pha-1(e2123) III; him-5(e1490) V; otEx6433. | C. elegans | otEx6433 [srx-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13871 | pha-1(e2123) III; him-5(e1490) V; otEx6435. | C. elegans | otEx6435 [srx-10p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13873 | pha-1(e2123) III; him-5(e1490) V; otEx6437]. | C. elegans | otEx6437 [srx-17p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13875 | pha-1(e2123) III; him-5(e1490) V; otEx6439. | C. elegans | otEx6439 [srx-22p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13877 | pha-1(e2123) III; him-5(e1490) V; otEx6441. | C. elegans | otEx6441 [sru-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13879 | pha-1(e2123) III; him-5(e1490) V; otEx6443. | C. elegans | otEx6443 [sru-2p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13881 | pha-1(e2123) III; him-5(e1490) V; otEx6445. | C. elegans | otEx6445 [sru-8p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13884 | pha-1(e2123) III; him-5(e1490) V; otEx6447. | C. elegans | otEx6448 [sru-12p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13885 | pha-1(e2123) III; him-5(e1490) V; otEx6449. | C. elegans | otEx6449 [sru-30p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13887 | pha-1(e2123) III; him-5(e1490) V; otEx6451. | C. elegans | otEx6451 [sru-48p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH13908 | daf-16(ot821[daf-16::mKate2::3xFLAG]) I. | C. elegans | CRISPR allele of daf-16, tagged at the C-terminus with mKate2::3xFLAG. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology. |
| OH13988 | ieSi57 II; unc-3(ot837[unc-3::mNeonGreen::AID*]) X. | C. elegans | ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. The endogenous unc-3 locus is tagged with mNeonGreen and AID* degron. mNeonGreen expression is seen in the cholinergic motor neurons, command interneurons, and ASI. Reference: Patel T, Hobert O. Elife. 2017 Apr 19;6:e24100. doi: 10.7554/eLife.24100. PMID: 28422646. |
| OH14014 | inx-6(ot804 ot840) IV. | C. elegans | inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. ot840 was created by targeted disruption of the conserved TAATTA in the tagged inx-6(ot804). Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH14018 | him-5(e1490) V; otIs520. | C. elegans | otIs520 [eat-4(prom11)::GFP + ttx-3::mCherry]. Reference: Serrano-Saiz E, et al. Curr Biol. 2017 Jan 23;27(2):199-209. |
| OH14021 | hpl-1(ot841 [hpl-1::mKate2]) X. | C. elegans | ot841[hpl-1::mKate2]. Endogenous hpl-1 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted into the protein after amino acid 12. This tag was based on a published hpl-1 protein fusion (Couteau et al., 2002). Reference: Patel T & Hobert O. eLife 2017. |
| OH14044 | evIs82b IV; bnc-1(ot763) V. | C. elegans | evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press). |
| OH14045 | evIs82b IV; bnc-1(ot721) V. | C. elegans | evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press). |
| OH14049 | otIs629; ntIs1 V. | C. elegans | otIs629 [gcy-7p::TagRFP + ttx-3p::GFP]. ntIs1 [gcy-5p::GFP + lin-15(+)] V. RFP expression in ASEL neurons. GFP expression appears in ASER (in adults) and AIY neurons. Reference: Patel T & Hobert O. eLife 2017. |
| OH14070 | bnc-1(ot845[bnc-1::mNeonGreen::AID*]) V. | C. elegans | bnc-1 was modified by CRISPR/Cas9 to create both a GFP-tagged reporter and conditional allele using the auxin-inducible degron (AID*). Reference: Kerk SY, et al. Neuron. 2017 Jan 4;93(1):80-98. doi: 10.1016/j.neuron.2016.11.036. PMID: 28056346 |
| OH14125 | daf-16(ot853[daf-16::linker::mNeonGreen::3xFlag::AID*]) I. | C. elegans | mNeonGreen tag inserted into endogenous daf-16 locus; AID* at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580 |
| OH14130 | che-1(ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. | C. elegans | ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 tagged with GFP. Nuclear GFP localization in ASE neurons. Reference: Leyva-Díaz E, et al. Genetics. 2017 Oct;207(2):529-545. |
| OH1421 | hst-6(ok273) X. | C. elegans | Phenotypically WT. In hst-6(ok273) , 1064 nt are deleted following position 39378 in Y34B4A (ACC# AC024755) and replaced by four nucleotides CTTT. |
| OH1422 | otIs138 X. | C. elegans | otIs138 [ser-2(prom3)::GFP + rol-6(su1006)] X. Integrated array derived from otEx449. |
| OH14220 | hpl-2(ot860 [hpl-2::mKate2]) III. | C. elegans | ot860[hpl-2::mKate2]. Grows normally at 15-20C. Endogenous hpl-2 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted into the protein after amino acid 96; tags both isoforms of hpl-2. This tag was based on a published hpl-2 protein fusion (Couteau et al., 2002). Reference: Patel T & Hobert O. eLife 2017. |
| OH14221 | met-2(ot861[met-2::mKate2]) III. | C. elegans | ot861[met-2::mKate2] III. Maintain at 15-20C. Endogenous met-2 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted at the C-terminus using a small protein bridge present in the plasmids (Dickinson et al., 2015). Reference: Patel T & Hobert O. eLife 2017. |
| OH14222 | pha-1(e2123) III; him-5(e1490) V; otEx6599. | C. elegans | otEx6599 [srj-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14224 | pha-1(e2123) III; him-5(e1490) V; otEx6600. | C. elegans | otEx6601 [srj-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14225 | pha-1(e2123) III; him-5(e1490) V; otEx6602. | C. elegans | otEx6602 [srj-20p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14226 | pha-1(e2123) III; him-5(e1490) V; otEx6603. | C. elegans | otEx6603 [srj-22p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14227 | pha-1(e2123) III; him-5(e1490) V; otEx6604. | C. elegans | otEx6604 [srj-25p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14228 | pha-1(e2123) III; him-5(e1490) V; otEx6605. | C. elegans | otEx6605 [srj-27p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14230 | pha-1(e2123) III; him-5(e1490) V; otEx6607. | C. elegans | otEx6607 [srj-38p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14232 | pha-1(e2123) III; him-5(e1490) V; otEx6609. | C. elegans | otEx6609 [srsx-12p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14234 | pha-1(e2123) III; him-5(e1490) V; otEx6611. | C. elegans | otEx6611 [srsx-28p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14235 | pha-1(e2123) III; him-5(e1490) V; otEx6612. | C. elegans | otEx6612 [srsx-38p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14238 | pha-1(e2123) III; him-5(e1490) V; otEx6614. | C. elegans | otEx6614 [srg-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14240 | pha-1(e2123) III; him-5(e1490) V; otEx6616. | C. elegans | otEx6616 [srg-14p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14241 | pha-1(e2123) III; him-5(e1490) V; otEx6617. | C. elegans | otEx6617 [srg-29p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14243 | pha-1(e2123) III; him-5(e1490) V; otEx6619. | C. elegans | otEx6619 [srg-31p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14244 | pha-1(e2123) III; him-5(e1490) V; otEx6620. | C. elegans | otEx6620 [srg-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14246 | pha-1(e2123) III; him-5(e1490) V; otEx6622. | C. elegans | otEx6622 [srg-39p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14248 | pha-1(e2123) III; him-5(e1490) V; otEx6624. | C. elegans | otEx6624 [srg-58p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14250 | pha-1(e2123) III; him-5(e1490) V; otEx6626. | C. elegans | otEx6626 [srg-66p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14265 | pha-1(e2123) III; him-5(e1490) V; otEx6628. | C. elegans | otEx6628 [srz-54p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14271 | pha-1(e2123) III; him-5(e1490) V; otEx6634. | C. elegans | otEx6634 [str-31p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14273 | pha-1(e2123) III; him-5(e1490) V; otEx6636. | C. elegans | otEx6636 [str-52p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14275 | pha-1(e2123) III; him-5(e1490) V; otEx6638. | C. elegans | otEx6638 [str-94p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14277 | pha-1(e2123) III; him-5(e1490) V; otEx6640. | C. elegans | otEx6640 [str-121p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14279 | pha-1(e2123) III; him-5(e1490) V; otEx6642. | C. elegans | otEx6642 [str-178p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14281 | pha-1(e2123) III; him-5(e1490) V; otEx6644. | C. elegans | otEx6644 [str-231p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14283 | pha-1(e2123) III; him-5(e1490) V; otEx6646. | C. elegans | otEx6646 [str-233p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14285 | pha-1(e2123) III; him-5(e1490) V; otEx6648. | C. elegans | otEx6648 [str-247p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14287 | pha-1(e2123) III; him-5(e1490) V; otEx6650. | C. elegans | otEx6650 [str-261p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14289 | pha-1(e2123) III; him-5(e1490) V; otEx6652]. | C. elegans | otEx6652 [srh-62p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14293 | pha-1(e2123) III; him-5(e1490) V; otEx6656. | C. elegans | otEx6656 [srh-100p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14295 | pha-1(e2123) III; him-5(e1490) V; otEx6658. | C. elegans | otEx6658 [srh-142p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14297 | pha-1(e2123) III; him-5(e1490) V; otEx6660. | C. elegans | otEx6660 [srh-193p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14299 | pha-1(e2123) III; him-5(e1490) V; otEx6662. | C. elegans | otEx6662 [srh-199p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14301 | pha-1(e2123) III; him-5(e1490) V; otEx6664. | C. elegans | otEx6664 [srh-201p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14303 | pha-1(e2123) III; him-5(e1490) V; otEx6666. | C. elegans | otEx6666 [srh-277p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14305 | pha-1(e2123) III; him-5(e1490) V; otEx6668. | C. elegans | otEx6668 [srh-127p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14313 | pha-1(e2123) III; him-5(e1490) V; otEx6674. | C. elegans | otEx6674 [srh-210p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14315 | pha-1(e2123) III; him-5(e1490) V; otEx6676. | C. elegans | otEx6676 [srh-211p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14317 | pha-1(e2123) III; him-5(e1490) V; otEx6678. | C. elegans | otEx6678 [srh-218p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14319 | pha-1(e2123) III; him-5(e1490) V; otEx6680. | C. elegans | otEx6680 [srh-240p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14321 | pha-1(e2123) III; him-5(e1490) V; otEx6682. | C. elegans | otEx6682 [srh-241p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14323 | pha-1(e2123) III; him-5(e1490) V; otEx6684. | C. elegans | otEx6684 [srh-269p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14335 | otIs637. | C. elegans | otIs637 [bnc-1p::rab-3::GFP + myo-2p::mCherry]. Reporter for presynapse of VA/VB class motor neurons innervating muscle and DD motor neurons in ventral nerve cord. Reference: Kerk SY, et al. Neuron 2017 (in press). |
| OH14337 | pha-1(e2123) III; him-5(e1490) V; otEx6694. | C. elegans | otEx6694 [srh-270p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14339 | pha-1(e2123) III; him-5(e1490) V; otEx6696. | C. elegans | otEx6696 [srj-21p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14341 | pha-1(e2123) III; him-5(e1490) V; otEx6698. | C. elegans | otEx6698 [srsx-27p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14343 | pha-1(e2123) III; him-5(e1490) V; otEx6700. | C. elegans | otEx6700 [srz-102p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14357 | mab-9(ot863[mab-9::TagRFP::AID*]) II. | C. elegans | mab-9(ot863[mab-9::TagRFP::AID*]) II. mab-9 was modified by CRISPR/Cas9 to create a conditional allele using the auxin-inducible degron (AID*). RFP is not visible in this strain. Reference: Kerk SY, et al. Neuron. 2017 Jan 4;93(1):80-98. doi: 10.1016/j.neuron.2016.11.036. PMID: 28056346 |
| OH14360 | pha-1(e2123) III; him-5(e1490) V; otEx6702. | C. elegans | otEx6702 [srg-25p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14362 | pha-1(e2123) III; him-5(e1490) V; otEx6704. | C. elegans | otEx6704 [srw-145p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14364 | pha-1(e2123) III; him-5(e1490) V; otEx6706. | C. elegans | otEx6706 [srb-17p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14367 | pha-1(e2123) III; him-5(e1490) V; otEx6708. | C. elegans | otEx6709 [sri-26p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14368 | pha-1(e2123) III; him-5(e1490) V; otEx6710. | C. elegans | otEx6710 [srd-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14369 | pha-1(e2123) III; him-5(e1490) V; otEx6726. | C. elegans | otEx6726 [str-253p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14370 | pha-1(e2123) III; him-5(e1490) V; otEx6711. | C. elegans | otEx6711 [srsx-37p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14372 | pha-1(e2123) III; him-5(e1490) V; otEx6713. | C. elegans | otEx6713 [str-97p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14374 | pha-1(e2123) III; him-5(e1490) V; otEx6715. | C. elegans | otEx6715 [str-102p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14376 | pha-1(e2123) III; him-5(e1490) V; otEx6717. | C. elegans | otEx6717 [str-85p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14378 | pha-1(e2123) III; him-5(e1490) V; otEx6719. | C. elegans | otEx6719 [str-84p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14380 | pha-1(e2123) III; him-5(e1490) V; otEx6721. | C. elegans | otEx6721 [str-114p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14384 | pha-1(e2123) III; him-5(e1490) V; otEx6725. | C. elegans | otEx6725 [str-262p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14386 | pha-1(e2123) III; him-5(e1490) V; otEx6728. | C. elegans | otEx6728 [str-250p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14388 | pha-1(e2123) III; him-5(e1490) V; otEx6730. | C. elegans | otEx6730 [str-123p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14390 | pha-1(e2123) III; him-5(e1490) V; otEx6732. | C. elegans | otEx6732 [str-125p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14392 | pha-1(e2123) III; him-5(e1490) V; otEx6734. | C. elegans | otEx6734 [str-129p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14394 | pha-1(e2123) III; him-5(e1490) V; otEx6736. | C. elegans | otEx6736 [str-130p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14396 | pha-1(e2123) III; him-5(e1490) V; otEx6738. | C. elegans | otEx6738 [str-143p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14398 | pha-1(e2123) III; him-5(e1490) V; otEx6740. | C. elegans | otEx6740 [str-148p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14400 | pha-1(e2123) III; him-5(e1490) V; otEx6742. | C. elegans | otEx6742 [str-236p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14402 | pha-1(e2123) III; him-5(e1490) V; otEx6744. | C. elegans | otEx6744 [str-249p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14404 | pha-1(e2123) III; otEx6746. | C. elegans | otEx6746 [gta-1(fosmid)::SL2::mChopti::H2B + pha-1(+)]. Maintain at 25C to maintain array. Reporter tag inserted into fosmid WRM0627bF07. Line 6-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14405 | tab-1(gk753) II; otIs549 X; otEx6747. | C. elegans | otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6747 [tab-1(fosmid)::SL2::YFP::H2B + rol-1(su1006)]. Pick Rollers to maintain otEx6747. Him. otIs549 reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. otIs549 was derived from injection of pMG154; line 2-1. otEx6747 reporter tag inserted into fosmid WRM0617bA03; line 5-4. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14408 | elt-1(ok1002) IV; otEx6750. | C. elegans | otEx6750 [unc-47p::mChopti + elt-1(+)(fosmid)]. Array rescues lethal elt-1 mutation; contains fosmid WRM0619bE05. Line 1-2. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14420 | pals-22(ot811) III; otIs381 V; otEx6761. | C. elegans | otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6761 [pals-22(+) + ttx-3p::mChOPTI]; derived from PCR fragment containing the genomic pals-22 locus. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6761 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545. |
| OH14429 | pals-22(ot811) III; otIs381 V; otEx6769. | C. elegans | otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6769 [pals-22(fosmid) + myo-2p::mChOPTI]; derived from NotI digestion of WRM0616DC09. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6769 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545. |
| OH14431 | otIs638. | C. elegans | otIs638 [unc-6(fosmid)::NLS::YFP::H2B + ttx-3p::mCherry + pha-1(+)]. Integrated fosmid reporter for unc-6. Reference: Weinberg P, et al. Curr Biol. 2018 Feb 19;28(4):623-629.e3. |
| OH14454 | otIs587; otIs304. | C. elegans | otIs587 [gcy-5(fosmid)::SL2::NLS::GFP + ttx-3p::mCherry]. otIs304 [hsp16-2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. GFP reporter tag inserted into gcy-5(+) fosmid. gcy-5 is normally expressed in ASER and RIGL/R neurons, but upon heatshock, expression of CHE-1 induces ectopic gcy-5 expression (the extent of ectopic expression is dependent on the timing of the heatshock). Reference: Patel T & Hobert O. eLife 2017. |
| OH14486 | gcy-5(ot835[gcy-5::SL2::mNeonGreen]) II; otTi6 X. | C. elegans | ot835 [gcy-5::SL2::mNeonGreen] III. otTi6 [hsp16-41p::che-1::2xFLAG] X. otTi6 is a miniMOS insertion of heatshock inducible che-1. Under normal growth conditions, very dim expression of gcy-5 is observed in the ASER and RIGL/R neurons. Upon heatshock, induction of CHE-1 leads to ectopic expression of gcy-5 (ectopic expression varies depending upon age at heatshock and genetic background). |
| OH14529 | otTi19. | C. elegans | otTi19 [npr-9p::inx-6::GFP]. Mos-mediated insertion. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH14542 | pha-1(e2123) III; otEx6798. | C. elegans | otEx6798 [lgc-36(fosmid)::SL2::NLS::YFP::H2B + ttx-3::mChopti + pha-1(+)]. Maintain at 25C to select for array. Reporter tag inserted into fosmid WRM0636cA08. Line 4-2. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14543 | pha-1(e2123) III; otEx6799. | C. elegans | otEx6799 [gab-1(fosmid)::SL2::NLS::YFP::H2B + ttx-3::mChopti + pha-1(+)]. Maintain at 25C to select for array. Reporter tag inserted into fosmid WRM0640aC06. Line 2-3. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14544 | pha-1(e2123) III; otEx6800. | C. elegans | otEx6800 [lgc-37(fosmid)::SL2::NLS::YFP::H2B + ttx-3::mChopti + pha-1(+)]. Maintain at 25C to select for array. Reporter tag inserted into fosmid WRM0640aC06. Line 3-2. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14545 | pha-1(e2123) III; otEx6801. | C. elegans | otEx6801 [lgc-38p::GFP + pha-1(+)]. Maintain at 25C to select for array. PCR used to fuse 3.9 kb lgc-38 promoter with GFP reporter. Line 10. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14546 | pha-1(e2123) III; otEx6802. | C. elegans | otEx6802 [lgc-37p::GFP + pha-1(+)]. Maintain at 25C to select for maintain array. Reporter contains 5 kb of lgc-37 promoter fused with GFP. Derived from injection of pMG249; line 5. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14547 | pha-1(e2123) III; otEx6803. | C. elegans | otEx6803 [gab-1p::GFP + pha-1(+)]. Maintain at 25C to select for array. Reporter contains 5 kb of gab-1 promoter fused with GFP. Derived from injection of pMG250; line 1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14548 | tab-1(gk753) II; otIs549 X; otEx6804. | C. elegans | otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6804 [tab-1(+) + ttx-3::GFP]. Maintain otEx6804 by picking ttx-3::GFP. otEx6804 carries a PCR fragment containing the tab-1 locus; rescues gk753. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14551 | unc-25(ot867[unc-25::SL2::1xNLS::GFP::H2B]) III. | C. elegans | unc-25(ot867[unc-25::SL2::1xNLS::GFP::H2B]) III. |
| OH14570 | otEx6820. | C. elegans | otEx6820 [ceh-36(prom3)::oig-8 + ttx-3p::mCherry]. Pick ttx-3p::mCherry to maintain. |
| OH14589 | daf-12(ot870[daf-12::GFP::3xFlag]) X. | C. elegans | Superficially wildtype. GFP tag inserted into endogenous daf-12 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted |
| OH14619 | elt-1(ok1002) IV; him-5(e1490) V; otIs549 X; otEx6751. | C. elegans | otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. otEx6751 [unc-47p::GFP + elt-1(+)(fosmid)]. Him. otEx6751 rescues lethal elt-1 mutation; contains fosmid WRM0619bE05. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14654 | daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; daf-2(e1370) III. | C. elegans | Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID* conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva U. et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586; PMCID: PMC8099054. |
| OH14660 | snf-3(ok293) II; him-5(e1490) V. | C. elegans | Him. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30. |
| OH14674 | otIs348 IV; him-5(e1490) V. | C. elegans | otIs348 [unc-47p::mChopti::unc-54 3'UTR + pha-1(+)] IV. Him. otIs348 contains 300 bp upstream of the unc-47 start codon; derived from injection of pMG92; line 2-16. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14675 | otIs575 I; him-5(e1490) V. | C. elegans | otIs575 [unc-46p::GFP + pha-1(+)] I. Him. otIs575 contains 234 bp upstream of the unc-46 start codon; derived from injection of pMG117; line 17-2. Integrated in LG I near ceh-8 and ceh-12. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14711 | nhr-67(ot795) IV; him-5(e1490) V; otEx5999. | C. elegans | otEx5999 [nhr-67(fosmid) + unc-47p::mChopti]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx5999 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14712 | nhr-67(ot795) IV; him-5(e1490) V; otEx6001. | C. elegans | otEx6001 [nhr-67(fosmid) + unc-47p::GFP]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx6001 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5. |
| OH14750 | pha-1(e2123) III; him-5(e1490) V; otEx6853. | C. elegans | otEx6853 [srv-3p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14751 | pha-1(e2123) III; him-5(e1490) V; otEx6854. | C. elegans | otEx6854 [srv-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14752 | pha-1(e2123) III; him-5(e1490) V; otEx6855. | C. elegans | otEx6855 [srv-8p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14753 | pha-1(e2123) III; him-5(e1490) V; otEx6856. | C. elegans | otEx6856 [srv-12p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14755 | pha-1(e2123) III; him-5(e1490) V; otEx6856. | C. elegans | otEx6856 [srv-17p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14756 | pha-1(e2123) III; him-5(e1490) V; otEx6859. | C. elegans | otEx6859 [srv-27p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14757 | pha-1(e2123) III; him-5(e1490) V; otEx6860. | C. elegans | otEx6860 [srv-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14758 | pha-1(e2123) III; him-5(e1490) V; otEx6861. | C. elegans | otEx6861 [srv-34p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH1476 | lin-23(ot1) II; oxIs12 X. | C. elegans | oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic AVL outgrowth. |
| OH14760 | pha-1(e2123) III; him-5(e1490) V; otEx6863. | C. elegans | otEx6863 [srm-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14761 | pha-1(e2123) III; him-5(e1490) V; otEx6864. | C. elegans | otEx6864 [srm-2p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14762 | pha-1(e2123) III; him-5(e1490) V; otEx6865. | C. elegans | otEx6865 [srm-3p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14763 | pha-1(e2123) III; him-5(e1490) V; otEx6866. | C. elegans | otEx6866 [srm-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14764 | pha-1(e2123) III; him-5(e1490) V; otEx6867. | C. elegans | otEx6867 [srm-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14765 | pha-1(e2123) III; him-5(e1490) V; otEx6868. | C. elegans | otEx6868 [srm-6p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14766 | pha-1(e2123) III; him-5(e1490) V; otEx6869. | C. elegans | otEx6869 [srr-2p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14767 | pha-1(e2123) III; him-5(e1490) V; otEx6870. | C. elegans | otEx6870 [srr-3p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14768 | pha-1(e2123) III; him-5(e1490) V; otEx6871. | C. elegans | otEx6871 [srr-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14769 | pha-1(e2123) III; him-5(e1490) V; otEx6872. | C. elegans | otEx6872 [srr-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14770 | pha-1(e2123) III; him-5(e1490) V; otEx6873. | C. elegans | otEx6873 [srr-7p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14771 | pha-1(e2123) III; him-5(e1490) V; otEx6874. | C. elegans | otEx6874 [srr-8p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14772 | pha-1(e2123) III; him-5(e1490) V; otEx6875. | C. elegans | otEx6875 [srr-9p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14773 | pha-1(e2123) III; him-5(e1490) V; otEx6876. | C. elegans | otEx6876 [srr-10p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14783 | kyIs140 I; oig-8(ot818) II; otTi20. | C. elegans | kyIs140: [str-2::GFP + lin-15(+)] I. otTi20 [oig-8p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing oig-8p::oig-8 transgene. |
| OH14785 | kyIs140 I; oig-8(ot818) II; otTi22. | C. elegans | kyIs140: [str-2::GFP + lin-15(+)] I. otTi22 [str-1p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing str-1p::oig-8 transgene. |
| OH14838 | pha-1(e2123) III; him-5(e1490) V; otEx6909. | C. elegans | otEx6909 [srz-56p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14840 | pha-1(e2123) III; him-5(e1490) V; otEx6911. | C. elegans | otEx6911 [srz-104p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14861 | lite-1(ce314) X; otIs644. | C. elegans | otIs644 [tdc-1::ChR2::YFP]. Reporter contains 4.4 kb of tdc-1 promoter fused to ChR2::YFP; can be used for optogenetic stimulation of tyraminergic and octopaminergic neurons. |
| OH14864 | kyIs140 I; oig-8(ot818) II; otTi24. | C. elegans | kyIs140: [str-2::GFP + lin-15(+)] I. otTi24 [ceh-36(prom3)::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing ceh-36(prom3)::oig-8 transgene. |
| OH1487 | hse-5(tm472) III. | C. elegans | Partially penetrant sluggish. tm472 removes 1249nt following 15974 in B0285 (Acc#34533) and inserts an adenosine at position 17228. Putative molecular null allele. |
| OH14884 | pha-1(e2123) III; him-5(e1490) V; otIs646. | C.elegans | otIs646 [srh-127p::GFP + pha-1(+)]. Robust GFP expression in ADL neurons. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979. |
| OH14888 | daf-16(ot853[daf-16::mNG::3xFlag::AID*]) I; ieSi57 II; daf-2(e1370) III. | C. elegans | ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva U et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH14891 | daf-12(ot874[daf-12::TagRFP::3xFlag::AID*]) X. | C. elegans | Superficially wildtype. CRISPR/Cas9-engineered AID* conditional daf-12 allele. Reference: Aghayeva et al., PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH14892 | daf-3(ot875[daf-3::GFP::3xFlag]) X. | C. elegans | Superficially wildtype. GFP tag inserted into endogenous daf-3 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted |
| OH14896 | daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID*]) X. | C. elegans | Superficially wildtype. CRISPR/Cas9-engineered AID* conditional daf-3 allele. Reference: Aghayeva et al., PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH14897 | daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; ieSi60 II; daf-2(e1370) III. | C. elegans | ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH149 | ceh-23(ms23) III. | C. elegans | No obvious phenotype; partial effects on AiY interneuron differentiation; genotyped by PCR that covers the deletion in the ceh-23(ms23) allele. |
| OH14926 | bnc-1(ot721) vsIs33 V. | C. elegans | vsIs33 [dop-3::RFP] V. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press). |
| OH14935 | otIs648. | C.elegans | otIs648 [hlh-3(fosmid)::GFP + ttx-3p::mCherry]. Transgene is expressed in HSN neurons. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979. |
| OH14945 | daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; ieSi61 II; daf-2(e1370) III. | C. elegans | ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH14946 | ieSi57 II; daf-7(e1372) III; daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID*]) X. | C. elegans | ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-3 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH14953 | pha-1(e2123) III; him-5(e1490) V; otEx6946. | C. elegans | otEx6946 [sri-50p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14954 | pha-1(e2123) III; him-5(e1490) V; otEx6947. | C. elegans | otEx6947 [srz-24p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14956 | pha-1(e2123) III; him-5(e1490) V; otEx6949. | C. elegans | otEx6949 [srz-66p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14958 | pha-1(e2123) III; him-5(e1490) V; otEx6951. | C. elegans | otEx6951 [srh-74p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14962 | pha-1(e2123) III; him-5(e1490) V; otEx6955. | C. elegans | otEx6955 [srz-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14964 | pha-1(e2123) III; him-5(e1490) V; otEx6957. | C. elegans | otEx6957 [sri-45p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14966 | pha-1(e2123) III; him-5(e1490) V; otEx6959. | C. elegans | otEx6959 [srz-61p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14969 | pha-1(e2123) III; him-5(e1490) V; otEx6961. | C. elegans | otEx6962 [srx-44p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14970 | pha-1(e2123) III; him-5(e1490) V; otEx6963. | C. elegans | otEx6963 [srj-23p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14971 | pha-1(e2123) III; him-5(e1490) V; otEx6964. | C. elegans | otEx6964 [srbc-7p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14973 | pha-1(e2123) III; him-5(e1490) V; otEx6966. | C. elegans | otEx6966 [srw-119p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14975 | pha-1(e2123) III; him-5(e1490) V; otEx6968. | C. elegans | otEx6968 [srj-13p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH14984 | daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID*]) X. | C. elegans | Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID* conditional daf-12 allele in daf-7(e1372) background (TIR1-less control). Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH14986 | ieSi57 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID*]) X. | C. elegans | ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-12 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH14989 | ieSi60 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID*]) X. | C. elegans | ieSi60 [myo-2p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. Pharyngeal muscle-specific depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH15034 | otIs653. | C. elegans | otIs653 [srg-8p::mCherry + cho-1p::mCherry + srg-8p::nlg-1::spGFP1-10 + cho-1p::nlg-1::spGFP11]. GRASP labeling of ASK to AIA synapses. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| OH15039 | pha-1(e2123) III; him-5(e1490) V; otIs625. | C. elegans | otIs625 [cat-1(fosmid)::SL2::mCherry::H2B + pha-1(+)]. Fosmid-based cat-1 reporter marks aminergic neurons. |
| OH15089 | otIs657. | C. elegans | otIs657 [klp-6p::mCherry + flp-3p::mCherry + klp-6p::NLG1::GFP1-10 + flp-3p::NLG1::GFP11]. IL2-IL1 GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH15097 | him-5(e1490) V; otIs541. | C. elegans | otIs541 [lim-6(intron4)::wCherry]. Red fluorescent reporter labels DVB neuron in males and hermaphrodites; also labels AVL, PVT, and 2 additional dim neurons in head. Hart MP & Hobert O. Nature. 2018; 553:165-170. PMID: 29323291. |
| OH15128 | pha-1(e2123) III; him-5(e1490) V; otEx7020. | C. elegans | otEx7020 [srg-64p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH15134 | pha-1(e2123) III; him-5(e1490) V; otEx7026. | C. elegans | otEx7026 [srn-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
| OH15144 | pha-1(e2123) III; otEx7036. | C. elegans | otEx7036 [pals-22p::GFP::unc-54 3'UTR + pha-1(+)]. Transcriptional reporter containing pals-22 promoter (coordinates -791 to -1 from start). Maintain at 25C to select for otEx7036. Reference: Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545. |
| OH15145 | pha-1(e2123) III; otEx7037. | C. elegans | otEx7037 [pals-22p::GFP::unc-54 3'UTR + pha-1(+)]. Translational reporter fusion containing pals-22 promoter (coordinates -791 to -1 from start). Maintain at 25C to select for otEx7037. Reference: Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545. |
| OH15178 | pals-22(ot810) III; otIs381 V. | C. elegans | otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. pals-22(ot810) mutant shows transgene-silencing phenotype. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545. |
| OH15179 | pals-22(ot811) III; otIs381 V | C. elegans | otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. pals-22(ot811) mutant shows transgene-silencing phenotype. Pan-neuronal nuclear GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545. |
| OH15205 | otEx7057. | C. elegans | Pick TagRFP+ animals to maintain. otEx7057 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Injected into N2. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15224 | pha-1(e2123) III; otEx7074. | C. elegans | otEx7074 [inx-20(fosmid WRM066cA02)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15225 | pha-1(e2123) III; otEx7075. | C. elegans | otEx7075 [inx-18a(fosmid WRM0629cH03)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15227 | unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID*]) III. | C. elegans | unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID* (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID* cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, et al. Curr Biol. 2018 Sep 10;28(17):2813-2823.e2. doi: 10.1016/j.cub.2018.06.045. Epub 2018 Aug 23. PMID: 30146154. |
| OH15242 | pha-1(e2123) III; otEx7090. | C. elegans | otEx7090 [inx-11(fosmid WRM0621cA09)::SL2::NLS::YFP::H2B + pha-1(+) + unc-122::GFP]. Maintain at 25C or pick GFP+ to retain array. |
| OH15244 | pha-1(e2123) III; otEx7092. | C. elegans | otEx7092 [inx-18b(fosmid WRM0629cH03)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15262 | otIs669 V. | C. elegans | otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15263 | otIs670 V. | C. elegans | otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15265 | otIs672. | C. elegans | otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. Bright panneuronal nuclear GCaMP6s expression. Reference: Yemini E, et al. https://www.biorxiv.org/content/10.1101/676312v1 |
| OH15271 | pha-1(e2123) III; otEx7102. | C. elegans | otEx7102 [inx-5(fosmid WRM0625cD05)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15272 | pha-1(e2123) III; otEx7103. | C. elegans | otEx7103 [inx-14(fosmid WRM0626aA10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15273 | pha-1(e2123) III; otEx7104. | C. elegans | otEx7104 [inx-13(fosmid WRM0621dC07)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15274 | pha-1(e2123) III; otEx7105. | C. elegans | otEx7105 [inx-16(fosmid WRM0619cH12)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15275 | pha-1(e2123) III; otEx7106. | C. elegans | otEx7106 [unc-7(fosmid WRM0627bH02)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15276 | pha-1(e2123) III; otEx7107. | C. elegans | otEx7107 [inx-1b(fosmid WRM0672aB09)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15278 | pha-1(e2123) III; otEx7109. | C. elegans | otEx7109 [unc-9(fosmid WRM0611aH10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15281 | pha-1(e2123) III; otEx7112. | C. elegans | otEx7112 [che-7(fosmid WRM0640dF02)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15282 | pha-1(e2123) III; otEx7113. | C. elegans | otEx7113 [inx-12(fosmid WRM0621dC07)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15285 | pha-1(e2123) III; otEx7116. | C. elegans | otEx7116 [inx-1a(fosmid WRM0672aB09f)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15288 | pha-1(e2123) III; otEx7119. | C. elegans | otEx7119 [inx-10a(fosmid WRM0628bH12):SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15291 | pha-1(e2123) III; otEx7121. | C. elegans | otEx7121 [inx-3(fosmid WRM0636dA10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH153 | cog-1(ot28) II. | C. elegans | No obvious phenotype. |
| OH15338 | ceh-32(ok343) V; otEx7146. | C. elegans | otEx7146 [ceh-32(+) fosmid WRM0637dA10 + myo-2p::RFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH15363 | otIs669 him-5(e1490) V | C. elegans | High incidence of males (Him). otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Not known where otIs669 maps relative to him-5. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15373 | otIs683. | C. elegans | otIs683 [hlh-4(fosmid)::YFP + ttx-3p::mCherry]. Transgene is expressed in ADL neurons. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979. |
| OH15422 | ceh-14(ot900) X. | C. elegans | Null allele generated by gRNAs targeted to the first and last exons of ceh-14, resulting in a 4061bp deletion from +35 to +4098 relative to the start of the ORF. |
| OH15430 | pha-1(e2123) III; otIs669 V. | C. elegans | Maintain at 15C. Temperature-sensitive. Slow growing. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15439 | ceh-34(ot903[ceh-34::mNG::3xFLAG::AID*]) V. | C. elegans | CRISPR/Cas9-engineered insertion of mNeonGreen::3xFLAG::AID* tags into endogenous ceh-34 locus. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH15487 | otIs695. | C. elegans | otIs695 [nlp-3p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH15493 | pha-1(e2123) III; otIs669 V; otEx7202. | C. elegans | otEx7202 [gbb-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15495 | otIs696. | C. elegans | otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. Insertion site unknown, but not on LG V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15499 | pha-1(e2123) III; otIs669 V; otEx7206. | C. elegans | otEx7206 [mgl-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15500 | otIs669 V; otIs672. | C. elegans | otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Bottlenecked 23x for isogenicity. Slow growing. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15511 | pha-1(e2123) III; otIs669 V; otEx7209. | C. elegans | otEx7209 [gar-2(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15518 | pha-1(e2123) III; otIs669 V; otEx7215. | C. elegans | otEx7215 [mgl-3(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15519 | pha-1(e2123) III; otIs669 V; otEx7216. | C. elegans | otEx7216 [gar-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15528 | him-5(e1490) V; otIs696. | C. elegans | High incidence of males (Him). otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15530 | pha-1(e2123) III; otEx7225. | C. elegans | otEx7225 [eat-5(fosmid WRM0621dG04)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15532 | pha-1(e2123) III; otEx7227. | C. elegans | otEx7227 [inx-9(fosmid WRM0632dA04)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15538 | him-5(e1490) V; otEx7231. | C. elegans | otEx7231 [srg-8p::rab-3::GFP + srg-8p::mCherry]. Pick animals with mCherry expression to maintain. Presynaptic RAB-3::GFP reporter for ASK neurons with cytoplasmic ASKp::mCherry in the background. Reference: Majeed M, et al. Elife. 2024 Jan 15:12:RP91775. doi: 10.7554/eLife.91775. PMID: 38224479. |
| OH15540 | pha-1(e2123) III; otEx7232. | C. elegans | otEx7232 [inx-15(fosmid WRM0619cH12)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15542 | pha-1(e2123) III; otEx7233. | C. elegans | otEx7233 [inx-19(extended fosmid WRM0632bE10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15555 | pha-1(e2123) III; otIs669 V; otEx7244. | C. elegans | otEx7244 [mgl-2(7.9k)::GFP + inx-6(prom18)::TagRFP + pha-1(+)]. 7.9 kb fragment used in otEx7244 reporter covers full mgl-2 5' promoter region. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH15566 | inx-2(ot906 [inx-2::SL2::NLS::yfp::H2B]) X. | C. elegans | inx-2(ot906) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-2 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15568 | unc-17(ot907[unc-17::mKate2::3xflag]) IV. | C. elegans | Superficially wild-type. mKate2 and 3xFlag tag added to endogenous unc-17 locus. unc-17::mKate2 labels all cholinergic neurons in the nervous system. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078. |
| OH15579 | che-1(ot908 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. | C. elegans | ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision). |
| OH15655 | otIs711. | C. elegans | otIs711 [nlp-8p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH15683 | che-1(ot871 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. | C. elegans | ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision). |
| OH15689 | pha-1(e2123) III; otEx7292. | C. elegans | otEx7292 [inx-7(fosmid WRM0631dH08)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. |
| OH15691 | otEx7294. | C. elegans | otEx7294 [inx-8(fosmid WRM0632dA04)::SL2::NLS::YFP::H2B + rol-6(su1006)]. Pick Rollers to maintain. |
| OH1571 | tax-2(ot25) otIs114 I; him-5(e1490) V. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic lim-6 expression in a set of cells anterior to ASE. Molecular identity: W40Stop. Null allele. |
| OH15732 | mab-3(ot931[mab-3::GFP::3xFlag]) II; him-5 (e1490) V. | C. elegans | GFP and 3xFlag tag inserted in endogenous mab-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: ggtcaaaattatagatctt Insertion site: II: 9737290-9737291. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078. |
| OH15733 | dmd-3(ot932[dmd-3::GFP::3xFlag]); him-8 (e1489) IV. | C. elegans | GFP and 3xFlag tag inserted in endogenous dmd-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: accctttcagccgtattgt Insertion site: V: 19650564-19650565. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078. |
| OH158 | zig-4(gk34) X. | C. elegans | C09C7.1 Deletion breakpoints at position 237 and 803 with insertion of CTTGTATAGCAAGAAACC at this breakpoint. Predicted molecular null. About 30% penetrance of displaced axons in the ventral nerve cord. Homozygous viable. |
| OH15814 | him-5(e1490) V; dmd-4(ot935[dmd-4::GFP]) X. | C. elegans | GFP tag inserted into endogenous dmd-4 locus to create a C-terminal translational GFP fusion. |
| OH15815 | che-1(ot63 ot941[che-1::SEC-GFP::TEV::3xFLAG]) I. | C. elegans | ot941[che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying ot63 null alllele and tagged with GFP (che-1::SEC-GFP::TEV::3xFLAG). che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37. |
| OH15845 | daf-16(ot853[daf-16::mNG::AID*]) I; daf-2(e1370) III; otIs730. | C. elegans | otIs730 [UPNp::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH15862 | him-5 (e1490) V; otEx7353. | C. elegans | otEx7353 [UPN::tagRFP::TRA-1(active) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Nervous system-specific expression of a TRA-1 gain-of-function construct. UPN is a concatenated panneuronal promoter (containing promoter fragments from unc-11, rgef-1, ehs-1, and ric-19). TRA-1(active) is a shortened version of the TRA-1A cDNA (860aa) predicted to encode the proteolytically activated version of TRA-1A generated by C-terminal cleavage in hermaphrodites (Schvarzstein and Spence 2006). |
| OH15876 | pha-4(ot946[pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]) V. | C. elegans | GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH15881 | otEx7363. | C. elegans | otEx7363 [flp-3p::mCherry + flp-3p::GFP::cla-1 + unc-122p::GFP]. Pick GFP+ animals to maintain. Presynaptic GFP::cla-1 reporter for IL1 neurons with cytoplasmic IL1p::mCherry in the background. Reference: Majeed M, et al. Elife. 2024 Jan 15:12:RP91775. doi: 10.7554/eLife.91775. PMID: 38224479. |
| OH1589 | lin-23(ot1) II; oxIs12 X; otEx840. | C. elegans | otEx840 [lin-23::GFP + rol-6(su1006)]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers. |
| OH15908 | him-5(e1490) V; dmd-4(ot957ot935) X. | C. elegans | CRISPR-engineered deletion in dmd-4(ot935[dmd-4::GFP]) removing +3201 to +3710 relative to start codon. Partial removal of intron 3 results in loss of somatic nervous system expression without affecting pharyngeal expression. |
| OH15910 | lin-11(ot958[lin-11::GFP::FLAG]) I. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous lin-11 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH15912 | vab-7(ot959[vab-7::GFP::FLAG]) III. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous vab-7 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH15913 | daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID*]) X; otIs730. | C. elegans | otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH160 | otIs76 mgIs18 IV; lon-2(e678) hst-6(ot17) X. | C. elegans | otIs76 [pttx-3p::kal-1 + unc-122p::GFP] IV. mgIs18 [ttx-3p::GFP] IV. Long, otherwise phenotypically WT. ttx-3p::GFP labels AIY interneurons. hst-6(ot17) suppresses the branching phenotype of KAL-1 overexpression in AIY. hst-6(ot17) is closely linked to lon-2. |
| OH16003 | otIs742. | C. elegans | otIs742 [nlp-13p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH16020 | exc-7(ot970[exc-7::gfp]) II. | C. elegans | Superficially wild-type. GFP inserted into endogenous exc-7 locus by CRISPR/Cas9. Reference: Pham K & Hobert O. MicroPubl Biol. 2019; 2019: 10.17912/micropub.biology.000189. |
| OH16024 | daf-16(ot971[daf-16::GFP]) I. | C. elegans | CRISPR allele of daf-16, tagged at the C-terminus with GFP. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology. |
| OH16029 | daf-16(ot975[daf-16::mNeptune2.5::AID*]) I. | C. elegans | CRISPR allele of daf-16, tagged at the C-terminus with mNeptune2.5::AID*. Reference: Aghayeva U, et al. MicroPubl Biol. 2020 Jan 7;2020:10.17912/micropub.biology.000210. doi: 10.17912/micropub.biology.000210. PMID: 32550509 |
| OH16047 | eat-5(ot980[eat-5::GFP]) I. | C. elegans | GFP tag with 6x GS linker inserted at C-terminus of endogenous eat-5 locus. |
| OH16085 | otIs748 X. | C. elegans | otIs748 [rab-3p(prom1)::GFP + ttx-3p::mCherry] X. Pan-neuronal cytoplasmic GFP expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| OH161 | ttx-3(ot22) X. | C. elegans | Thermotaxis defective (cryophilic). Null allele. |
| OH16103 | otDf1X. | C. elegans | otDf1is a deletion obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method removing ceh-41, ceh-21, T26C11.9, and ceh-39. 8968 bp deletion, from position -159 upstream ceh-39 ATG, to +1608 from ATG ceh-41 (+89 from STOP ceh-41). |
| OH16111 | unc-42(ot986[unc-42::gfp]) V. | C. elegans | GFP tag inserted at the C-terminus of the endogenous unc-42 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Berghoff EG, et al. Elife. 2021 Jun 24;10:e64903. doi: 10.7554/eLife.64903. PMID: 34165428 |
| OH16219 | ceh-44(ot1015[ceh-44::gfp]) III. | C. elegans | GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. |
| OH16224 | ceh-49(ot1016[ceh-49::gfp]) V. | C. elegans | GFP tag inserted at the C-terminus of the endogenous ceh-49 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. |
| OH16230 | otIs670 V; otIs672. | C. elegans | otIs672 [rab-3::NLS::GCaMP6s + arrd-4::NLS::GCaMP6s]. otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH16263 | otEx7457. | C. elegans | otEx7457 [sri-9::mCherry + sri-9p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ADL>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH16265 | otEx7459. | C. elegans | otEx7459 [srh-18::mCherry + srh-18p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ASH>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH16289 | otIs696; wtfIs5. | C. elegans | wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH16290 | otIs670 V; wtfIs5. | C. elegans | wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH16294 | nono-1(ot1018[nono-1::gfp::3xflag]) III. | C. elegans | Superficially wild-type. |
| OH16298 | him-8(e1489) IV; otIs670 V. | C. elegans | Him. [NOTE: strain does not segregate many male progeny.] otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 |
| OH16335 | ceh-34(ot1014) V; otEx7476. | C. elegans | otEx7476 [ceh-34(fosmid) + myo-3p::mCherry]. Pick mCherry+ to maintain. ot1014 is a CRISPR/Cas9-engineered allele removing the entire ceh-34 locus. ot1014 homozygotes arrest as L1 larvae. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH16345 | ceh-37(ot1023[ceh-37::GFP::FLAG]) X. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-37 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16366 | pha-1(e2123) III; otIs669 V; otEx7484. | C. elegans | otEx7484 [ceh-13::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16367 | pha-1(e2123) III; otIs669 V; otEx7485. | C. elegans | otEx7485 [ceh-28::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16368 | pha-1(e2123) III; otIs669 V; otEx7486. | C. elegans | otEx7486 [ceh-12::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16369 | pha-1(e2123) III; otIs669 V; otEx7487. | C. elegans | otEx7487 [ceh-17::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16370 | pha-1(e2123) III; otIs669 V; otEx7488. | C. elegans | otEx7488 [ceh-45::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16371 | pha-1(e2123) III; otIs669 V; otEx7489. | C. elegans | otEx7489 [nsy-7::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16376 | ceh-44(ot1028) III. | C. elegans | ot1028 = 80bp deletion on Exon 8 (first exon isoform A - isoform with CUT domains), leading to a frameshift and early stop codon in Exon 8 expected to affect only isoform A. Deletion coordinates: +9069 to +9148. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. ot1028 is molecularly identical to ot1031. |
| OH16377 | ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs356 V; otDf1 X. | C. elegans | otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. CUT Sextuple mutant animals show reduced pan-neuronal gene expression, impaired locomotion and resistance to aldicarb induced paralysis. otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341. |
| OH16380 | nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X. | C. elegans | Endogenous nlp-45 locus tagged with GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16391 | otEx7501. | C. elegans | otEx7501 [pdfr-1::GFP::cla-1 + pdfr-1::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Presynaptic GFP::cla-1 reporter for pharyngeal I1 neurons. Reference: Cook SJ, et al. J Comp Neural. 2020 Nov 1;528(16):2767-2784. doi: 10.1002/cne.24932. PMID: 32352566. |
| OH16395 | otEx7505. | C. elegans | otEx7505 [ceh-19p::GFP::cla-1 + ceh-19p::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Presynaptic GFP::cla-1 reporter for pharyngeal MC neurons. Reference: Cook SJ, et al. J Comp Neural. 2020 Nov 1;528(16):2767-2784. doi: 10.1002/cne.24932. PMID: 32352566. |
| OH16398 | otIs763. | C. elegans | otIs763 [lin-4(fosmid)::NLS::YFP::H2B]. Integrated fosmid transcriptional reporter for lin-4 microRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16445 | cdh-1(ot1034) III. | C. elegans | CRISPR/Cas9 engineered deletion of full cdh-1 locus. |
| OH16446 | cdh-3(ot1035) III. | C. elegans | CRISPR/Cas9 engineered deletion of full cdh-3 locus. |
| OH16461 | ama-1(ot1037[gfp::ama-1]) IV. | C. elegans | Superficially wild-type. |
| OH16463 | smo-1(ot1038[smo-1::gfp::3xflag]) I. | C. elegans | Superficially wild-type. |
| OH16464 | fust-1(ot1039[fust-1::gfp::3xflag]) II. | C. elegans | Superficially wild-type. |
| OH16479 | pha-1(e2123) III; otIs669 V; otEx7569. | C. elegans | otEx7569 [ceh-81::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16480 | pha-1(e2123) III; otIs669 V; otEx7570. | C. elegans | otEx7570 [ceh-91::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16481 | pha-1(e2123) III; otIs669 V; otEx7571. | C. elegans | otEx7571 [ceh-99::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16482 | rpc-1(ot1041[rpc-1::gfp::3xflag]) IV. | C. elegans | Superficially wild-type. |
| OH16487 | ceh-76(ot1042[ceh-76::GFP]) V. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-76 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16499 | nlp-45(ot1046) X. | C. elegans | Presumed null allele nlp-45. ot1046 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16500 | nlp-45(ot1047) X. | C. elegans | Presumed null allele nlp-45. ot1047 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16505 | ceh-89(ot1050[ceh-89::GFP]) X. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-89 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| OH16508 | daf-16(ot975[daf-16::mNeptune2.5::3xFlag::AID*]) I; daf-2(e1370) III; otIs730. | C. elegans | otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586. |
| OH16543 | unc-39(ok2137) V; otEx7581. | C. elegans | otEx7581 [unc-39(+) fosmid WRM0636cG07 + inx-6(prom18)::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH16551 | him-8(e1489) IV; mab-23(ot1057[mab-23::GFP::3xFLAG]) V. | C. elegans | GFP::3xFLAG tag inserted at C-terminus of endogenous mab-23 locus. Him. crRNA1: AATGACTAGATCAATGACG crRNA2: CGTCATTGATCTAGTCATT Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH16552 | dmd-5(ot1058[dmd-5::GFP::3xFLAG]) II; him-5(e1490) V. | C. elegans | GFP::3xFLAG tag inserted at C-terminus of endogenous dmd-5 locus. Him. crRNA1: CATCGTTTAATGAAAAATG. crRNA2: CATTTTTCATTAAACGATG. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH16554 | him-8(e1489) IV; dmd-7(ot1060[dmd-7::GFP::3xFLAG]) V. | C. elegans | GFP::3xFLAG tag inserted at C-terminus of endogenous dmd-7 locus. Him. crRNA1: CATGTGCTCATTTCTGTTG. crRNA2: CAACAGAAATGAGCACATG. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH16555 | him-8(e1489) IV; dmd-8(ot1061[dmd-8::GFP::3xFLAG]) V. | C. elegans | GFP::3xFLAG tag inserted at C-terminus of endogenous dmd-8 locus. Him. crRNA1: AATTGCAGCGCTAAGCTCA. crRNA2: TGAGCTTAGCGCTGCAATT. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH16557 | him-8(e1489) IV; dmd-10(ot1063[dmd-10::GFP::3xFLAG]) V. | C. elegans | GFP::3xFLAG tag inserted at C-terminus of endogenous dmd-10 locus. Him. crRNA1: ATGTCATTACAGTTTGATT. crRNA2: AATCAAACTGTAATGACAT. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH16563 | ceh-45(ot1065) I. | C. elegans | ot1065 is a CRISPR/Cas9-engineered allele removing the entire ceh-45 locus. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH16564 | ceh-53(ot1066) IV. | C. elegans | ot1066 is an engineered deletion of the full ceh-53 locus. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425 |
| OH16565 | ceh-79(ot1067) V. | C. elegans | ot1067 is an engineered deletion of the full ceh-79 locus. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425 |
| OH16636 | pha-1(e2123) III; otIs669 him-5(e1490) V; otEx7603. | C elegans | otEx7603 [nlp-52p::GFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. The nlp-52 reporter construct contains the full intergenic region of nlp-52 as the promoter. GFP expression in a subset of cells of the nervous system. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095. |
| OH1670 | him-5(e1490) V; otIs123. | C. elegans | otIs123 [sra-11::GFP + unc-4(+)]. Might contain an unc-4 mutation in the background. |
| OH16700 | otIs785. | C. elegans | otIs785 [ceh-34p::GFP::CLA-1 + ceh-34p::TagRFP + rol-6(su1006)]. Rollers. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH16704 | fox-1(ot1081[fox-1::gfp::3xflag]) X. | C. elegans | Superficially wild-type. |
| OH16737 | otIs788. | C. elegans | otIs788 [cat-4p::GFP::cla-1 + cat-4p::mCherry + inx-16p::tagRFP]. GFP-tagged CLA-1 provides a synaptic marker in HSN neurons. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| OH16739 | casy-1(ot1082) II. | C. elegans | CRISPR/Cas9 engineered deletion of full casy-1 locus. |
| OH16748 | otIs790. | C. elegans | otIs790 [UPN::npp-9::mCherry::blrp::3xFlag]. otIs790 contains a pan-neuronal INTACT tag for pull-down of all neuronal nuclei. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16750 | cdh-8(ot1084) IV. | C. elegans | CRISPR/Cas9 engineered deletion of full cdh-8 locus. |
| OH16765 | otIs794. | C. elegans | otIs794 [cho-1(fosmid)::NLS::SL2::YFP::H2B + eat-4(fosmid)::SL2::LSSmOrange::H2B + unc-47p::tagBFP2 + cat-1p::mMaroon + rab-3p1::2xNLS::tagRFP]. cho-1 fosmid reporter construct labels cholinergic neurons. eat-4 fosmid reporter construct labels glutamatergic neurons. unc-47p::tagBFP2 reporter (contains -2778 to -1 promoter region) labels GABAergic neurons. cat-1p::mMaroon reporter (contains -1599 to -1) labels monoaminergic neurons. rab-3p::tagRFP (contains -1462 to +2921 of prom1) labels all neurons (pan-neuronal marker). Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| OH16772 | fmi-1(ot1090) V. | C. elegans | CRISPR/Cas9 engineered deletion of full fmi-1 locus. |
| OH16773 | cdh-12(ot1091) III. | C. elegans | CRISPR/Cas9 engineered deletion of full cdh-12 locus. |
| OH16774 | cdh-1(ot1092[cdh-1::T2A::GFP::H2B]) III. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-1 locus. |
| OH16783 | cdh-9(ot1095[cdh-9::T2A::GFP::H2B]) X. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-9 locus. |
| OH16790 | him-8(e1489) IV; lin-14(cc2841[lin-14::gfp]) X; otEx7578. | C. elegans | otEx7578 [rab-3p::fem-3::SL2::TagRFP + inx-6(prom18)::TagRFP]. Panneuronal overexpression of fem-3 causes panneuronal masculation. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16795 | otEx7677; nlp-45(ot1046) X. | C. elegans | otEx7677 [mgl-1p::nlp-45 cDNA::SL2::TagRFP::p10 3'UTR + inx-6(prom18)::TagRFP]. Pick RFP+ to maintain. Over-expression of nlp-45 in the RMDD/V neurons in nlp-45 mutant background. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16799 | otEx7681; nlp-45(ot1046) X. | C. elegans | otEx7681 [glr-3p::nlp-45 cDNA::SL2::TagRFP::p10 3'UTR + inx-6(prom18)::TagRFP]. Pick RFP+ to maintain. Overexpression of nlp-45 in the RIA neurons in nlp-45 mutant background. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16816 | otIs809. | C. elegans | otIs809 [glr-7::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH16830 | cdh-8(ot1106[cdh-8::T2A::GFP::H2B]) IV. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-7 locus. |
| OH16831 | npr-17(ot1101[npr-17::GFP]) IV. | C. elegans | Endogenous npr-17 locus tagged with GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16834 | otTi71. | C. elegans | otTi71 [UPN::lin-4::unc-54 3’UTR]. single copy insertion of panneuronally expressed lin-4 pri-miRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16836 | otIs669 V; otIs115. | C. elegans | otIs115 [gcy-12p::GFP]. Integrated promoter fusion reporter for gcy-12. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. References: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2. Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16837 | him-8(e1489) IV; nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X; otEx7578. | C. elegans | otEx7578 [rab-3p::fem-3::SL2::TagRFP + inx-6(prom18)::TagRFP]. Panneuronal overexpression of fem-3 causes panneuronal masculation. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| OH16848 | him-5(e1490)V; otIs518; otIs773. | C. elegans | otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. otIs773 [inx-19(fosmid)::SL2::YFP::H2B + unc-122::GFP + pha-1(+)]. Integrated fosmid transcriptional reporter for inx-19. |
| OH16866 | otIs810. | C. elegans | otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1]. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| OH16932 | casy-1(ot1108[casy-1::T2A::GFP::H2B]) II. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous casy-1 locus. |
| OH16971 | otIs816. | C. elegans | otIs816 [klp-6p::mCherry + klp-6p::GFP::cla-1]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH17000 | cdh-3(ot1096[cdh-3::T2A::GFP::H2B]) III. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-3 locus. |
| OH17002 | cdh-10(ot1118[cdh-10::T2A::GFP::H2B]) IV. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-10 locus. |
| OH17030 | cdh-12(ot1119[cdh-12::T2A::GFP::H2B]) III. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-12 locus. |
| OH17051 | ceh-48(ot1125[ceh-48::GFP]) IV. | C. elegans | GFP tag inserted at the C-terminus of the endogenous ceh-48 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| OH17055 | ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otDf1 X; otIs790. | C. elegans | otIs790 [UPN::npp-9::mCherry::blrp::3xflag]. otIs790 contains a pan-neuronal INTACT tag for pull-down of all neuronal nuclei. CUT sextuple-mutant background. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| OH17058 | cdh-5(ot1127[cdh-5::T2A::GFP::H2B]) IV. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-5 locus. |
| OH17064 | daf-16(ot971[daf-16::GFP]) otDf2 I. | C. elegans | otDf2 is a 25,484 bp deletion of the insulin cluster from Chr I, removing ins-28, ZC334.13, ins-29, ins-25, ins-27, linc-124, ZC334.12, ZC334.17, ins-24, ins-30, and ins-26. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH17072 | otIs833. | C. elegans | otIs833 [egas-4p::TagRFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH171 | otEx103. | C. elegans | otEx103[lim-7::GFP; rol-6(su1006)]. <50% penetrant Roller line. Maintain by picking Rollers. GFP strongly expressed in gonad sheath cell pair 1. |
| OH17156 | cdh-5(ot1093) IV; him-5(e1490) V; dzIs89 X. | C. elegans | dzIs89 [inx-1p::BirA::nrx-1 + gcy-13p::AP::nlg-1 + gcy-13p::tagBFP + unc-122p::stretavadin::tagRFP] X. cdh-5(ot1093) is a CRISPR/Cas9 engineered deletion of full cdh-5 locus. Reference: Majeed M, et al. Sci Adv. 2025 Feb 21;11(8):eads2852. doi: 10.1126/sciadv.ads2852. PMID: 39983000. |
| OH172 | lin-15B&lin-15A(n765) X; otEx105. | C. elegans | otEx105 [lim-7::GFP + lin-15(+)]. Highly penetrant line, but non-Muv/Muv does not correlate well with presence/absence of extrachromosomal array. Maintain by picking GFP-positive animals under GFP-dissecting scope. GFP strongly expressed in gonad sheath cell pair 1. |
| OH17217 | otIs846. | C. elegans | otIs846 [egas-1p::GFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH17225 | otEx7760. | C. elegans | otEx7760 [cat-4p::mCherry + zig-3p::mCherry + zig-3p::NLG1::GFP1-10 + cat-4p::NLG1::GFP11 + inx-6(prom18)::TagRFP]. BDU-HSN GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH17241 | unc-86(ot1158) III. | C elegans | unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095. |
| OH17294 | npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV; otIs669 him-5(e1490) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH17368 | otIs854. | C. elegans | otIs854 [unc-39p::tagRFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH17492 | him-5(e1490) V; otEx7809. | C. elegans | otEx7809 [flp-7p::TagRFP + inx-1::tagRFP + flp-7p::NLG1::GFP1-10 + inx-1p::NLG1::GFP11]. Him. AIB-SAA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH17502 | otIs867. | C. elegans | otIs867 [srh-71p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH17513 | unc-86(ot1184) III; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. | C. elegans | Null allele of unc-86 generated by gRNAs targeted to the first and last exons, resulting in a 3202 bp deletion from -8 to +3194 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| OH17514 | ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V; ceh-14(ot1185) X. | C. elegans | Null allele of ceh-14 generated by gRNAs targeted to the first and last exons, resulting in a 4056 bp deletion from +40 to +4096 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| OH17515 | unc-30(ot1186) IV; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. | C. elegans | Null allele of unc-30 generated by gRNAs targeted to the first and last exons, resulting in a 5168 bp deletion from -37 to +5131 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| OH17582 | daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II; daf-2(e1370) III. | C. elegans | otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Temperature-senstive daf(c): maintain at 15C. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Constitutive dauer formation at 25 C due to daf-2(e1370). Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH17657 | unc-39(syb4537ot1193[unc-39p(bs_del)::unc-39::gfp]) V. | C. elegans | ot1193 is a CRISPR-engineered mutation of a small unc-39 auto-regulatory region containing a cluster of several predicted homeodomain binding sites in the endogenously-tagged unc-39(syb4537) reporter strain. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH17726 | unc-3(ot5008) X. | Pristionchus pacificus | severe unc |
| OH17751 | otEx7895. | C. elegans | otEx7895 [nmr-1p::CyoFP + flp-3p::mNeptune + gcy-35p::mNeptune flp-7p::tagRFP + klp-6::tagRFP + C42D4.1::GFP]. Pick animals with red or green fluorescence to maintain. AxoPAL strain for visualizing axonal neighborhoods. Reference: Majeed M, et al. Sci Adv. 2025 Feb 21;11(8):eads2852. doi: 10.1126/sciadv.ads2852. PMID: 39983000. |
| OH17766 | ins-3(syb5421[ins-3::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| OH17767 | ins-6(syb5463[ins-6::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933. |
| OH17768 | ins-24(syb5447[ins-24::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| OH17801 | him-5(e1490) V; otIs870. | C. elegans | otIs870 [mir-228p::3xNLS::TagRFP] Pan-glial expression of tagRFP reporter. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| OH17826 | ins-30(syb5526[ins-30::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| OH17870 | lin-11(ot1026) I; unc-17(syb4491[unc-17::T2A::GFP::H2B]) IV; otIs669 him-5(e1490) V. | C. elegans | Egl. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| OH17874 | Cbr-dpy-10(ot1210) II. | C. briggsae | Dpy Rol. Heterozygotes are Left-handed Rol. R92C mutation in Cbr-dpy-10 generated via CRISPR/Cas9. Homologous to the C. elegans dpy-10(cn64) mutation. |
| OH17918 | lep-5(ot1215[lep-5p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. | C. elegans | The Null Transcriptional Reporter (NuTR) cassette was used to remove the lep-5 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. Males exhibit typical leptoderan tails. |
| OH17921 | linc-3(ot1217[linc-3p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) V. | C. elegans | The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-3 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers. |
| OH17923 | linc-19(ot1219[linc-19p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) III. | C. elegans | The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-19 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers. |
| OH17929 | linc-23(ot1225[linc-23p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. | C. elegans | The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad. |
| OH17932 | linc-26(ot1227[linc-26p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. | C. elegans | The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad and extremely dim expression in hermaphrodite spermatheca. |
| OH17935 | linc-36(ot1229[linc-36p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. | C. elegans | The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-36 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the sperm of both hermaphrodites and males. |
| OH17938 | linc-41(ot1231[linc-41p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. | C. elegans | The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-41 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad, spermatheca of hermaphrodites, as well as several other tissues in the head. |
| OH17942 | tts-1(ot1234[tts-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. | C. elegans | The Null Transcriptional Reporter (NuTR) cassette was used to remove the tts-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in several tissues including the pharynx but is significantly upregulated in a stress-dependent manner in a variety of tissues. |
| OH17945 | puf-9(ot1236[puf-9::GFP::loxP::3xFLAG]) X. | C. elegans | SEC cassette was used to generate a C-terminal GFP tag of puf-9. Expression is cytoplasmic and pan-somatic throughout larval development into adults. |
| OH17963 | otIs879. | C. elegans | otIs879 [sri-1p::NLS::GFP + pha-1(+)]. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| OH17994 | cdh-4(ot1246) III. | C. elegans | CRISPR/Cas9 engineered deletion of full cdh-4 locus. |
| OH17995 | cdh-9(ot1247) X. | C. elegans | CRISPR/Cas9 engineered deletion of full cdh-9 locus. |
| OH18019 | linc-1(ot1249[linc-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. | C. elegans | The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad. |
| OH18043 | rab-3(ot1178 syb3072) II; him-8(e1489) IV. | C. elegans | CRISPR-engineered mutation of CUT transcription factor binding site in endogenously-tagged rab-3(syb3072[rab-3::T2A::3xNLS::GFP]). Causes a reduction in rab-3 expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| OH18062 | nlp-11(syb4759[nlp-11::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH18108 | otIs669 V; nlp-66(syb4403[nlp-66:SL2:GFP::H2B])X. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nlp-66 locus by CRISPR. Allele generated by SUNY Biotech. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| OH18111 | ttx-1(syb1679[ttx-1::GFP]) ot1264) V. | C. elegans | ot1264 is a CRISPR deletion removing -10.8 kb to -1.8 kb before the first exon of ttx-1, made in the context of the ttx-1::GFP allele syb1679. Notably ttx-1 expression in RIB is lost, and RIB markers are off or dim. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| OH18145 | otIs883. | C. elegans | otIs883 [srab-20p::GFP::cla-1 + unc-122p::mCherry]. Presynaptic GFP::cla-1 reporter for PHB neurons. Reference: Majeed M, et al. Elife. 2024 Jan 15:12:RP91775. doi: 10.7554/eLife.91775. PMID: 38224479. |
| OH18190 | unc-4(ot5018) II. | Pristionchus pacificus | unc |
| OH18203 | ceh-44(ot1294[*ot1015[ceh-44::gfp]]) III. | C. elegans | ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. Reporter expression is not affected. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18237 | lim-6(ot1312) X. | C.elegans | Full gene deletion of the lim-6 locus (-51 to +5144) by CRISPR. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18268 | ceh-44(ot1402[*ot1015[ceh-44::gfp]]) III. | C. elegans | ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1402 is a deletion removing the UNC-75 binding site within intron 7 of the endogenously-tagged ceh-44 locus. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18297 | spig-2(ot1324[spig-2::SL2::GFP::T2A::H2B *syb6670]) V. | C. elegans | Derived by CRISPR edit of spig-2(syb6670[spig-2::SL2::GFP::H2B]) in parental strain PHX6670 to insert T2A was inserted between GFP and H2B to convert the reporter from nuclear to cytoplasmic localization. Reference: Aguilar GR & Hobert O. (2024). A protocol to transform a fluorescent reporter from a nuclear to a cytoplasmic location. microPublication Biology. https://doi.org/10.17912/micropub.biology.000954 |
| OH18320 | ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I. | C. elegans | ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH18398 | otIs669 him-5(e1490) V; unc-6(syb5064[unc-6::SL2::GFP::H2B]) X. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983. |
| OH18410 | cone-1(syb5437[GFP::cone-1]) ceh-44(ot1294[*ot1015[ceh-44::gfp]]) III. | C. elegans | GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. Normally broad, punctate expression of GFP::CEH-44 is not present. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18463 | unc-75(ot1351) I; ceh-44(ot1015[ceh-44::GFP]) III. | C. elegans | ot1351 is a CRISPR-engineered deletion of unc-75 gene rendering all 3 RNA recognition motifs null on unc-75; reduces pan-neuronal nuclear GFP expression fluorescence. GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18465 | ceh-38(tm321) II; ceh-44(ot1015[ceh-44::gfp]) III; ceh-48(tm6112) IV; otDf1 X. | C. elegans | ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. CUT Quintuple-mutant background. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH1849 | pha-1(e2123) III; otEx980. | C. elegans | otEx980 [dop-2::GFP + pha-1(+)]. |
| OH18501 | aex-1(ot1357) I. | C. elegans | ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH18508 | daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. | C. elegans | ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH18512 | pha-1(e2123) III; otEx8085. | C. elegans | otEx8085 [pha-4(prom2)::GFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to select for animals carrying the array. pha-4 cis-regulatory element drives expression specifically in all 20 pharyngeal enteric neurons, 2 hindgut enteric neurons, as well as RIS and PVT. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH18559 | him-5(e1490) V; otIs810. | C. elegans | otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1]. |
| OH18562 | unc-119(ed3) III; otIs898[*oxTi553] V. | C. elegans | otIs898 [pha-4prom2::3xNLS::ceGCaMP6s::unc-54 3' UTR]. Neuron-specific cis regulatory fragment of pha-4 driving expression of C. elegans codon-optimized GCaMP6s in enteric neurons. The multicopy array was inserted at the oxTi553 landing site (EG7944) by FLInt. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH18594 | Cbr-eat-4(ot1371[Cbr-eat-4::T2A::GFP::H2B]) III. | C. briggsae | T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18595 | unc-25(ot1372[unc-25::T2A::GFP::H2B] III. | C. elegans | Endogenous unc-25 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| OH18596 | Cbr-unc-25(ot1373[Cbr-unc-25::T2A::GFP::H2B]) III. | C. briggsae | T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18614 | hlh-13(ot1388) X. | C. elegans | CRISPR/Cas9-engineered deletion removing entire hlh-13 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| OH18615 | hlh-15(ot1389) X. | C. elegans | CRISPR/Cas9-engineered deletion removing entire hlh-15 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| OH18619 | lim-6(ot1391[lim-6::GFP]) X. | C. elegans | C-terminal GFP tag inserted before STOP codon of endogenous lim-6 locus using CRISPR/Cas9. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18624 | Ctr-lim-6(ot1392[Ctr-lim-6::GFP]) X. | C. tropicalis | C-terminal GFP tag inserted before STOP codon of endogenous Ctr-lim-6 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18640 | Cbr-lim-6(ot1393[Cbr-lim-6::GFP]) X. | C. briggsae | C-terminal GFP tag inserted before STOP codon of endogenous Cbr-lim-6 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18653 | ins-2(syb6543[ins-2::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983. |
| OH18671 | Ctr-unc-25(ot1397[Ctr-unc-25::T2A::GFP::H2B]) III. | C. tropicalis | T2A::GFP::H2B tag inserted before STOP codon of endogenous Ctr-unc-25 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18694 | col-105(syb6767[col-105::SL2::GFP::H2B]) him-8(e1489) IV. | C. elegans | Endogenous locus tagged with SL2::GFP::H2B at C-terminus using CRISPR/Cas9. The reporter is linked to him-8(e1489) in the background. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| OH18707 | otIs904 V. | C. elegans | otIs904 [ges-1p::ins-1::tagRFP-T::SL2::GFP::his-44::tbb-2 3’ UTR + inx-6p18::tagRFP::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of INS-1 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH18749 | cone-1(ot1409[*syb5437[GFP::con-1]) III. | C. elegans | syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1409 is a deletion removing exons 1-7 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18750 | cone-1(ot1410[*syb5437[GFP::con-1]) III. | C. elegans | syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1410 is a deletion removing exon 5 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18755 | unc-30(ot5019) IV. | Pristionchus pacificus | unc |
| OH1876 | hst-2(ok595) X. | C. elegans | |
| OH18772 | ins-5(syb6245[ins-5::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983. |
| OH18779 | unc-25(ot5020) III. | Pristionchus pacificus | unc |
| OH18821 | nlp-18(ot1421[nlp-18::SL2::GFP::H2B]) II. | C. elegans | SL2::GFP::H2B tag inserted after STOP codon of endogenous nlp-18 locus using CRISPR/Cas9. The 15 first nucleotides of the standard SL2 sequence (immediately downstream of nlp-18 STOP) are missing but bright GFP fluorescence is clearly detectable. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18826 | Ctr-nlp-11(ot1422[Ctr-nlp-11::SL2::GFP::H2B]) II. | C. tropicalis | SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-11 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18829 | Cbr-nlp-3(ot1423[Cbr-nlp-3::SL2::GFP::H2B]) X. | C. briggsae | SL2::GFP::H2B tag inserted after STOP codon of endogenous Cbr-nlp-3 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18832 | Cbr-nlp-18(ot1424[Cbr-nlp-18::SL2::GFP::H2B]) II. | C. briggsae | SL2::GFP::H2B tag inserted after STOP codon of endogenous Cbr-nlp-18 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18835 | ins-7(ot1427) IV. | C. elegans | ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH18840 | hlh-32(ot1347) IV. | C. elegans | CRISPR/Cas9-engineered 1691 bp deletion removing entire hlh-32 locus; similar to syb6773 deletion. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| OH18853 | Ctr-ceh-32(ot1430[Ctr-ceh-32::GFP]) V. | C. tropicalis | C-terminal GFP tag inserted before STOP codon of endogenous Ctr-ceh-32 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18854 | Cbr-ceh-32(ot1431[Cbr-ceh-32::GFP]) V. | C. briggsae | C-terminal GFP tag inserted before STOP codon of endogenous Cbr-ceh-32 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18863 | unc-18(ot1432(unc-18::SL2::GFP::H2B)) X. | C. elegans | Endogenous reporter generated by the insertion of SL2::GFP::H2B into the endogenous unc-18 locus. Expression in intestine and nervous system. Reference: Boeglin M, et al. Genetics. 2023 Dec 6;225(4):iyad180. doi: 10.1093/genetics/iyad180. PMID: 37793339. |
| OH18871 | ceh-44(ot1433[*ot1015[ceh-44::gfp]]) III. | C. elegans | ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1433 is a deletion removing exons 4-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18872 | ceh-44(ot1434[*ot1015[ceh-44::gfp]]) III. | C. elegans | ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 1-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18892 | Cbr-unc-17(ot1440[Cbr-unc-17::T2A::mScarlet3::H2B]) IV. | C. briggsae | T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-unc-17 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18895 | ins-35(ot1443) V. | C. elegans | ot1443 is CRISPR-engineered 646 bp deletion of the ins-35 gene removing all the coding sequence except the last 7 aa, which should not be translated due to the absence of an ATG. Sequence after edit: ttctgaaatttttgaaattgtctaattttcCAGCAGACTCAGATGAACTATTCAATTAATAATTTAAGTT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH18902 | degt-1(ot1445[degt-1::GFP]) V. | C. elegans | GFP tag inserted at the C-terminus of the endogenous degt-1 locus directly before the DEGT-1 stop codon. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2 |
| OH18948 | ceh-44(ot1447[*ot1015[ceh-44::gfp]]) III. | C. elegans | ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1447 is a deletion removing exon 5 of the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18961 | Ctr-nlp-3(ot1453[Ctr-nlp-3::SL2::GFP:H2B]) X. | C. tropicalis | SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-3 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH19034 | degt-1(ot1466) V. | C. elegans | Null allele. ot1466 is a CRISPR-engineered deletion removing the complete CDS. Normal growth & viability. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2 |
| OH19054 | pha-1 (e2123) III; otEx8199. | C. elegans | otEx8199 [sshk-1p::GFP + pha-1(+)]. Maintain at 25C. 370 bp of promoter directly upstream of sshk-1 fused to GFP. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| OH19078 | daf-16(ot853[daf-16::mNG::AID*]) I; otIs908 V. | C. elegans | otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. TIR1(F79G) expression in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH19089 | Ctr-nlp-18(ot1474[Ctr-nlp-18::SL2::GFP:H2B]) II. | C. tropicalis | SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-18 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH19094 | Cbr-lgc-37(ot1475[Cbr-lgc-37::T2A::mScarlet3::H2B]) III. | C. briggsae | T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-lgc-37 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH19118 | otIs913 V. | C. elegans | otIs913 [pha-4(prom2)::daf-2(DN)::eBFP2::tbb-2 3’ UTR + unc-122p::mCherry::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. pha-4(prom2) drives expression of daf-2(DN) in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH19119 | cone-1(ot1485[*syb5500[cone-1::oxGFP]]) III. | C. elegans | syb5500 is an oxGFP tag inserted at the C-terminus of the endogenous cone-1 locus by CRISPR. ot1485 is an early stop codon introduced into exon 3 of the endogenously-tagged cone-1 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH19120 | ceh-44(ot1486[*ot1015[ceh-44::gfp]]) III. | C. elegans | ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1468 is an early stop codon introduced into exon 3 of the endogenously-tagged ceh-44 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH19123 | Ctr-lgc-37(ot1487[Ctr-lgc-37::T2A::mScarlet3::H2B]) III. | C. tropicalis | T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-lgc-37 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH19124 | pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. | C elegans | SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| OH19125 | pks-1(ot1489[pks-1::SL2::GFP::H2B]) X. | C elegans | GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| OH19186 | cone-1(ot1502[GFP::H2B::SL2::cone-1]) III. | C. elegans | GFP::H2B tag with SL2 inserted at N-terminus of endogenous cone-1 locus. Ubiquitous nuclear green at all stages (as early as 2-cell). GFP signal is very bright compared to C-terminal tag in OH19215. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH19202 | Cbr-eat-4(ot1507[Cbr-eat-4::SL2::mScarlet3::H2B]) III. | C. briggsae | SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH19204 | golg-4(ot1508[GFP::golg-4]) III. | C elegans | GFP tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170. |
| OH19205 | golg-4(ot1509[mScarlet3::golg-4]) III. | C elegans | mScarlet3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170. |
| OH19206 | golg-4(ot1510[mScarlet-I3::golg-4]) III. | C elegans | mScarlet-I3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170. |
| OH19210 | him-8(e1489) IV; unc-42(ot1187) V. | C. elegans | CRISPR/Cas9 full deletion removing the entire coding-region of unc-42. Him and Unc. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983. |
| OH19211 | Ctr-eat-4(ot1512[Ctr-eat-4::SL2::mScarlet3::H2B]) III. | C. tropicalis | SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-eat-4 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH19212 | Ctr-unc-17(ot1513[Ctr-unc-17::T2A::mScarlet3::H2B]) IV. | C. tropicalis | T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-unc-17 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH19215 | cone-1(ot1514[cone-1::SL2::GFP::H2B]) III. | C. elegans | CRISPR reporter, substitution of SL2 for T2A. A broad nuclear expression begins around the Comma stage. Brighter expression with earlier initiation than T2A reporter. Expression becomes restricted to non-neuronal cells as animals mature to larval stages. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH19219 | ceh-44(ot1515[*ot1015[ceh-44::gfp]]) III. | C. elegans | ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH19232 | daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II. | C. elegans | otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH19259 | Cbr-unc-25(ot1524[Cbr-unc-25::SL2::mScarlet3::H2B]) III. | C. briggsae | SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH19278 | aex-4(ot1530[aex-4::SL2::gfp::his-44]) X. | C. elegans | SL2::GFP::HIS-44 tag inserted into the endogenous aex-4 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH19280 | aex-5(ot1532[aex-5::SL2::gfp::his-44]) I. | C. elegans | SL2::GFP::HIS-44 tag inserted into the endogenous aex-5 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH19295 | unc-25(ot1536[unc-25b.1::T2A::GFP::H2B]) III; him-5(e1490) V. | C. elegans | CRISPR-engineered T2A::GFP::H2B insertion specifically tags isoform b.1 of the endogenous unc-25 locus. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| OH19299 | unc-75(ot1539[mScarlet-I3::unc-75]) I. | C elegans | mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| OH19333 | aex-1(ot1543[aex-1::SL2::gfp::his-44]) I. | C. elegans | SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH19337 | tph-1(ot1545) II. | C. elegans | ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH19404 | dmd-6(ot1059[dmd-6::GFP::3xFLAG]) II; mel-28(bq6[mKate2::mel-28]) III; him-5(e1490) V. | C. elegans | GFP::3xFLAG tag inserted at C-terminus of endogenous dmd-5 locus. mKate2 tag inserted at N-terminus of endogenous mel-28 locus. Him. crRNA1: TCTTTGACTTAGACCGGGT. crRNA2: ACCCGGTCTAAGTCAAAGA. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH19406 | him-8(e1489) IV; dmd-10(syb1703[GFP::3xFLAG::dmd-10]) V. | C. elegans | GFP::3xFLAG tag inserted at N-terminus of endogenous dmd-10 locus. Him. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH19410 | him-8(e1489) IV; dmd-7(syb5992[dmd-7::SL2::GFP::H2B]) V. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous dmd-7 locus. Him. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH19411 | him-8(e1489) IV; dmd-7(syb4035[GFP::tev::loxP::3xFLAG::dmd-7]) V. | C. elegans | GFP::tev::loxP::3xFLAG tag inserted at N-terminus of endogenous dmd-7 locus. Him. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH19441 | mab-23(ot1574) him-5(e1490) V. | C. elegans | CRIPSR/Cas9-engineered mab-23 null mutant. Him. Abnormal male tail. Generated in N2 background. crRNA1: AGTGTACTTGGTCCCAAAAG. crRNA2: CGTTTTGCTTCATTTTACAC. ssODN: ATTGGTCCACGCACTGTTCTATGGCCACGCCTCTTTAAAATGAAGCAAAACGAATCCAAGTCAACACAGA. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH19444 | dmd-3(ot1577) him-5(e1490) V. | C. elegans | CRIPSR/Cas9-engineered dmd-3 null mutant. Him. Abnormal male tail. Generated in N2 background. crRNA1: ACAAGTTTTATATTGTGATA. crRNA2: AAATCAATATGGTAACGTTT. ssODN: TTTTTTTTCTGAATAAAAAAAAAATTGTACCTTATCGTTACCATATTGATTTTCTCGGTGATTTGATCAC. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH19575 | otIs927 V. | C. elegans | otIs927 [ges-1p::nlp-40::tagRFP-T::SL2::GFP::his-44::tbb-2 3’ UTR + inx-6(prom18)::tagRFP-T::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of NLP-40 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH19587 | php-3(syb1549[php-3::GFP]) III; otIs669 him-5(e1490) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983. |
| OH1960 | pha-1(e2123) III; otEx1043. | C. elegans | otEx1043 [dop-1(prom2)::GFP + pha-1(+)]. |
| OH19735 | otIs937 V. | C. elegans | otIs937 [ceh-19(prom2)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. ceh-19(prom2) drives expression of daf-2(DN) specifically in the MC neurons in the pharyngeal nervous system. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH19767 | otIs942 V. | C. elegans | otIs942 [tph-1(prom5)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. tph-1(prom5) drives expression of daf-2(DN) specifically in the NSM neurons. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH19781 | Cbr-cat-1(ot1621[Cbr-cat-1::SL2::mScarlet3::H2B]) X. | C. briggsae | SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-cat-1 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH19827 | Ctr-cat-1(ot1631[Ctr-cat-1::SL2::mScarlet3::H2B]) X. | C. tropicalis | SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-cat-1 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH19864 | fog-29(q71) pha-4(ot1506)/stu-3(q265) rol-9(sc148) V. | C. elegans | Heterozygous. Pick wild-type to maintain. ot1506 is a full (6665bp) deletion of the pha-4 locus coding region from the start codon of the longest isoform to the stop codon. Heterozygotes appear wild-type, and segregate wild-type heterozygotes, fog-29(q71) pha-4(ot1506) homozygotes (arrest as embryos or L1s), Sterile Rollers. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH19945 | pha-4(syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG] *ot1078 *ot946) otIs908 V. | C. elegans | otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. Endogenously-tagged pha-4::GFP::AID crossed with enteric neuron-specific TIR1(F79G), allowing depletion of PHA-4 from pharyngeal nerons, AVL, and RIS by addition of 5-Ph-IAA. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH2000 | lin-23(ot1) II; oxIs12 X; otEx1076. | C. elegans | otEx1076 [unc-47p(long)::lin-23cDNA(yk784a08) + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers. |
| OH20048 | mab-3(ot1666[mab-3::SL2::GFP::H2B]) II; him-8(e1489) IV. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous mab-3 locus. Him. crRNA: TGGTCAAAATTATAGATCTT. ssODN primers: FWD 5' GGAGTATGTATCTGAAAAATTATGGTCTGCAAGCCTAAgctgtctcatcctactttcacctag 3'; REV 5' ttttctaaaaatcaataattggtcaaaattatagatcctacttgctggaagtgtacttg 3'. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| OH20089 | otEx8333. | C. elegans | otEx8333 [sre-22p::GFP::H2B::tbb-2 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH20095 | egl-3(nu1711[loxP::egl-3::loxP]) V; otEx8339. | C. elegans | otEx8339 [sre-22p::2xFlag::NLS::Cre::unc-54 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron, allowing PVT cell-specific Cre-Lox elimination of egl-3 in animals carrying the array. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH20099 | pha-4(ot1078[loxp::pha-4::GFP::loxP] *ot946) V; otEx8343. | C. elegans | otEx8343 [sre-22p::2xFlag::NLS::Cre::unc-54 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron, allowing PVT cell-specific Cre-Lox elimination of pha-4 in animals carrying the array. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH20145 | zfh-2(ot1709)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. | C. elegans | Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus ot1709 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. zfh-2(ot1709) is a CRISPR/Cas9-engineered >30kb deletion of the entire zfh-2 locus. crRNA1: CTACCATTTAGCCAATATAT. crRNA2: GTAGTAGTAGTAGTATGAGG. ssODN: aaattcatccaaaaaaatttccagagttgccccgcccataCATACTACTACTACTACCACGACGACGCCATAAcaaaacc. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069. |
| OH2018 | mgIs18 IV; otIs35 hst-6(ot19) X. | C. elegans | mgIs18 [ttx-3p::GFP] IV. otIs35 [ttx-3p::kal-1 + rol-6(su1006)] X. otIs35 has been mapped to LG X between lon-2 and hst-6. Rollers. ttx-3p::GFP labels AIY interneurons. ot19 suppresses the branching phenotype of KAL-1 overexpression in AIY. hst-6(ot19) is closely linked to otIs35. |
| OH2024 | exc-4(rh133) I; otEx1000. | C. elegans | otEx1000 [hsp16-2::exc-4(cDNA)::GFP + rol-6(su1006)]. Maintain by picking Rollers. |
| OH20419 | zfh-2(syb10278[zfh-2::GSGGSGGTGGSG::mIAA7::wrmScarlet-I3-mIAA7]) I; otSi4 II. | C. elegans | otSi4 [myo-2p::TIR1(F79G)::mRuby::unc-54 3'UTR *ieSi60] II. Endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069. |
| OH2042 | lin-49(ot78) dpy-20(?) IV; otIs3 V. | C. elegans | otIs3 [gcy-7::GFP + lin-15(+)] V. Whole genome sequenced strain. |
| OH20425 | zfh-2(ot1787 *syb10278)/tmC20[unc-14(tmIs1219) dpy-5(tm9715)] I. | C. elegans | Homozygous sterile mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus ot1709 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Second homeodomain deleted from endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. ot1787 crRNA1: TCCTGCAACACGTCGTCCAG. crRNA2: CGGCGTTCTCACAAATCGAT. ssODN: ATGACACCGAGCACTCCTTCCTGCAACACGTCGTCCtcTGGACGAATCTATGAGAATCAGCCGAATCACGAGAGTTCtGATCGATTTGTGAGAACGCCGGGATCGAACTTTCAGTGC. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069. |
| OH2096 | lin-23(ot1) II; oxIs12 X; otEx1131. | C. elegans | otEx1131[unc-47::GFP + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers. |
| OH2143 | otIs39 II; wrk-1(ok695) X. | C. elegans | otIs39 [unc-47(delta)::GFP + lin-15(+)]. |
| OH2204 | otEx1182. | C. elegans | otEx1182[gst-44p::gst-44::GFP + rol-6(dom)]. Maintain by picking Rollers. |
| OH2211 | otEx1184. | C. elegans | otEx1184 [exl-1p::exl-1::GFP + rol-6(su1006)]. Maintain by picking Rollers. Translational GFP fusion localizes to lysosomal membranes in the intestine and to the Golgi apparatus in neurons and muscle. |
| OH2225 | unc-4(e120) die-1(ot26) II. | C. elegans | |
| OH2246 | otIs107. | C. elegans | otIs107 [ser-2::GFP + lin-15(+)]. Not on LG X. |
| OH2344 | eno-2(ot2) I; oxIs12 X. | C. elegans | oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
| OH2345 | eno-3(ot3) oxIs12 X. | C. elegans | Ectopic DVB outgrowth. oxIs12 [unc-47p::GFP + lin-15(+)]. |
| OH2346 | eno-6(ot6) V; oxIs12 X. | C. elegans | oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
| OH2347 | eno-11(ot40) I; oxIs12 X. | C. elegans | oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
| OH2382 | eno-7(ot7) IV; oxIs12 X. | C. elegans | oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
| OH2383 | eno-8(ot8) III; oxIs12 X. | C. elegans | oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
| OH2411 | pha-1(e2123) III; otEx233. | C. elegans | otEx233 [dop-1(prom1)::GFP + pha-1(+)]. |
| OH2475 | otIs157. | C. elegans | otIs157 [lim-6r::GFP + rol-6(su1006)]. |
| OH2535 | lsy-6(ot71) V. | C. elegans | Worms appear WT. 1071 bp deletion removes the entire lsy-6 hairpin and part of the predicted C32C4.3 gene. ASEL takes on ASER gene expression profile. |
| OH2638 | dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1467. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx1467 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1467 are DpyUnc. Animals which have lost the otEx1467 array are DpyUncLet. |
| OH2639 | dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1468. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx1468 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1468 are DpyUnc. Animals which have lost the otEx1468 array are DpyUncLet. |
| OH2672 | otEx1495. | C. elegans | otEx1495 [sul-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. GFP expression in hypodermis and AVL. |
| OH2724 | otIs133; otEx1545. | C. elegans | otIs133 [pttx-3::RFP + unc-4(+)]. otEx1545 [F11H8.2::GFP + rol-6(su1006)]. Maintain by picking GFP+ Rollers. RFP expressed in AIY only. Reference: Wenick AS, Hobert O. Wenick AS, Hobert O. Developmental Cell. 2004 Jun;6(6):757-70. |
| OH2862 | otEx731. | C. elegans | otEx731[lin-23::GFP + rol-6(su1006)]. lin-23prom::GFP transcriptional fusion. |
| OH2871 | che-1(ot101) I; ntIs1 V; otIs151. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V; integration of adEx1262 [gcy-5p::GFP + lin-15(+)]. otIs151 [ceh-36p::RFP + rol-6(su1006)]. Rollers. Both ASEL and ASER show GFP expression from ntIs1. |
| OH2984 | otEx1765. | C. elegans | otEx1765 [let-765::GFP + rol-6(su1006)]. Maintain by picking Rollers. |
| OH2985 | otEx1766. | C. elegans | otEx1766 [let-765::GFP + rol-6(su1006)]. Maintain by picking Rollers. |
| OH2987 | otEx1768. | C. elegans | otEx1768 [let-756::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers. |
| OH2990 | otEx1771. | C. elegans | otEx1771[egl-15::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers. |
| OH2996 | ntIs1; lsy-2(ot64) X; otEx1777. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. otEx1777 [lsy-2::GFP + rol-6(su1006)]. Maintain by picking Rollers. |
| OH3112 | otIs159. | C. elegans | otIs159 [die-1::GFP + rol-6(su1006)]. GFP expressed in embryonic hypodermis and head neurons. |
| OH313 | ser-2(pk1357) X. | C. elegans | |
| OH3150 | otIs160; otIs151. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. otIs160 [lsy-6::GFP + coelomocyte::GFP]. Rollers. |
| OH3191 | otIs3 V. | C. elegans | otIs3 [gcy-7::GFP + lin-15(+)]. Integrated from adEx1288; genetically mapped between 3.05 m.u. (T19B10) and 5.86 m.u. (AH10) on V. GFP expression appears in ASEL and the excretory cell in adult animals. |
| OH3192 | ntIs1 V. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V; integration of adEx1262 [gcy-5p::GFP + lin-15(+)]. GFP expression appears in ASER in adult animals. |
| OH3313 | oyIs14 V; otIs37 X. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otIs37 [unc-47(del)::GFP]. GFP fluorescence in PVT and DBV. |
| OH3314 | oyIs14 V; otIs38 X. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otIs38 [unc-47(del)::GFP]. otIs38 is integrated juEx60 [(pCZ114) unc-47(del)::GFP]. GFP fluorescence in PVT and DBV. |
| OH3351 | otIs162; him-5(e1490) V. | C. elegans | otIs162[gcy-6::GFP + lin-15(+)]. |
| OH3455 | oyIs14 V; egl-15(n1456) X; otEx1254. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx1254 [egl-15p::egl-15(5B) genomic hybrid + ceh-22p::GFP + pBS]. otEx1254 rescues the lethal phenotype of egl-15(n1456). |
| OH3467 | oyIs14 V; egl-15(n1456) X; otEx1267. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx1267 [pTB71=egl-15p::egl-15(5B) genomic hybrid + ceh-22p::GFP + pBS]. otEx1267 rescues the lethal phenotype of egl-15(n1456). |
| OH3478 | oyIs14 V; egl-15(n484) X; otEx1270. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx1270 [dpy-7p::egl-15(5A)cDNA + ceh-22p::GFP + pBS]. Maintain by picking worms with GFP expression in their pharynx. |
| OH3487 | otIs114 I; cog-1(ot119) II. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot119. Rollers. |
| OH3491 | otIs114 I; cog-1(ot123) II. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. ot123 is a semi-dominant deletion allele of part of the cog-1 3' UTR, a lsy-6 miRNA target. Loss of miRNA regulation leads to ectopic expression of cog-1 in ASEL, which transforms ASEL to have ASER fate. otIs114, normally expressed in only ASEL and excretory gland cells, is lost in ASEL in ot123. Animals tend not to Roll. |
| OH3503 | otEx2040. | C. elegans | otEx2040 [hse-5p::GFP + rol-6(su1006)]. Transcriptional hse-5s::GFP fusion.Maintain by picking Rollers. |
| OH3556 | che-1(ot124) otIs114 I. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH3568 | otIs114 I; cog-1(ot155) II. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot155. Rollers. Animals look Dpy. |
| OH3645 | otIs114 I; lsy-6(ot149) V. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lsy-6 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH3646 | otIs114 I; lsy-6(ot150) V. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lsy-6 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH3679 | che-1(ot151) otIs114 I. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH3681 | otIs114 che-1(ot153) I. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH3682 | otIs114 I; lsy-12(ot154) V. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. 2 ASER. |
| OH3684 | otIs114 I; lsy-12(ot170) V. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers. Worms are slow growing. |
| OH3701 | otIs173 III. | C. elegans | otIs173 [F25B3.3::DsRed2 + ttx-3pB::GFP]. |
| OH3754 | otIs114 I; fozi-1(ot159) III. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER. |
| OH3890 | otIs114 I; ced-4(ot188) III. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers. |
| OH3895 | otIs114 I; die-1(ot198) II. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of die-1 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH3900 | otIs114 I; fozi-1(ot191) III. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER. |
| OH3902 | otIs114 I; cog-1(ot200) II. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot200. Rollers. |
| OH3903 | otIs114 I; cog-1(ot201) II. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot201. Rollers. |
| OH3923 | otIs114 I; ced-4(ot228) III. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers. |
| OH3926 | otIs114 I; nhr-67(ot136) IV. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Shows ASE asymmetry defects. Mildly temperature sensitive. Maintain at 25C. |
| OH3928 | otIs114 I; nhr-67(ot202) IV. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Mildly cold-sensitive; maintain at 25C. ASE asymmetry defects. |
| OH3955 | pha-1(e2123) III; otEx193. | C. elegans | otEx193[C09E7.3(oig-1)::GFP]. |
| OH3957 | otIs114 I; ced-4(ot248) III. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers. |
| OH3959 | otIs114 I; die-1(ot231) II. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of die-1 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH3962 | otIs114 I; fozi-1(ot236) III. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER. |
| OH3963 | otIs114 I; ced-4(ot238) III. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers. |
| OH3966 | otIs151; otEx2304. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2304 [gcy-11(prom1)::GFP + unc-122::GFP]. Expresses GFP in pharyngeal muscle. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH3972 | otIs151; otEx2310. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2310 [gcy-19(prom1)::GFP + unc-122::GFP]. Expresses GFP in IL2, faint in ASEL/R, and faint pairs in head. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH3976 | otIs151; otEx2314. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2314 [gcy-2(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASI, RIA, PVT and AWA. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH3992 | otIs151; otEx2322. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2322[gcy-14(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASEL, and dim GFP in ASER and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH3997 | otIs151; otEx2327. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2327 [gcy-20(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASEL, dim in ASER and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH4013 | otIs114 che-1(ot232) I. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH4025 | otIs114 I; nhr-67(ot190) IV. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Shows ASE asymmetry defects. |
| OH4027 | otIs114 I; fozi-1(ot234) III. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER. |
| OH4041 | ham-1(ot253) IV; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Missing or extra cells expressing dat-1::GFP. |
| OH4120 | rhIs4 III; wrk-1(ok695) X. | C. elegans | rhIs4 [glr-1p::GFP + dpy-20(+)] III. |
| OH4121 | juIs76 II; wrk-1(ok695) X. | C. elegans | juIs76 [unc-25p::GFP + lin-15(+)] II. |
| OH4124 | oyIs14 V; wrk-1(ok695) X. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. |
| OH4125 | evIs82b IV; wrk-1(ok695) X. | C. elegans | evIs82b [unc-129::GFP + dpy-20(+)] IV. |
| OH4127 | zdIs13 IV; oyIs14 V; wrk-1(ok695) X. | C. elegans | zdIs13 [tph-1p::GFP] IV. oyIs14 [sra-6::GFP + lin-15(+)] V. |
| OH4128 | juIs76 II; evIs82b IV. | C. elegans | juIs76 [unc-25p::GFP + lin-15(+)] II. evIs82b [unc-129::GFP + dpy-20(+)] IV. |
| OH4129 | jcIs1 IV; wrk-1(ok695) X. | C. elegans | jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91. |
| OH4130 | bwIs2 vab-1(dx31) II; wrk-1(ok695) X. | C. elegans | bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped. |
| OH4132 | vab-1(dx31) II; rhIs4 III; wrk-1(ok695) X. | C. elegans | rhIs4 [glr-1p::GFP + dpy-20(+)] III. |
| OH4133 | bwIs2 II; vab-1(dx31) II. | C. elegans | bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped. |
| OH4134 | otIs173 III; zdIs13 IV. | C. elegans | otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP] III. zdIs13 [tph-1p::GFP] IV. |
| OH4135 | otIs173 III; zdIs13 IV; wrk-1(ok695) X. | C. elegans | otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP]. zdIs13 [tph-1p::GFP] IV. |
| OH4136 | rhIs4 III; wrk-1(tm1099) X. | C. elegans | rhIs4 [glr-1p::GFP + dpy-20(+)] III. |
| OH4137 | bwIs2 II; wrk-1(tm1099) X. | C. elegans | bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped. |
| OH4138 | zdIs13 IV; wrk-1(tm1099) X. | C. elegans | zdIs13 [tph-1p::GFP] IV. |
| OH4139 | vab-1(dx31) II; oyIs14 V. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. |
| OH4140 | vab-1(dx31) II; oyIs14 V; wrk-1(ok695) X. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. |
| OH4141 | zdIs21 IV; wrk-1(ok695) X. | C. elegans | zdIs21 [zag-1::GFP] IV. |
| OH4142 | bwIs2 II; wrk-1(ok695) X. | C. elegans | bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped. |
| OH4143 | vab-1(dx31) II; zdIs13 IV. | C. elegans | zdIs13 [tph-1p::GFP] IV. |
| OH4144 | vab-1(dx31) II; zdIs13 IV; wrk-1(ok695) X. | C. elegans | zdIs13 [tph-1p::GFP] IV. |
| OH4147 | zdIs13 IV; wrk-1(ok695) X. | C. elegans | zdIs13 [tph-1p::GFP] IV. |
| OH4149 | wrk-1(tm1099) X. | C. elegans | |
| OH4158 | otIs151; otEx2409. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2409 [gcy-4(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASE, biased to right. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH4160 | otIs151; otEx2411. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2411[gcy-13(prom1)::GFP + unc-122::GFP]. Expresses GFP in RIM. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH4163 | otIs151; otEx2414. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2414 [gcy-17(prom1)::GFP + unc-122::GFP]. Expresses GFP in PHA. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH4165 | otIs151; otEx2416. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2416 [gcy-21(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASG and ADL(weak). Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH4168 | otIs151; otEx2419. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2419 [gcy-1(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASER, ASI, URX, PVT, and AIY. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH4172 | otIs151; otEx2423. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2423[gcy-3(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASER. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH4174 | otIs151; otEx2425. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2425 [gcy-25(prom1)::GFP + unc-122::GFP]. Expresses GFP in AQR, PQR, URX. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH4176 | otIs114 I; cog-1(ot242) II. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot242. |
| OH4177 | otIs114 I; ced-4(ot248) III. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers. |
| OH4224 | ham-1(ot257) IV; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP. |
| OH4226 | vtIs1 V; lin-32(ot259) X. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Fewer or extra cells expressing dat-1::GFP in various penetrances. |
| OH4240 | lin-17(ot260) I; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. PDEs often do not express dat-1::GFP. Whole genome sequenced strain. |
| OH4247 | vtIs1 V; dopy-6(ot263) X. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Missing or extra PDEs based on dat-1::GFP expression. Whole genome sequenced strain. |
| OH4254 | vtIs1 V; vab-3(ot266) X. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP. |
| OH4265 | lin-22(ot267) IV; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP in the V1 to V4 lineages. |
| OH4270 | lin-22(ot268) IV; vtIs1V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1 in the V1 to V4 lineages. Missense mutation (L68F) affecting a conserved leucine residue in the helix-loop-helix domain. |
| OH4271 | lin-22(ot269) IV; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)]. Rollers. Extra cells expressing dat-1::GFP in the V1 to V4 lineages. |
| OH4274 | ztf-6(ot271) I; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll well, but GFP expression is easily detected. Extra cells expressing dat-1::GFP. |
| OH4276 | ztf-6(ot273) I; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP. |
| OH4277 | ztf-6(ot274) I; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. More cells express dat-1::GFP. |
| OH4299 | vtIs1 V; vab-3(ot276) X. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP. |
| OH4303 | ztf-6(ot280) I; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP. Whole genome sequenced strain. |
| OH4305 | egl-1(ot282) vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP. Whole genome sequenced strain. |
| OH4306 | dopy-5(ot283)/+ III; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Homozygous ot283 animals are 100% sterile and variable CEP phenotype. Maintain by picking single animals that segregate Sterile worms (the sterility is easy to see by eye because the sterile worms do not produce eggs or oocytes). |
| OH4307 | dopy-5(ot284)/+ III; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Homozygous ot284 animals are 100% sterile and variable CEP phenotype. Maintain by picking single animals that segregate Sterile worms (the sterility is easy to see by eye because the sterile worms do not produce eggs or oocytes). |
| OH4309 | otIs151; otEx2491. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2491[gcy-29(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASE and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH4320 | lin-22(ot287) IV; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP in the V1 to V4 lineages. |
| OH4322 | ced-3(ot289) IV; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. The undead sisters of CEPvs and PVDs express dat-1::GFP. |
| OH4326 | pha-1(e2123) III; otEx239. | C. elegans | otEx239 [C53B7.1::GFP + pha-1(+)]. Maintain by picking GFP+. At 25C, only animals with the array should be alive. |
| OH4329 | lsy-6(ot71) dpy-11(e224) V; otEx2322. | C. elegans | otEx2322[gcy-14(prom1)::GFP + unc-122::GFP]. Faint ASE GFP expression (2 right). Expresses bright GFP in coelomocytes. Dpy. |
| OH4334 | dopy-5(ot296)/+ III; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Homozygous ot296 animals are 100% sterile and variable CEP phenotype. Maintain by picking single animals that segregate Sterile worms (the sterility is easy to see by eye because the sterile worms do not produce eggs or oocytes). |
| OH4335 | vtIs1 V; lin-32(ot297) X. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Missing CEPVs and PDEs; ADEs variably affected. |
| OH4339 | dopy-5(ot298)/+ III; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Homozygous ot298 animals are 100% sterile and variable CEP phenotype. Maintain by picking single animals that segregate Sterile worms (the sterility is easy to see by eye because the sterile worms do not produce eggs or oocytes). |
| OH4343 | otIs133 II; otEx2498. | C. elegans | otEx2498 [gcy-18(prom1)::GFP + rol-6(su1006)]. Expresses GFP in AFD and AIM. Maintain by picking GFP+ animals (which should also be Rollers). otIs133 [pttx-3::RFP + unc-4(+)]. RFP expressed in AIY only. |
| OH4346 | otIs151; otEx2501. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2501[gcy-23(prom1)::GFP + unc-122::GFP]. Expresses GFP in AFD. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH4348 | otEx2503. | C. elegans | otEx2503[gcy-27(prom1)::GFP + rol-6(su1006)]. Expresses GFP in ASK, ASI, ASJ. Maintain by picking GFP+ animals (which should also be Rollers). |
| OH4350 | otIs151; otEx2504. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2504 [gcy-28(prom1)::GFP + unc-122::GFP]. Expresses GFP in many head neurons, ventral cord and tail neurons, body wall muscle, hypodermis, somatic germline and intestine. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+. |
| OH438 | unc-4(e120) II; otIs117 IV. | C. elegans | otIs117 [unc-33p::GFP + unc-4(+)]. Pan-neuronal GFP. |
| OH439 | otIs118. | C. elegans | otIs118 [unc-33::GFP + unc-4(+)]. Pan-neural expression. Might still carry unc-4(e120) in background. |
| OH4397 | otIs151; lsy-6(ot71) dpy-11(e224) V; otEx2419. | C. elegans | otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2419 [gcy-(prom1)::GFP + unc-122::GFP]. Bilateral expression of GFP in ASE. Expresses bright GFP in coelomocytes. Rollers. Dpy. Maintain by picking GFP+. |
| OH4400 | lim-6(nr2073) X; otEx2322. | C. elegans | otEx2322 [gcy-14(prom1)::GFP + unc-122::GFP]. ASEL biased GFP expression. Expresses bright GFP in coelomocytes. |
| OH441 | otIs45 V. | C. elegans | otIs45 [unc-119::GFP]. Pan-neural expression. No injection marker. |
| OH443 | otEx304. | C. elegans | otEx304 [unc-75p::GFP + rol-6(su1006)]. 5kb upstream of promoter of unc-75 cloned into pPD95.75. Expressed pan neuronally. Pick Rollers to maintain. |
| OH4460 | otEx2572. | C. elegans | otEx2572 [unc-97::NLS::GFP]. GFP expressed strongly in muscle. Maintain by picking GFP+ animals. |
| OH4461 | lin-15B&lin-15A(n765); otEx2571. | C. elegans | otEx2571 [unc-97::GFP + lin-15(+)]. GFP strongly expressed in muscle. Maintain by picking GFP+, non-Muv animals. |
| OH4605 | unc-37(ot59)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); him-8(e1489) IV; otIs3 V. | C. elegans | otIs3 [gcy-7::GFP + lin-15(+)] V. Heterozygotes are WT and GFP+ in the pharynx. ot59 is homozygous inviable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. In WT animals, gcy-7::GFP expressed in ASEL. unc-37(ot59) mutants, otIs3 is expressed in both ASEL and ASER. |
| OH4609 | otEx2646. | C. elegans | otEx2646 [ceh-36::GFP::unc-54 3' UTR + rol-6(su1006)]. Maintain by picking Rollers. |
| OH4610 | otEx2647. | C. elegans | otEx2647 [ceh-36p2::GFP::cog-1 3'UTR + rol-6(su1006)]. |
| OH4617 | otEx2654. | C. elegans | otEx2654 [ceh-36p2::GFP::cog1 3' UTR + rol-6(su1006)]. |
| OH4768 | kyIs140 I; ttx-3(mg158) X. | C. elegans | kyIs140 [str-2::GFP + lin-15(+)] I. |
| OH4769 | ttx-3(mg158) X; nuIs11. | C. elegans | nuIs11 [osm-10::GFP + lin-15(+)]. Array contains pool28; KP#57-59 (osm-10::GFP insert at Nrul site) and pJM24 [lin-15(+) rescues n765 at 20C]. GFP expressed in ASH, ASI, PHA and PHB after 3-fold. nuIs11 may be inserted on LG I. |
| OH4770 | ttx-3(mg158) X; otIs24. | C. elegans | otIs24 [sre-1::GFP + dpy-20(+)]. |
| OH481 | otIs20. | C. elegans | otIs20 [zig-4::GFP + rol-6(su1006)]. Rollers. otIs20 does not mate. |
| OH4830 | otIs114 I; tax-4(ot35) III; him-5(e1490) V. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. |
| OH4836 | otIs7. | C. elegans | otIs7 [zig-2::GFP + rol-6(su1006)]. Expression variable. Whenever tail non-neuronal cells are on, then PVT is on; apparently more penetrant in adult. |
| OH4837 | lim-6(nr2073) X; otIs11. | C. elegans | otIs11 [zig-5::GFP + rol-6(su1006)]. Rollers. |
| OH4838 | otIs25. | C. elegans | otIs25 [zig-1::GFP + rol-6(su1006)]. |
| OH4839 | gcy-22(tm2364) V. | C. elegans | Reference: Ortiz CO, et al., Curr Biol. 2009 Jun 23;19(12):996-1004. |
| OH4840 | otIs85. | C. elegans | otIs85 [F59B2.13::GFP + rol-6(su1006)]. Rollers. Not constipated. |
| OH4841 | otIs92. | C. elegans | otIs92 [flp-10::GFP]. Derived by integration of ynEx2. |
| OH4844 | gcy-5(tm897) II. | C. elegans | No visible phenotype. Normal chemotaxis to ammonium chloride. |
| OH4887 | otIs182. | C. elegans | otIs182[inx-18::GFP]. |
| OH4974 | otIs114 I; lsy-12(ot89) V. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers. |
| OH6020 | otIs185. | C. elegans | otIs185 [ceh-36::GFP::cog-1 3' UTR + rol-6(su1006)]. Rollers. |
| OH6071 | trp-4(ot337) I; vtIs1 vsIs33 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer cells expressing dat-1::GFP. Whole genome sequenced strain. |
| OH6072 | vtIs1 vsIs33 V; lin-32(ot338) X. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Missing CEPVs and PDEs; ADEs variably affected. |
| OH6086 | ceh-43(ot345) III; vtIs1 vsIs33 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. CEPDs, ADEs and PDEs variably affected. Rollers. |
| OH6087 | ceh-43(ot340) III; vtIs1 vsIs33 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Few cells expressing dat-1::GFP. Whole genome sequenced strain. |
| OH610 | che-1(ot63) I; otIs3. | C. elegans | otIs3 [gcy-7::GFP + lin-15(+)]. che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. otIs3 was derived by integration of adEx1288 [gcy-7::GFP + lin-15(+)]. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37. |
| OH7007 | ham-1(ot342) IV; vtIs1 vsIs33 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer or extra cells expressing dat-1::GFP in various penetrances. |
| OH7008 | vtIs1 vsIs33 V; lin-32(ot343) X. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer or extra cells expressing dat-1::GFP in various penetrances. |
| OH7016 | ham-1(ot339) IV; vtIs1 vsIs33 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. CEP vells variably affected (sometimes fewer, sometimes more cells expressing GFP). |
| OH7058 | vtIs1 vsIs33 V; vab-3(ot346) X. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Extra cells expressing dat-1::GFP. |
| OH7061 | ref-2(ot327) X; otEx3091. | C. elegans | otEx3091[ref-2::ven + rol-6(su1006)]. ot327 is larval lethal. otEx3091 carries a ref-2::venus translational fusion and rescues the lethality. |
| OH707 | cog-1(ot38)/+ II; otIs114 I. | C. elegans | otIs114 [lim-6::GFP + rol-6(su1006)]. Rollers. Heterozygous strain. Heterozygotes should be fertile and segregate some sterile progeny. Maintain by picking plenty of animals with GFP in both ASEL and ASER; many of them will be sterile (homozygotes). otIs114 is normally expressed only in ASEL and excretory gland cell. Homozygous ot38; otIs114 is sterile and expresses GFP in both ASEL and ASER neurons. Heterozygotes display a semi-dominant, partially penetrant "ASEL + ASER" phenotype. |
| OH7074 | otIs173 III; ttx-3(ot355) X. | C. elegans | otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30. |
| OH7075 | otIs173 III; ttx-3(ot356) X. | C. elegans | otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30. |
| OH7076 | otIs173 III; ttx-3(ot357) X. | C. elegans | otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30. |
| OH7079 | otIs173 III; ttx-3(ot360) X. | C. elegans | otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30. |
| OH7095 | ham-1(ot361) IV; vtIs1 vsIs33 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. CEP vells variably affected (sometimes fewer, sometimes more cells expressing GFP). |
| OH7098 | ham-1(ot364) IV; vtIs1 vsIs33 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer or extra cells expressing dat-1::GFP in various penetrances. |
| OH7103 | otIs173 III; ttx-3(ot365) X. | C. elegans | otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30. |
| OH7115 | lsy-22(ot244) otIs114 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are Rollers and GFP+. Homozygous lsy-22(ot244) otIs114 animals are Rollers and have a maternal effect embryonic lethal phenotype. |
| OH7116 | lsy-22(ot114) unc-101(m1) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); otIs3 V. | C. elegans | otIs3 [gcy-7::GFP + lin-15(+)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are WT and GFP+. Homozygous lsy-22(ot114) unc-101(m1) animals are Unc and have a maternal effect embryonic lethal phenotype. Whole genome sequenced strain. |
| OH7118 | vtIs1 vsIs33 V; lin-32(ot366) X. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Missing CEPVs and PDEs; ADEs variably affected. |
| OH7150 | ham-1(ot371) IV; vtIs1 vsIs33 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. CEP vells variably affected (sometimes fewer, sometimes more cells expressing GFP). |
| OH7155 | otIs181 III; F19F10.1(tm456) V. | C. elegans | otIs181 [dat-1::mCherry + ttx-3::mCherry]. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889. |
| OH7158 | vtIs1 V; C52B9.2(tm413) X. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889. |
| OH7159 | C24A1.2(tm801) III; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889. |
| OH7160 | vtIs1 V; ets-5(tm866) X. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889. |
| OH7169 | C50A2.4(tm440) IV; vtIs1 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889. |
| OH7193 | otIs181 III; him-8(e1489) IV. | C. elegans | otIs181 [dat-1::mCherry + ttx-3::mCherry]. Him. Expression in DA neurons (ADE, PDE, CEP, male tail) and AIY. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889. |
| OH7202 | sax-7(ky146) IV; oyIs14 V; otEx3124. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx3124 [rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68. |
| OH7203 | sax-7(ky146) IV; oyIs14 V; otEx3125. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx3125 [rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68. |
| OH7204 | sax-7(ky146) IV; oyIs14 V; otEx3135. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx3135 [myo-3p::sax-7cDNA short + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68. |
| OH7213 | sax-7(ky146) IV; oyIs14 V; otEx3126. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx3126 [dpy-7p::sax-7cDNA long + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68. |
| OH7216 | sax-7(ky146) IV; oyIs14 V; otEx3140. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx3140 [unc-14p::sax-7cDNA long-delta11 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68. |
| OH7217 | sax-7(ky146) IV; oyIs14 V; otEx3141. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx3141 [unc-14p::sax-7cDNA long-delta11 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68. |
| OH7219 | sax-7(ky146) IV; oyIs14 V; otEx3139. | C. elegans | oyIs14 [sra-6::GFP + lin-15(+)]. otEx3139 [unc-14p::sax-7cDNA long + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68. |
| OH7235 | zdIs13 IV; otEx3154. | C. elegans | zdIs13 [tph-1p::GFP] IV. otEx3154 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 1. |
| OH7236 | zdIs13 IV; otEx3155. | C. elegans | zdIs13 [tph-1p::GFP] IV. otEx3155 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 2. |
| OH7237 | zdIs13 IV; otEx3156. | C. elegans | zdIs13 [tph-1p::GFP] IV. otEx3156 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 3. |
| OH7251 | zdIs13 IV; otEx3163. | C. elegans | zdIs13 [tph-1p::GFP] IV. otEx3163 [unc-120p::hif-1(p621A) + ttx-3::RFP]. Line 1. |
| OH7253 | zdIs13 IV; otEx3165. | C. elegans | zdIs13 [tph-1p::GFP] IV. otEx3165 [unc-120p::hif-1(p621A) + ttx-3::RFP]. Line 3. |
| OH7260 | zdIs13 IV; otEx3168. | C. elegans | zdIs13 [tph-1p::GFP] IV. otEx3168 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 1. |
| OH7261 | zdIs13 IV; otEx3169. | C. elegans | zdIs13 [tph-1p::GFP] IV. otEx3169 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 2. |
| OH7262 | zdIs13 IV; otEx3170. | C. elegans | zdIs13 [tph-1p::GFP] IV. otEx3170 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 3. |
| OH7310 | otIs193 syIs63 IV. | C. elegans | otIs193 [cog-1p::lsy-6hp + rol-6(su1006)]; derived from otEx1450. syIs63 [cog-1::GFP + unc-119(+)]. Egl. Pvul. |
| OH7317 | F21H12.1(ot86) rol-6(e187) II; ntIs1 V. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. Ectopic expression of ntIs1 in ASEL. Rollers. Whole genome sequenced strain. |
| OH7323 | ceh-43(ot406) III; vtIs1 vsIs33 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer or extra cells expressing dat-1::GFP. |
| OH7410 | unc-37(ot37) otIs114 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. |
| OH750 | otEx427. | C. elegans | otEx427 [hst-6p::GFP + rol-6(su1006)]. Transcriptional hst-6::GFP fusion. Maintain by picking Rollers. |
| OH7511 | otIs197. | C. elegans | otIs197 [unc-14p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. |
| OH7546 | vtIs1 V; otIs198. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. otIs198 [hsp16-2::ast-1 + ttx-3::DsRed + hsp16-2::NLS::mCherry]. Rollers. Heat shock induces expression of nuclear mCherry and AST-1. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889. |
| OH7547 | otIs199. | C. elegans | otIs199 [cat-2::GFP + rgef-1(F25B3.3)::DsRed + rol-6(su1006)]. Rollers. GFP expressed in dopaminergic neurons and dsRed expressed pan-neuronally. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889. |
| OH7566 | mgIs18 unc-24(e138) nhr-67(ot407) IV; ntIs1 V; otEx3103. | C. elegans | mgIs18 [ttx-3p::GFP] IV. ntIs1 [gcy-5p::GFP + lin-15(+)] V. otEx3103 [elt-2::GFP]. All worms have mgIs18 and ntIs1. mgIs18 labels AIY interneurons. ntIs1 marks one GFP+ neuron (ASER) in the head. otEx3103 [elt-2::GFP] is expressed in intestinal cells; maintain by picking animals with intestinal GFP. Worms that have lost the array are Emb, Lvl, and have an ASE defect. |
| OH7631 | nhr-67(ok631) IV; otEx3362. | C. elegans | otEx3362 [nhr-67(fosmid)::mCherry + elt-2::GFP]. Pick GFP+ to maintain. otEx3362 rescues nhr-67(ok631). |
| OH7677 | lin-59(ot104) I; lsy-12(ot563) ntIs1 V. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. Whole genome sequenced strain. |
| OH7687 | otEx3401. | C. elegans | otEx3401 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 1. Pick Rollers. |
| OH7688 | otEx3402. | C. elegans | otEx3402 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 2. Pick Rollers. |
| OH7689 | otEx3403. | C. elegans | otEx3403 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 3. Pick Rollers. |
| OH7690 | otEx3398. | C. elegans | otEx3398 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 1. Pick Rollers. |
| OH7691 | otEx3399. | C. elegans | otEx3399 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 2. Pick Rollers. |
| OH7692 | otEx3400. | C. elegans | otEx3400 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 3. Pick Rollers. |
| OH7726 | otIs114 I; nhr-67(ot158) IV. | C. elegans | otIs114 contains [lim-6p::GFP + rol-6(su1006)]. Rollers. |
| OH775 | eno-4(ot4) II; oxIs12 X. | C. elegans | oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
| OH7805 | otIs204. | C. elegans | otIs204 [ceh-36p2::lsy-6 + elt-2p::GFP]. Reference: Poole RJ, et al. PLoS Genet. 2011 June; 7(6): e1002109. |
| OH7917 | ast-1(ot417) II; otIs199. | C. elegans | otIs199 [cat-2::GFP + rgef-1(F25B3.3)::DsRed + rol-6(su1006)]. Rollers. No cat-2::GFP expression in DA neurons (CEP, ADE, PDE). Maintain under normal conditions. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889. |
| OH8 | ttx-3(mg158) X. | C. elegans | Thermotaxis defective (cryophilic); strong loss of function. |
| OH8001 | otIs114 I; lsy-12(ot177) V. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers. Whole genome sequenced strain. |
| OH8014 | zdIs13 IV; otEx3567. | C. elegans | zdIs13 [tph-1p::GFP] IV. otEx3567 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 1. |
| OH8015 | zdIs13 IV; otEx3568. | C. elegans | zdIs13 [tph-1p::GFP] IV. otEx3568 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 2. |
| OH8016 | zdIs13 IV; otEx3569. | C. elegans | zdIs13 [tph-1p::GFP] IV. otEx3569 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 3. |
| OH812 | otIs114 I. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. |
| OH8249 | otIs224. | C. elegans | otIs224 [cat-1(2493bp)::GFP]. |
| OH8421 | dpy-11 lsy-20(ot219) unc-76 V. | C. elegans | Whole genome sequenced strain. |
| OH8480 | otIs221 III; him-8(e1489) IV. | C. elegans | otIs221 [cat-1::GFP]. GFP expression in monoaminergic neurons. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889. |
| OH8481 | otIs226 IV; him-5(e1490) V. | C. elegans | otIs226 [bas-1::GFP]. Expression in monoaminergic neurons. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889. |
| OH8545 | trp-4(ot477) I; vtIs1 vsIs33 V. | C. elegans | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Whole genome sequenced strain. |
| OH8585 | otIs4; otEx3822. | C. elegans | otIs4 [gcy-7::GFP]. otEx3822 [ceh-36::CZ-caspase3(p17) + gcy-7::caspase3(p12)-NZ + myo-3::mCherry]. |
| OH8593 | ntIs1 V; otEx3830. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. otEx3830 [ceh-36::CZ-caspase3(p17) + gcy-5::caspase3(p12)-NZ + myo-3::mCherry]. |
| OH8882 | otEx3909. | C. elegans | otEx3909 [ceh-36(fosmid)::YFP + rol-6(su1006)]. otEx3909 is a complex array derived from injection with PvuII-digested E. coli genomic DNA. ceh-36::YFP is broadly expressed in early stage embryos and becomes restricted to ASE and AWC later in development. Pick rollers to maintain. |
| OH898 | pha-1(e2123) III; otEx536. | C. elegans | otEx536 [ser-2(prom2)::GFP + pha-1(+)]. Maintain at 25C to select for transgenic animals. |
| OH8993 | otIs252. | C. elegans | otIs252 [lsy-6(fosmid)::YFP + rol-6(su1006)]. Rollers. YFP expression in ASEL. |
| OH9016 | ntIs1 V; lsy-2(ot90) X. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. Loss of ASEL fate. 2 cells GFP+ for ASER marker. |
| OH9019 | otIs4; otIs253. | C. elegans | otIs4 [gcy-7::GFP]. otIs253 [ceh-36::CZ-caspase3(p17) + gcy-7::caspase3(p12)-NZ + myo-3::mCherry]. |
| OH9022 | ntIs1 V; otIs256. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs256 [ceh-36::CZ-caspase3(p17) + gcy-7::caspase3(p12)-NZ + myo-3::mCherry]. |
| OH904 | otIs33 IV. | C. elegans | otIs33 [kal-1::GFP]. Transcriptional kal-1::GFP reporterd expressed in specific subset of neurons, including interneurons (e.g. AIY, AIZ), sensory neurons, motorneurons (e.g. HSN). Expression is also seen in non-neuronal tissues (e.g. spermatheca). |
| OH906 | otIs39 II. | C. elegans | otIs39 [unc-47(delta)::GFP + lin-15(+)]. Expressed in RMEL/R, AVL, RIS, DVB, PVT and unidentified amphid sensory neuron pair. |
| OH910 | otIs77 II. | C. elegans | otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. Overexpressing line from P. Loria. The integrated array has been mapped to LG II between stP36 and maP1. AIY interneurons have a 100% penetrant axon branching phenotype. Otherwise, the animals look phenotypically wild type. |
| OH911 | him-5(e1490) V; otIs35 X. | C. elegans | otIs35 [ttx-3p::kal-1 + rol-6(su1006)] X. otIs35 has been mapped to LG X between lon-2 and hst-6. Superficially wild-type; AIY interneurons have a 100% penetrant axon branching phenotype. |
| OH912 | otIs76 mgIs18 IV. | C. elegans | otIs76 [pttx-3p::kal-1 + unc-122p::GFP] IV. mgIs18 [ttx-3p::GFP] IV. otIs76 is closely linked to mgIs18 on LG IV. Superficially wild-type. AIY interneurons have a 100% penetrant axon branching phenotype. |
| OH9279 | otIs266. | C. elegans | otIs266 [cat-1p::mCherry]. A 2.5 kb upstream region of cat-1 ATG was cloned into pPD95.75 vector and GFP was replaced with mCherry. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8. |
| OH9294 | otIs274. | C. elegans | otIs274 [FOSMID::die-1::2xFLAG::VENUS]. 2 ASER. |
| OH9305 | unc-37(ot240) otIs114 I. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. Whole genome sequenced strain. |
| OH9330 | hlh-3(ot354) II; otIs173 III. | C. elegans | otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30. |
| OH9331 | ttx-3(ot358). | C. elegans | Whole genome sequenced strain. |
| OH9370 | otIs232; otEx4149. | C. elegans | otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. otEx4149 [cog-1(fosmid)::YFP + elt-2::DsRed]. Maintain by picking animals dsRed(+) in gut nuclei. Rollers. mCherry expression in ASER and ASEL. |
| OH9482 | lol-1(ot567); otIs138 X. | C. elegans | otIs138 [ser-2(prom3)::GFP + rol-6(su1006)] X. Integrated array derived from otEx449. Whole genome sequenced strain. |
| OH9545 | otIs287 IV. | C. elegans | otIs287 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] IV. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH96 | him-5(e1467) V; mgIs19 X. | C. elegans | Rollers. Throws males. mgIs19 [lim-4::GFP + rol-6(su1006)]. |
| OH9609 | otIs291 V. | C. elegans | otIs291 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] V. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. |
| OH9625 | otIs292. | C. elegans | otIs292 [eat-4::mCherry + rol-6(su1006)]. Rollers. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8. |
| OH9639 | ntIs1 V; him-8 IV; lim-6(ot146) X. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. 2 ASER. Him. |
| OH9668 | che-1(ot489) I; him-5(e1490) V. | C. elegans | |
| OH9671 | otIs114 I; lsy-27(ot108) II; otIs220 IV. | C. elegans | otIs220 [gcy-5::mCherry]. otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. 2 ASER. |
| OH9679 | otIs300. | C. elegans | otIs300 [8xASEmotif::GFP + elt-2::DsRed]. elt-2::DsRed prone to silencing; maintain by picking DsRed+. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8. |
| OH9729 | otIs302. | C. elegans | otIs302 [lsy-6::GFP (fosmid) + F25B3.3::DsRed2]; injected with bacterial DNA to form a complex array. otIs302 and otIs301 are different integrants of the same extrachromosomal array and behave similarly. Maintain at 15-20C. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8. |
| OH9838 | otIs232; otEx4359. | C. elegans | otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL. otEx4359 [die-1(prom8)::2NLS::YFP + elt-2::DsRed]. Pick animals with dsRed+ intestinal nuclei to maintain otEx4359. otEx4359 carries a minimal (1 kb) promoter driving 2NLS::YFP only in ASEL. |
| OH9846 | otIs305 ntIs1 V. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp16-2p::che-1::3xHA::BLRP + rol-6(su1006)] V; injected as complex array with Pvu II bacterial DNA. Rollers. Rol is prone to silencing in otIs305, but hsp transgene is still active in Hobert Lab assays. otIs305 is homozygous by PCR analysis (Hobert). Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8. |
| OH9882 | otEx4390. | C. elegans | otEx4390 [8xASE::GFP::cog-1 3'UTR + rol-6(su1006)]. Maintain by picking Rollers. |
| OH99 | mgIs18 IV. | C. elegans | mgIs18 [ttx-3p::GFP] IV. ttx-3p::GFP labels AIY interneurons. |
| OH998 | otIs114 I; lin-49(ot78) IV; him-5 V. | C. elegans | otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. Him. 2 ASER. Whole genome sequenced strain. |
| OH9991 | otIs114 I; otIs220 IV; lsy-12(ot563) ntIs1 V. | C. elegans | ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs220 [gcy-5::mCherry]. otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. 2 ASER. |
| OH9995 | otIs313. | C. elegans | otIs313 [sem-2(fosmid)::YFP + rol-6(su1006)]. Rollers. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77. |
| PHX10278 | zfh-2(syb10278[zfh-2::GSGGSGGTGGSG::mIAA7::wrmScarlet-I3::mIAA7]) I. | C. elegans | Endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069. |
| PHX1048 | hdl-1(syb1048[hdl-1::gfp]) IV. | C. elegans | GFP tag inserted at the C-terminus of the endogenous hdl-1 locus by CRISPR/Cas9. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| PHX1551 | ceh-51(syb1551[ceh-51::GFP]) V. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-51 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX1587 | tab-1(syb1587[tab-1::GFP]) II. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous tab-1 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX1592 | ceh-5(syb1592[ceh-5::GFP]) I. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-5 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX1610 | ceh-92(syb1610[ceh-92::GFP]) III. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-92 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX1656 | ceh-8(syb1656[ceh-8::GFP]) I. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-8 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX1658 | unc-4(syb1658[unc-4::GFP]) II. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous unc-4 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX1679 | ttx-1(syb1679[ttx-1::GFP]) V. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ttx-1 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX1849 | ceh-23(syb1849[ceh-23::GFP)] III. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-23 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX1884 | ceh-75(syb1884[ceh-75::GFP]) V. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-75 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX1955 | ceh-87(syb1995[ceh-87::GFP]) II. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-87 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX2015 | ceh-58(syb2015[ceh-58::GFP]) II. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-58 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX2517 | ceh-86(syb2517[ceh-86::GFP::FLAG]) II. | C. elegans | Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-86 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
| PHX2575 | rsp-4(syb2575[rsp-4::GFP]) II. | C. elegans | GFP tag inserted into endogenous rsp-1 locus. Reference: Pham K, et al. Genetics. 2021 Mar 3;217(1):1-17. doi: 10.1093/genetics/iyaa016. PMID: 33683371. |
| PHX2587 | wac-1.1&wac-1.2(syb2587) I. | C. elegans | Superficially wild-type. Deletion removes of wac-1.1/Y40B1A.1 and wac-1.2/Y40B1A.3 (I:13344075 to 13358647, version WS276, PRJNA13758). |
| PHX2616 | ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X. | C. elegans | Endogenous ins-9 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| PHX2634 | flp-3(syb2634[flp-3::T2A::3XNLS::GFP]) X. | C. elegans | GFP tag inserted at the C-terminus of the endogenous flp-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Tekieli T. et al. Development. 2021 Sep 15;148(18):dev199687. doi: 10.1242/dev.199687. PMID: 34415309. |
| PHX2658 | flp-1(syb2658[flp-1::T2A::3XNLS::GFP]) IV. | C. elegans | GFP tag inserted at the C-terminus of the endogenous flp-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253. |
| PHX2685 | ins-6(syb2685[ins-6::T2A::3xNLS::GFP]) II. | C. elegans | Endogenous ins-6 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| PHX2704 | nlp-50(syb2704[nlp-50::T2A::3xNLS::GFP]) II. | C. elegans | Endogenous nlp-50 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| PHX2805 | nlp-51(syb2805 [nlp-51::T2A::3xNLS::GFP]) II. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253. |
| PHX2878 | ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. | C. elegans | T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous ric-4 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| PHX2880 | ceh-16(syb2709[loxP] syb2880[ceh-16::loxP::GFP]) III. | C. elegans | GFP tag inserted at the C-terminus of the endogenous ceh-16 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX2934 | ceh-37(syb2933[loxP]) ceh-36(syb2934[ceh36::loxP::GFP]) X. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX3072 | rab-3(syb3072[rab-3::T2A::3xNLS::GFP]) II. | C. elegans | T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous rab-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| PHX3112 | nlp-12(syb3112[nlp-12::T2A::3×NLS::GFP]) I. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3169 | flp-12(syb3169[flp-12::T2A::3xNLS::GFP]) X. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3172 | flp-25(syb3172[flp-25::T2A::3×NLS::GFP]) III. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3179 | nlp-10(syb3179[nlp-10::T2A::3×NLS::GFP]) III. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3184 | flp-17(syb3184[flp-17::T2A::3xNLS::GFP]) IV. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3186 | nlp-3 (syb3186 [nlp-3::T2A::3XNLS::GFP]) X. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nlp-3 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3187 | flp-10(syb3187[flp-10::T2A::3xNLS::GFP]) IV. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3191 | nlp-58(syb3191 [nlp-58::T2A::3xNLS::GFP]) V. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nlp-58 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX3193 | flp-18(syb3193[flp-18::T2A::3×NLS::GFP]) X. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3195 | flp-33(syb3195[flp-33::T2A::3xNLS::GFP]) I. | C elegans | GFP tag inserted into endogenous flp-33 locus using CRISPR/Cas9 engineering. GFP expression in ADE (in head). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095. |
| PHX3203 | flp-6 (syb3203 [flp-6::T2A::3XNLS::GFP]) V. | C. elegans | GFP tag inserted at the C-terminus of the endogenous flp-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX3207 | flp-28(syb3207[flp-28::T2A::3xNLS::GFP]) X. | C. elegans | Endogenous flp-28 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| PHX3208 | nlp-40(syb3208 [nlp-40::T2A::3XNLS::GFP]) I. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nlp-40 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3212 | flp-21(syb3212 [flp-21::T2A::3×NLS::GFP]) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX3222 | nlp-17(syb3222[nlp-17::T2A::3×NLS::GFP]) IV. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3229 | flp-9(syb3229[flp-9::T2A::3xNLS::GFP]) IV. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. |
| PHX3230 | flp-15(syb3230[flp-15::T2A::3xNLS::GFP]) III. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3238 | nlp-42(syb3238[nlp-42::T2A::3XNLS::GFP]) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX3240 | nlp-1(syb3240[nlp-1::T2A::3XNLS::GFP]) X. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3241 | flp-20 (syb3241 [flp-20::T2A::3xNLS::GFP]) X. | C. elegans | GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX3242 | flp-23(syb3242[flp-23::T2A::3xNLS::GFP]) III. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. |
| PHX3250 | capa-1(syb3250[capa-1::T2A::3xNLS::GFP]) X. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3251 | flp-16(syb3251[flp-16::T2A::3XNLS::GFP]) II. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3252 | unc-10(syb2898 syb3252[unc-10::T2A::3xNLS::GFP]) X. | C. elegans | T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous unc-10 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| PHX3257 | flp-34(syb3257[flp-34::T2A::3xNLS::GFP]) V. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3262 | nlp-47(syb3262[nlp-47::T2A::3XNLS::GFP]) IV. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3275 | pdf-2(syb3275[pdf-2::T2A::3xNLS::GFP]) X. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. pdf-2 also known as nlp-37. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3277 | flp-13 (syb3277 [flp-13::T2A::3XNLS::GFP]) IV. | C. elegans | GFP tag inserted at the C-terminus of the endogenous flp-13 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3278 | flp-19(syb3278 [flp-19::T2A::3xNLS::GFP]) X. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| PHX3285 | nlp-54(syb3285 [nlp-54::T2A::3xNLS::GFP]) IV. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nlp-54 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3288 | nlp-23(syb3288[nlp-23::T2A::3xNLS::GFP]) X. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3301 | flp-22(syb3301[flp-22::T2A::3xNLS::GFP]) I. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3306 | nlp-62(syb3306[nlp-62::T2A::3XNLS::GFP]) I. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nlp-62 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3317 | flp-11b(syb3317[flp-11b::T2A::3XNLS::GFP]) X | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. |
| PHX3319 | nlp-22(syb3319[nlp-22::T2A::3×NLS::GFP]) X. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3320 | nlp-49(syb3320[nlp-49::T2A::3XNLS::GFP]) X. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| PHX3321 | ntc-1(syb3321[ntc-1::T2A::3xNLS::GFP]) X. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3323 | flp-14(syb3323[flp-14::T2A::3xNLS::GFP]) III. | C. elegans | Endogenous flp-14 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| PHX3330 | pdf-1(syb3330[pdf-1::T2A::3xNLS::GFP]) III. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3334 | flp-24(syb3334[flp-24::T2A::3×NLS::GFP]) III. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3372 | rgba-1(syb3372[rgba-1::T2A::3xNLS::GFP]) I. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3373 | nlp-70(syb3373[nlp-70::T2A::3xNLS::GFP]) V. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3384 | nlp-64(syb3384[nlp-64::T2A::3xNLS::GFP]) X. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3388 | nlp-38(syb3388[nlp-38::T2A::3xNLS::GFP]) I. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3411 | nlp-13(syb3411[nlp-13::T2A::3xNLS::GFP]) V. | C. elegans | Endogenous nlp-13 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| PHX3426 | ceh-27(syb2714[loxP] syb3286[loxP] syb3426[ceh27::GFP]) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX3436 | flp-4(syb3436[flp-4::T2A::3XNLS::GFP]) II. | C. elegans | Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX3588 | flp-26(syb3588[flp-26::T2A::3xNLS::GFP]) X. | C. elegans | Endogenous flp-26 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. |
| PHX3596 | tph-1(mg280) pah-1(syb3596) II. | C. elegans | Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT. |
| PHX3601 | pah-1(syb3601) II. | C elegans | Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT. |
| PHX362 | vglu-2(syb362[vglu-2::gfp]) III. | C. elegans | GFP tag inserted into C-terminus of endogenous vglu-2 locus. Reference: Serrano-Saiz E, et al. Genetics. 2019 Nov 27. pii: genetics.302855.2019. PMID: 31776169 |
| PHX3634 | pah-1(syb3634[GFP::H2B::T2A::pah-1]) II. | C elegans | Superficially wild-type. GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9. |
| PHX3678 | tph-1(mg280) pah-1(syb3678[GFP::H2B::T2A::pah-1]) II. | C elegans | GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9. |
| PHX3936 | nlp-51(syb3936[nlp-51::SL2::GFP::H2B]) II. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933. |
| PHX4049 | flp-20(syb4049[flp-20::SL2::GFP::H2B]) X. | C. elegans | GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX4257 | eat-4(syb4257[eat-4::T2A::GFP::H2B]) III. | C. elegans | Endogenous eat-4 locus tagged with T2A::GFP::H2B. Healthy strain that has all glutamatergic neurons marked with GFP. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425 |
| PHX4373 | nova-1(syb4373[nova-1::GFP]) V. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nova-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| PHX4374 | flp-32(syb4374[flp-32::SL2::gfp::H2B]) X. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313. |
| PHX4376 | rbm-25(syb4376[rbm-25::GFP]) V. | C. elegans | GFP tag inserted at the C-terminus of the endogenous rbm-25 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| PHX4399 | nlp-82(syb4399[nlp-82::SL2::GFP::H2B]) II. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nlp-82 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX4406 | nlp-73(syb4406 [nlp-73::SL2::GFP::H2B]) V. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nlp-73 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX4413 | flp-27(syb4413 [flp-27::SL2::GFP::H2B]) II. | C. elegans | GFP tag inserted at the C-terminus of the endogenous flp-27 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933. |
| PHX4421 | trh-1(syb4421[trh-1::SL2::GFP::H2B]) IV. | C. elegans | CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425. |
| PHX4426 | ehs-1(syb4426[ehs-1::SL2::GFP::H2B]) II. | C. elegans | SL2::GFP::H2B tag inserted at the C-terminus of the endogenous ehs-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| PHX4430 | kcc-3(syb4430[kcc-3::SL2::TagRFP-T::H2B]) II. | C. elegans | Endogenous locus tagged with SL2::TagRFP-T::H2B at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| PHX4433 | npr-32 (syb4433 [npr-32::SL2::GFP::H2B] IV. | C. elegans | GFP tag inserted at the C-terminus of the endogenous npr-32 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX4440 | npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV. | C. elegans | GFP tag inserted at the C-terminus of the endogenous npr-37 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313. |
| PHX4442 | dmsr-6 (syb4442 [dmsr-6::SL2::GFP::H2B]) I. | C. elegans | GFP tag inserted at the C-terminus of the endogenous dmsr-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX4447 | aex-2(syb4447 [aex-2::SL2::GFP::H2B)] X. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313. |
| PHX4453 | trhr-1(syb4453[trhr-1::SL2::GFP::H2B]) I. | C. elegans | CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425. |
| PHX4454 | hmr-1(syb4454 [hmr-1::SL2::GFP::H2B]) I. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous hmr-1 locus. |
| PHX4476 | cdh-4(syb4476[cdh-4::SL2::GFP::H2B]) III. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-4 locus. |
| PHX4478 | egl-3(syb4478[egl-3::SL2::GFP::H2B]) V. | C. elegans | SL2::GFP::H2B tag inserted at the C-terminus of the endogenous elg-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| PHX4491 | unc-17(syb4491[unc-17::T2A::GFP::H2B]) IV. | C. elegans | CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4502 | ser-7(syb4502[ser-7::SL2::GFP::H2B]) X. | C. elegans | CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4512 | nlp-69(syb4512[nlp-69::SL2::gfp::H2B]) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| PHX4513 | flp-5(syb4513[flp-5::SL2::GFP::H2B]) X. | C. elegans | CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425. |
| PHX4514 | dmsr-2(syb4514 [dmsr-2::SL2::gfp::H2B]) I. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313. |
| PHX4517 | nmur-2(syb4517 [nmur-2::SL2::GFP::H2B)] II. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nmur-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX4523 | frpr-19(syb4523[frpr19::SL2::GFP::H2B]) IV. | C. elegans | GFP tag inserted at the C-terminus of the endogenous frpr-19 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX4537 | unc-39(syb4537[unc-39::gfp]) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| PHX4563 | fmi-1(syb4563)[fmi-1::SL2::GFP::H2B]) V. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous fmi-1 locus. |
| PHX4595 | tkr-1 (syb4595 [tkr-1::SL2::GFP::H2B]) III. | C. elegans | GFP tag inserted at the C-terminus of the endogenous tkr-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX4677 | kin-36(syb4677[GFP::HIS::SL2::kin-36]) IV. | C. elegans | CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4678 | ceh-30(syb4678[ceh-30::GFP]) X. | C. elegans | GFP tag inserted at the C-terminus of the endogenous ceh-30 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX4693 | che-7(syb4693[che-7::SL2::gfp::H2B]) V. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| PHX4729 | rig-6(syb4729[rig-6::SL2::GFP::H2B]) II. | C. elegans | CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4763 | rig-3(syb4763[rig-3::SL2::GFP::H2B]) X. | C. elegans | CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4799 | ceh-38(syb4799[ceh-38::GFP]) II. | C. elegans | GFP tag inserted at the C-terminus of the endogenous ceh-38 locus by CRISPR. Allele generated by SUNY Biotech. |
| PHX4861 | gpla-1(syb4861[flr-2::SL2::GFP::H2B]) V. | C. elegans | CRISPR/Cas9-engineered reporter allele. gpla-1 formerly known as flr-2. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4895 | htrl-1(syb4895[htrl-1::SL2::GFP::H2B]) V. | C. elegans | CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4901 | ceh-41(syb4901[ceh-41::GFP]) X. | C. elegans | GFP tag inserted at the C-terminus of the endogenous ceh-41 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| PHX5073 | ceh-43(syb5073[ceh-43::SL2::GFP::H2B]) III. | C elegans | GFP tag inserted into endogenous ceh-43 locus using CRISPR/Cas9 engineering. GFP expression in IL1, CEP, AIN, AIZ, ASJ, ADE, BDU, SDQ, PDE, PVQ, and possibly glia. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095. |
| PHX5218 | cest-4(syb5218[cest-4::SL2::GFP::H2B]) IV. | C elegans | GFP tag inserted into endogenous cest-4 locus by CRISPR/Cas9. |
| PHX5229 | degl-2(syb5229[degl-2::SL2::gfp::H2B]) IV. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. |
| PHX5349 | tpan-1(syb5349[tpan-1::GFP]) V. | C. elegans | GFP tag inserted at the C-terminus of the endogenous tpan-1 locus by CRISPR. Allele generated by SUNY Biotech. |
| PHX5400 | golg-5(syb5400[golg-5::wrmScarlet]) I. | C. elegans | wrmScarlet tag inserted at the C-terminus of the endogenous golg-5 locus by CRISPR. Broad punctate expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5413 | flp-7(syb5413[flp-7::SL2::GFP::H2B]) X. | C. elegans | Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5424 | ins-7(syb5424[ins-7::SL2::GFP::his-44]) IV. | C. elegans | SL2::GFP::HIS-44 tag inserted into the endogenous ins-7 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| PHX5437 | cone-1(syb5437[gfp::cone-1]) III. | C elegans | GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. [NOTE: Previously described as ceh-44(syb5437[gfp::ceh-44]) III. ceh-44 and cone-1 are located in the same locus and may share many exons, but are two separate genes with different functions and expression patterns. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5452 | ins-1(syb5452[ins-1::SL2::gfp::H2B]) IV. | C. elegans | CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| PHX5462 | ins-18(syb5462[ins-18::SL2::GFP::his-44]) I. | C. elegans | SL2::GFP::HIS-44 tag inserted into the endogenous ins-18 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| PHX5500 | ceh-44(syb5500[ceh-44::oxGFP]) III. | C elegans | oxGFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5536 | ins-9(syb5536[ins-9::SL2::gfp::H2B]) X. | C. elegans | GFP tag inserted at the C-terminus of the endogenous ins-9 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX5561 | ins-33(syb5561[ins-33::SL2::gfp::his-44]) I. | C. elegans | SL2::GFP::HIS-44 tag inserted into the endogenous ins-33 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| PHX5697 | nlp-2(syb5697 [nlp-2::SL2::GFP::H2B]) X. | C. elegans | GFP tag inserted at the C-terminus of the endogenous nlp-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933. |
| PHX5755 | pha-4(syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG] *ot1078 *ot946) V. | C. elegans | Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID* after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5804 | egl-3(syb5804[flag::NLS::Cre::SL2::egl-3]) V. | C. elegans | Cre inserted into the endogenous egl-3 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5843 | ceh-44(syb5843[ceh-44::gfp(exon8)]) III. | C elegans | GFP tag inserted at the N-terminus of the endogenous ceh-44 locus by CRISPR. Pan-neuronal nuclear expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5859 | ceh-48(syb5859[flag::NLS::Cre::SL2::ceh-48]) IV. | C. elegans | Cre inserted into the endogenous ceh-48 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5923 | bas-1(syb5923[bas-1::SL2::GFP::H2B]) III. | C elegans | GFP tag inserted into endogenous bas-1 locus by CRISPR/Cas9. |
| PHX6078 | hlh-32(syb6078[hlh-32::GFP]) IV. | C. elegans | Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| PHX6112 | hlh-31(syb6112[hlh-31::GFP]) IV. | C. elegans | Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| PHX6123 | T07A9.10(syb6123[T07A9.10::SL2::GFP::H2B) IV. | C. elegans | GFP tag inserted at the C-terminus of the endogenous T07A9.10 locus by CRISPR. Punctate ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6153 | latd-1(syb6153[latd-1::GFP) X. | C. elegans | C39D10.6. GFP tag inserted at the C-terminus of the endogenous latd-1 locus by CRISPR. Punctate GFP expression in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6236 | ins-35(syb6236[ins-35::SL2::GFP::his-44]) V. | C. elegans | SL2::GFP::HIS-44 tag inserted into the endogenous ins-35 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| PHX6281 | ceh-44(syb6281[ceh-44::gfp(exon7)]) III. | C elegans | GFP tag inserted at exon 7 of the endogenous ceh-44 locus by CRISPR. Nuclear pan-neuronal nuclear and broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6303 | hlh-17(syb6303[hlh-17::GFP]) IV. | C. elegans | Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| PHX6304 | syx-3(syb6304[syx-3::SL2::GFP::H2B]) X. | C. elegans | GFP tag inserted at the C-terminus of the endogenous syx-3 locus by CRISPR. Ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6325 | unc-13(syb6325[unc-13::SL2::GFP::H2B) I. | C. elegans | GFP tag inserted at the C-terminus of the endogenous unc-13 locus by CRISPR. Nuclear neuronal and hypodermal expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6345 | W02D7.3(syb6345[GFP::W02D7.3]) V. | C. elegans | GFP tag inserted at the N-terminus of the endogenous W02D7.3 locus by CRISPR. Expression of GFP in pharynx, excretory gland cell, and some additional cells in the head. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6377 | uncp-18(syb6377) IV. | C.elegans | T07A9.10. syb6377 deletion removes all but exon 1 and part of exon 2 of uncp-18 locus. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6394 | Y71G12B.26(syb6394[Y71G12B.26::GFP]) I. | C. elegans | GFP tag inserted at the C-terminus of the endogenous Y71G12B.26 locus by CRISPR. Expression of GFP in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6451 | tph-1(syb6451[tph-1::SL2::GFP::H2B]) II. | C. elegans | Endogenous tph-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| PHX6466 | F36D1.23(syb6466[F36D1.23::tagRFP]) I. | C. elegans | tagRFP tag inserted at the C-terminus of the endogenous F36D1.23 locus by CRISPR. Strong and specific expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6486 | cat-1(syb6486[cat-1::SL2::GFP::H2B]) X. | C. elegans | Endogenous cat-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| PHX6499 | unc-75(syb6499[gfp::unc-75]) I. | C elegans | GFP tag inserted at the N-terminus of the endogenous unc-75 locus by CRISPR. Pan-neuronal nuclear expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6541 | spex-2(syb6541[spex-2::SL2::GFP]) I. | C. elegans | GFP tag inserted at the C-terminus of the endogenous spex-2/F36D1.7 locus by CRISPR. Expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6547 | golg-4(syb6547[wrmScarlet::golg-4]) III. | C elegans | wrmScarlet tag inserted at the N-terminus of the endogenous golg-4 locus by CRISPR. Broad punctate wrmScarlet expression. Allele generated by SUNY Biotech. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170. |
| PHX6635 | hlh-17 hlh-31(syb6635) IV. | C. elegans | CRISPR/Cas9-engineered 5421 bp deletion entirely removing both hlh-17 and hlh-31. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| PHX6640 | cdh-5(syb6640[cdh-5::GFP]) IV. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-5 locus. |
| PHX6670 | spig-2(syb6670[spig-2::SL2::GFP::H2B]) V. | C. elegans | SL2::GFP::H2B cassette inserted directly before the stop codon of the endogenous spig-2 locus. spig-2 also known as txt-17 or F20A1.10. Reference: Aguilar GR & Hobert O. (2024). A protocol to transform a fluorescent reporter from a nuclear to a cytoplasmic location. microPublication Biology. https://doi.org/10.17912/micropub.biology.000954 |
| PHX6680 | golg-2(syb6680[wrmScarlet::golg-2]) II. | C elegans | wrmScarlet tag inserted at the N-terminus of the endogenous golg-2 locus by CRISPR. Broad punctate wrmScarlet expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6739 | unc-64(syb6739[unc-64::SL2::GFP::H2B) III. | C.elegans | GFP tag inserted at the C-terminus of the endogenous unc-64 locus by CRISPR. Ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6764 | cdh-4(syb6764[cdh-4::GFP]) III. | C. elegans | SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-4 locus. |
| PHX6773 | hlh-17 hlh-31(syb6635) hlh-32(syb6773) IV. | C. elegans | Triple mutant for hlh-17, hlh-31, and hlh-32. CRISPR/Cas9-engineered 1691 bp deletion of the entire hlh-32 locus in hlh-17 hlh-31(syb6635) double mutant parental strain. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| PHX679 | vglu-3(syb679[vglu-3::gfp]) III. | C. elegans | GFP tag inserted at C-terminus endogenous vglu-3 locus. Reference: Serrano-Saiz E, et al. Genetics. 2019 Nov 27. pii: genetics.302855.2019. PMID: 31776169 |
| PHX6898 | cone-1(syb6898 [cone-1::T2A::GFP::H2B]) III. | C elegans | GFP tag inserted at C-terminus of endogenous cone-1 locus by CRISPR. Broad nuclear GFP expression in non-neuronal cells. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX7278 | unc-46(syb7278[unc-46::SL2::GFP::H2B]) V. | C. elegans | Endogenous unc-46 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| PHX7290 | snf-3(syb7290[snf-3::tagRFP::SL2::GFP::H2B]) II. | C. elegans | Endogenous snf-3 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| PHX7352 | nlp-29(syb7352[nlp-29::SL2::GFP::H2B]) V. | C. elegans | Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX7377 | nlp-7b(syb7377[nlp-7b::SL2::GFP::H2B]) X. | C. elegans | Endogenous nlp-7 locus (B-isoform) tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX7380 | cone-1(syb7380[wrmScarlet::cone-1]) III. | C. elegans | Broad puncate expression in non-neuronal cells, later expression initiatiated ~1.5-2 fold stage. wrmScarlet tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX7394 | nlp-36(syb7394[nlp-36::SL2::GFP::H2B]) III. | C. elegans | Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX7422 | nlp-39(syb7422[nlp-39::SL2::GFP::H2B]) I. | C. elegans | Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX7428 | nlp-15(syb7428[nlp-15::SL2::GFP::H2B]) I. | C. elegans | Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX7529 | ceh-44(syb7529[ceh-44(exon 4)::GFP]) III. | C. elegans | GFP tag inserted in exon 4 of endogenous ceh-44 locus. Broad, weak, punctate GFP expression in non-neuronal cells. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX7537 | nlp-20(syb7537[nlp-20::SL2::GFP::H2B]) IV. | C. elegans | Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX7564 | nlp-79(syb7564[nlp-79::SL2::GFP::H2B]) IV. | C. elegans | Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX7566 | unc-47(syb7566[unc-47::SL2::GFP::H2B]) III. | C. elegans | Endogenous unc-47 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| PHX7685 | hlh-13(syb7685 [hlh-13::GFP]) X. | C. elegans | Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| PHX7688 | hlh-15(syb7688 [hlh-15::GFP]) X. | C. elegans | Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| PHX7768 | tdc-1(syb7768[GFP::linker::H2B::T2A::tdc-1]) II. | C. elegans | Endogenous tdc-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| PHX7786 | tbh-1(syb7786[tbh-1::SL2::GFP::H2B]) X. | C. elegans | Endogenous tbh-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| PHX8255 | cat-2(syb8255[cat-2::SL2::GFP::H2B]) II. | C. elegans | Endogenous cat-2 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| PHX8612 | bcat-1(syb8612[bcat-1::SL2::GFP::H2B]) X. | C. elegans | Endogenous locus tagged with SL2::GFP::H2B at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
| PHX8870 | oct-1(syb8870[oct-1::SL2::GFP::H2B]) I. | C. elegans | Endogenous oct-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| PHX9045 | degt-1(syb9045[degt-1::SL2::GFP::H2B]) V. | C. elegans | SL2::GFP::H2B tag inserted at the C-terminus of the endogenous degt-1 locus. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2 |
| PHX9810 | btbz-2(syb9810[btbz-2::GFP]) II. | C. elegans | GFP tag inserted at C-terminus of endogenous btbz-2 locus. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
| TU2589 | dpy-20(e1282) IV; uIs25 X. | C. elegans | uIs25 [mec-18::GFP + dpy-20(+)]. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| ot406 | Allele | ||
| ot9 | Allele | ||
| ot22 | Allele | substitution | nonsense |
| ot71 | Allele | deletion | |
| ot108 | Allele | substitution | |
| ot1 | Allele | substitution | |
| ot28 | Allele | substitution | |
| ot25 | Allele | substitution | |
| ot17 | Allele | substitution | |
| ot19 | Allele | substitution | |
| ot26 | Allele | substitution | nonsense |
| ot2 | Allele | ||
| ot3 | Allele | ||
| ot6 | Allele | ||
| ot40 | Allele | ||
| ot7 | Allele | ||
| ot8 | Allele | ||
| ot101 | Allele | substitution | |
| ot64 | Allele | substitution | nonsense |
| ot119 | Allele | substitution | |
| ot123 | Allele | deletion | |
| ot124 | Allele | substitution | |
| ot155 | Allele | substitution | |
| ot149 | Allele | substitution | |
| ot150 | Allele | substitution | |
| ot151 | Allele | substitution | nonsense |
| ot153 | Allele | substitution | |
| ot154 | Allele | substitution | nonsense |
| ot170 | Allele | substitution | nonsense |
| ot159 | Allele | substitution | splice_site |
| ot188 | Allele | substitution | |
| ot198 | Allele | substitution | |
| ot191 | Allele | substitution | nonsense |
| ot200 | Allele | substitution | |
| ot201 | Allele | substitution | |
| ot228 | Allele | substitution | nonsense |
| ot136 | Allele | substitution | splice_site |
| ot202 | Allele | substitution | splice_site |
| ot248 | Allele | substitution | |
| ot231 | Allele | substitution | nonsense |
| ot236 | Allele | substitution | |
| ot238 | Allele | ||
| ot232 | Allele | substitution | |
| ot190 | Allele | substitution | |
| ot234 | Allele | substitution | |
| ot253 | Allele | ||
| ot242 | Allele | substitution | splice_site |
| ot257 | Allele | ||
| ot259 | Allele | ||
| ot266 | Allele | substitution | nonsense |
| ot267 | Allele | ||
| ot269 | Allele | ||
| ot271 | Allele | ||
| ot273 | Allele | ||
| ot274 | Allele | ||
| ot276 | Allele | ||
| ot282 | Allele | ||
| ot283 | Allele | ||
| ot284 | Allele | ||
| ot287 | Allele | ||
| ot289 | Allele | ||
| ot296 | Allele | ||
| ot297 | Allele | ||
| ot298 | Allele | ||
| ot59 | Allele | ||
| ot35 | Allele | substitution | |
| ot89 | Allele | ||
| ot338 | Allele | ||
| ot345 | Allele | ||
| ot342 | Allele | ||
| ot343 | Allele | ||
| ot339 | Allele | ||
| ot346 | Allele | ||
| ot327 | Allele | substitution | |
| ot38 | Allele | substitution | |
| ot355 | Allele | substitution | splice_site |
| ot356 | Allele | substitution | |
| ot357 | Allele | substitution | nonsense |
| ot360 | Allele | substitution | splice_site |
| ot361 | Allele | ||
| ot364 | Allele | ||
| ot365 | Allele | substitution | splice_site |
| ot244 | Allele | ||
| ot366 | Allele | ||
| ot371 | Allele | ||
| ot37 | Allele | ||
| ot407 | Allele | substitution | |
| ot158 | Allele | substitution | |
| ot4 | Allele | ||
| ot417 | Allele | substitution | |
| ot90 | Allele | substitution | |
| ot146 | Allele | substitution | |
| ot78 | Allele | substitution | splice_site |
| ot563 | Allele | substitution |