Laboratory Information

NameOH View on WormBase
Allele designationot
HeadOliver Hobert
InstitutionColumbia University, New York, NY
Address 1212 Amsterdam Ave.
Mail Code: 2431
Fairchild Bldg. Rm 805
New York 10027
United States
Website http://hobertlab.org/
Gene classes acly  aexr  anat  anmt  arid  best  camt  cnih  cof  comt  cpd  dmsr  dop  dopy 
dpff  dpt  drap  egas  elk  eno  exl  eyg  fozi  frpr  gipc  glna  gmeb  gmps  gopc 
gras  hat  homt  hse  igdb  igeg  iglr  irld  josd  lol  lsl  lsy  lurp  maf  magu 
men  nap  neto  nfx  npax  oig  pin  psmd  secr  sipa  srq  sssh  suds  sul  svop 
tmc  trpl  ubql  vglu  vnut  wrk  zhit  zig  alfa  bnc  fezf  hasp  hinf  lmd  peli 
piez  row  slc  trak  pals  vpat  nova  slrp  sgnh  pno  lido  wac 

Strains contributed by this laboratory

Strain Genotype Species Description
BFF40 mjIs134 II; meg-3(tm4259) meg-4(ax2026) X. C. elegans mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Germ granule defective. ~30% sterility, maintain by picking gravid adults with visible embryos. Nuclear GFP expression in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614
BFF48 mjIs134 II; hrde-1(tm1200) III. C. elegans mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, Mortal germline (Mrt) at 25C. Expressing nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614
BFF49 mjIs134 II; hrde-1(tm1200) III; meg-3(tm4259);meg-4(ax2026) X. C. elegans mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, germ granule defective, high sterility. Expresses nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614
BFF53 bqSi577 IV. C elegans bqSi577 [myo-2p::GFP + unc-119(+)] IV. Expresses GFP in pharyngeal muscles. Single-copy insertion in the MosSCI locus cxTi10882 on chromosome IV. Obtained via the outcrossing of strain BN578 with N2. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.
BFF57 srd-1(eh1) II; bqSi577 IV; meg-3(tm4259) meg-4(ax2026) X. C. elegans bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germline granules defective, ~30% sterility. Males fail to be attracted by hermaphrodite-secreted volatile sex pheromones. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343
BFF70 bqSi577 IV; meg-3(tm4259) meg-4(ax2026) X. C. elegans bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germ granule defective, ~30 sterility. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343
DA1519 lin-15B&lin-15A(n765) X; adEx1519. C. elegans adEx1519 [M03F4.3::GFP + lin-15(+)]. Putative serotonin receptor. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1616 lin-15B&lin-15A(n765) X; adEx1616. C. elegans adEx1616 [ser-4::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1641 lin-15B&lin-15A(n765) X; adEx1641. C. elegans adEx1641 [C09B7.1::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1644 lin-15B&lin-15A(n765) X; adEx1644. C. elegans adEx1644 [K02F2.6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1646 lin-15B&lin-15A(n765) X; adEx1646. C. elegans adEx1646 [T02E9.3::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1647 lin-15B&lin-15A(n765) X; adEx1647. C. elegans adEx1647 [dop-1(trans)::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1648 lin-15B&lin-15A(n765) X; adEx1648. C. elegans adEx1648 [F01E11.5::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1649 lin-15B&lin-15A(n765) X; adEx1649. C. elegans adEx1649 [F14D12.6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
EK123 cmEx6. C. elegans cmEx6 [(pBR126) mbk-2p::GFP + rol-6(su1006)]. Maintain by picking Rollers.
EK224 cmIs6 I; unc-4(e120) II. C. elegans cmIs6 [mbk-1::GFP + unc-4(+)]. Reference: Raich WB, et al. Genetics. 2003 Feb;163(2):571-80. doi: 10.1093/genetics/163.2.571. PMID: 12618396.
GS10011 arTi479 [unc-47p::cre::unc-54 3'UTR] I. C. elegans miniMOS insertion expressing cre recombinase specifically in GABAergic neurons. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
JN1194 gcy-14(pe1102) V. C. elegans Reference: Ortiz CO, et al., Curr Biol. 2009 Jun 23;19(12):996-1004.
MOS284 dmd-10(ety5) V. C. elegans CRIPSR/Cas9-engineered dmd-10 null mutant. Generated in N2 background. crRNA1: ATTCTTAAATTGATACAGAA. crRNA2: GGAAACGTGGATAGTTTGAG. ssODN: TAACTTCCAAACCTTCGAAATTCTTAAATTGATACAACTATCCACGTTTCCACCCACCACTTCATCTTAC. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
MT1191 exc-4(n561) I. C. elegans Exc canal outgrowth abnormal.
NIC203 Caenorhabditis tropicalis wild isolate. C. tropicalis Caenorhabditis tropicalis wild isolate. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
NW1229 dpy-20(e1362) IV; evIs111. C. elegans evIs111 [F25B3.3::GFP + dpy-20(+)]. Pan-neural expression.
OH1003 eno-9(ot9) oxIs12 X. C. elegans oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
OH10050 otIs317. C. elegans otIs317 [mgl-1::mCherry + pha-1(+)].
OH10051 unc-119(ed3) III; sox-2(ot640[unc-119(+)])/+ X. C. elegans ot640 was generated by using MosDel removing the entire sox-2 locus and insert unc-119(+). Heterozygotes are WT and segregate WT heterozygotes, Uncs and ot640 homozygous that arrest in L1 with a pharynx unattached (Pun) phenotype. Maintain by picking WT and check for correct segregation of progeny to maintain. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.
OH10053 unc-119(ed3) III; sox-2(ot640[unc-119(+)]) X; otEx4454. C. elegans otEx4454 [sox-2(fosmid)::mCherry + elt-2p::DsRed]. ot640 was generated by using MosDel removing the entire sox-2 locus and insert unc-119(+). ot640 homozygous arrest in L1 with a pharynx unattached (Pun) phenotype. Maintain by picking WT to maintain (transgene should be required for viability). Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.
OH101 mgIs20. C. elegans mgIs20 [K03E6::GFP + rol-6(su1006)].
OH10101 otIs323. C. elegans otIs323 [cho-1p(SL2 bicistronic)::2xNLS::GFP + elt-2::DsRed2]. Fosmid-based reporter labels virtually all cholinergic neurons. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10221 ccIs4251 I; otIs77 II; ruIs37 III; jcIs1 IV; vsIs33 V. C. elegans ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. ruIs37 [myo-2p::GFP + unc-119(+)] III. jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. vsIs33 [dop-3::RFP] V. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.
OH10237 otIs326 X. C. elegans otIs326 [ins-1::GFP + rol-6(su1006)] X. Rollers.
OH10243 pha-1(e2123) III; otEx4548. C. elegans otEx4548 [tbb-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10247 pha-1(e2123) III; otEx4552. C. elegans otEx4552 [unc-11(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10248 pha-1(e2123) III; otEx4553. C. elegans otEx4553 [unc-64(fosmid; isoform B)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10250 pha-1(e2123) III; otEx4555. C. elegans otEx4555 [unc-104(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10252 pha-1(e2123) III; otEx4557. C. elegans otEx4557 [shn-1(fosmid)::SL2::NLS::YFP::H2B + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Nuclear YFP expression in muscle. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10255 pha-1(e2123) otIs314 III; otEx4560. C. elegans otIs314 [rab-3p(prom1)::2xNLS::TagRFP] III. otEx4560 tbb-5(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx4560. Broad neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10260 pha-1(e2123) III; otIs356 V; otEx4553. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx4553 [unc-64A(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx5924. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH103 mgIs21. C. elegans mgIs21 [lin-11(ABCDE)::GFP + rol-6(su1006)]. Rollers.
OH10330 otIs333 II. C. elegans otIs333 [sox-2(fosmid)::mCherry + rol-6(su1006)]. Rollers. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.
OH10331 otIs334. C. elegans otIs334 [sox-3(fosmid)::mCherry + rol-6(su1006)]. Rollers. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.
OH10425 otIs337. C. elegans otIs337 [unc-86(fosmid)::NLS:::YFP::H2B + ttx-3::mCherry].
OH10434 otIs232. C. elegans otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL.
OH105 mgIs23 ; him-5(e1467) V. C. elegans Rollers. Throws males. mgIs23[lin-11DE::GFP; rol-6(su1006)].
OH10535 pha-1(e2123) otIs314 III; otEx4681. C. elegans otIs314 [rab-3p(prom1)::2xNLS::TagRFP] III. otEx4681 [snn-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx4681. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10545 otIs341 X. C. elegans otIs341 [mgl-1::GFP + pha-1(+)].
OH10596 otEx4720. C. elegans otEx4720 [YFP::hlh-2(+)(fosmid; N-terminal fusion)+ rol-6(su1006)]. Rollers. Maintain at 15-20C by picking rollers. Fosmid was recombineered in Greenwald Lab.
OH10667 pha-1(e2123) III; otEx4767. C. elegans otEx4767 [trp-1p(1.5kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10684 pha-1(e2123) III; otIs350. C. elegans otIs350 [ric-4(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10686 pha-1(e2123) III; otIs352. C. elegans otIs352 [ric-4(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10687 pha-1(e2123) III; otIs353. C. elegans otIs353 [ric-4(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10689 otIs355 IV. C. elegans otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. Pan-neuronal nuclear RFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10690 otIs356 V. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. Pan-neuronal nuclear RFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH10712 pha-1(e2123) III; otEx4794. C. elegans otEx4794 [del-1p(2.6kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10720 pha-1(e2123) III; otEx4802. C. elegans otEx4802 [T13G4.3p(3kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10721 pha-1(e2123) III; otEx4803. C. elegans otEx4803 [twk-7p(3kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10722 pha-1(e2123) III; otEx4804. C. elegans otEx4804 [twk-13p(2.5kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10723 pha-1(e2123) III; otEx4805. C. elegans otEx4805 [twk-40p(2.5kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10724 pha-1(e2123) III; otEx4806. C. elegans otEx4806 [twk-43p(4.9kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10733 cnd-1(ot704) III; otIs341 X. C. elegans otIs341 [mgl-1::GFP + pha-1(+)]. cnd-1(ot704) is Q118=>STOP.
OH10739 cnd-1(ot705) III; otIs341 X. C. elegans otIs341 [mgl-1::GFP + pha-1(+)]. cnd-1(ot705) is L42=>F.
OH10754 pha-1(e2123) III; otEx4818. C. elegans otEx4818 [del-1p(2.6kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10765 pha-1(e2123) III; otIs358. C. elegans otIs358 [ser-2(prom2)::GFP + pha-1(+)].
OH1078 ttx-3(ot22) X; otEx621. C. elegans otEx621 [(pAIY-MCS) ttx-3(cDNA) + unc-47(long)::GFP]. Maintain by picking GFP+.
OH10799 otEx4844. C. elegans otEx4844 [acr-14p(300bp promoter)::DsRed2 + pha-1(+)]. Maintain by picking DsRed2(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10819 unc-3(e151) X; vsIs48; otEx4441. C. elegans otEx4441 [hsp-16.2p::unc-3(cDNA) + ttx-3::mCherry]. vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. Maintain by picking mCherry(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10847 otEx4539. C. elegans otEx4539 [unc-3p(SL2 fosmid)::mCherry + myo-2::GFP]. Fosmid-based reporter. Maintain by picking GFP(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10849 otEx4793. C. elegans otEx4793 [ceh-36p::unc-3(cDNA) + rol-6(su1006)]. Maintain by picking rollers. ceh-36p::unc-3(cDNA) construct made by P. Sengupta. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10850 unc-3(e151) X; otEx4432. C. elegans otEx4432 [ace-2p(SL2 fosmid)::GFP + elt-2::DsRed2]. Fosmid-based reporter. Maintain by picking DsRed2(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10851 juIs14 IV; unc-3(e151) X; otEx4812. C. elegans otEx4812 [unc-30p(2.6kb promoter)::unc-3(cDNA)::unc-54 3'UTR + myo-2::GFP]. juIs14 [acr-2p::GFP + lin-15(+)]. Maintain by picking myo-2::GFP(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10892 otIs374. C. elegans otIs374 [unc-47p(300bp)::mChopti::unc-54 3'UTR + pha-1(+)]. mChopti is visible under dissecting scope.
OH1092 otIs131. C. elegans otIs131 [gcy-7::RFP + rol-6(su1006)]. Rollers.
OH10953 hlh-16(ot711) I; otIs341 X. C. elegans otIs341 [mgl-1::GFP + pha-1(+)]. hlh-16(ot711) is R21=>STOP.
OH10969 unc-42(ot712) vsIs33 V; otIs341 X. C. elegans vsIs33 [dop-3::RFP] V. otIs341 [mgl-1::GFP + pha-1(+)] X. unc-42(ot712) is W181=>STOP.
OH10972 otIs376. C. elegans otIs376 [eat-4(prom4)::GFP + rol-6(su1006)]. Rollers. Reference: Serrano-Saiz E, et al. Cell 2013. Oct; 155(3):659-73.
OH1098 otIs133 II. C. elegans otIs133[pttx-3::RFP + unc-4(+)]. RFP expressed in AIY only.
OH10993 otEx4944. C. elegans otEx4944 [lin-53::GFP + rol-6(su1006)]. Rollers. Maintain at 25C; pick Rollers. GFP recombineered at C-terminus of lin-53 in fosmid WRM0634aA12. otEx4945 was generated as a complex array with digested bacterial genomic DNA.
OH10997 otIs264 III; ntIs1 V; otIs305. C. elegans otIs264 [ceh-36p::tagRFP] III. ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. Maintain at 15-20C. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH110 lim-6(nr2073) X. C. elegans Egl. Exp. Syn daf-c. 1.7 kb deletion in lim-6 locus.
OH11020 otEx4961. C. elegans otEx4961 [lsy-6(300bp 3')::GFP::unc-54 3'UTR + ttx-3:mCherry]. Maintain by picking animals with mCherry in the AIY neurons.
OH11025 otIs252; otEx4965. C. elegans otEx4965 [tbx-38p::mCherry::unc-54 3'UTR + ttx-3::mCherry]. Maintain otEx4965 by picking animals with mCherry in the AIY neurons. otIs252 [lsy-6(fosmid)::YFP + rol-6(su1006)]. Rollers. YFP expression in ASEL.
OH11030 otIs379 otIs317. C. elegans otIs379 [cho-1(-3006/-2642)::GFP + rol-6(su1006)]. otIs317 [mgl-1::mCherry + pha-1(+)]. otIs379 appears to be linked to otIs317. Rollers.
OH11053 ntIs1 otIs305 otIs355 V. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)] V. otIs355 [rab-3::tagRFP] V. Maintain at 15-20C. Rollers. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH11054 pha-1(e2123) III; him-8(e1489) IV; ntIs1 V; otIs305; otEx4445. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. otEx4445 [snb-1::NLS::RFP + pBX]. Rollers. Maintain by picking RFP+ Rollers. Maintain at 20C to maintain extrachromosomal array. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH11061 otIs381 V. C. elegans otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH11092 pha-1(e2123) III; otEx5012. C. elegans otEx5012 [lsy-6p::YFP::unc-54 3'UTR + ttx-3p::mCherry + pha-1(+)]. Maintain at 25C; pick mCherry(+).
OH11094 pha-1(e2123) III; otEx5014. C. elegans otEx5014 [lsy-6p::YFP::lsy-6 3' sequence + ttx-3p::mCherry + pha-1(+)]. Maintain at 25C; pick mCherry(+).
OH11096 pha-1(e2123) III; otEx5016. C. elegans otEx5016 [lsy-6 300bp 3'::lsy-6p::YFP::unc-54 3'UTR + ttx-3p::mCherry + pha-1(+)]. Maintain at 25C; pick mCherry(+). Some rescued worms do not have ttx-3::mCherry expression.
OH11098 pha-1(e2123) III; otEx5018. C. elegans otEx5018 [lsy-6p::YFP::lsy-6(300bp 3')::unc-54 3'UTR + ttx-3:mCherry + pha-1(+)]. Maintain by picking animals with mCherry in the AIY neurons. Maintain at 25C to select for pha-1(+) array.
OH11101 otEx5021. C. elegans otEx5021 [lsy-6(fosmid - delta 300 bp 3')::GFP + ttx-3::mCherry]. Maintain by picking animals with mCherry expression in the AIY neurons.
OH11102 lsy-6(ot71) otIs3 V; otEx5022. C. elegans otEx5022 [lsy-6(fosmid - delta 150 bp 3') + ttx-3::mCherry]. otIs3 [gcy-7p::GFP + lin-15(+)] V. Maintain by picking animals with mCherry expression in the AIY neurons. Fosmid with 150 bp deletion does not rescue ASE asymmetry.
OH11104 lsy-6(ot71) otIs3 V; otEx5024. C. elegans otEx5024 [lsy-6(fosmid) + ttx-3::mCherry]. Maintain otEx5024 by picking animals with mCherry in the AIY neurons. otIs3 [gcy-7p::GFP + lin-15(+)] V. Integrated from adEx1288; genetically mapped between 3.05 m.u. (T19B10) and 5.86 m.u. (AH10) on V. GFP expression appears in ASEL and the excretory cell in adult animals.
OH11107 otEx5027. C. elegans otEx5027 [lsy-6(fosmid - delta 3 kb 3')::YFP + ttx-3::mCherry]. Maintain by picking animals with mCherry expression in the AIY neurons.
OH11111 lsy-6(ot71) otIs3 V; otEx5028. C. elegans otIs3 [gcy-7p::GFP + lin-15(+)] V. otEx5028 [lsy-6p::lsy-6(hairpin) + ttx-3::mCherry].
OH11113 lsy-6(ot71) otIs3 V; otEx5030. C. elegans otIs3 [gcy-7p::GFP + lin-15(+)] V. otEx5030 [lsy-6p::lsy-6(hairpin)::lsy-6 1kb 3' + ttx-3::mCherry].
OH11115 otIs286. C. elegans otIs386 [lsy-6(fosmid - delta 150 bp 3')::GFP + ttx-3::mCherry].
OH11117 otIs306, otEx4963. C. elegans otEx4963 [lsy-6p(fosmid delta 150bp downstream)::GFP + ttx-3:mCherry]. Maintain otEx4963 by picking animals with mCherry in the AIY neurons. otIs306 [hsp-16.2::che-1::3xHA + rol-6(su1006)]. Rollers.
OH11119 otIs377; otEx4945. C. elegans otIs377 [myo-3p::mCherry]. otEx4945 [hsp16-2p::hlh-1::2xFLAG + rol-6(su1006)]. Rollers. Maintain at 15-20C; pick Rollers. Both otIs377 and otEx4945 were generated as complex arrays with digested bacterial genomic DNA.
OH11124 otIs388 pha-1(e2123) III. C. elegans otIs388 [eat-4(fosmid)::SL2::YFP::H2B + pha-1(+)] III. Reference: Serrano-Saiz E, et al. Cell 2013. Oct; 155(3):659-73.
OH11152 otIs392. C. elegans otIs392 [eat-4(prom6)::GFP + ttx-3::DsRed]. Reference: Serrano-Saiz E, et al. Cell 2013. Oct; 155(3):659-73.
OH11157 pha-1(e2123) III; otIs393. C.elegans otIs393 [ift-20p::NLS::tagRFP + pha-1(+)]. Maintain at 25C to retain array. Pan-sensory neuronal GFP expression. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979.
OH11166 vab-3(ot569); otIs138. C. elegans otIs138 [ser-2(prom3)::GFP + rol-6(su1006)]. Rollers. Reference: Serrano-Saiz E, et al. Cell 2013. Oct; 155(3):659-73.
OH11319 otIs412 X. C. elegans otIs412 [unc-3p::GFP + rgef-1p::DsRed] X. GFP expression in DA/DB/VA/VB class neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH11350 otIs235; otIs252; otEx5141. C. elegans otEx5141 [hsp::tbx-37 + hsp::tbx-38 + elt-2p::DsRed]. Maintain by picking animals with dsRed in intestinal nuclei. Transcription factors TBX-37 and TBX-38 are ectopically expressed under control of a heat shock-inducible promoter. otIs235 [che-1p::mCherry + rol-6(su1006)]. otIs252 [lsy-6(+)(fosmid)::YFP + rol-6(su1006)]. Rollers. YFP expression in ASEL.
OH11410 pha-1(e2123) III; otEx5173. C. elegans otEx5173 [nsf-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH11411 pha-1(e2123) III; otEx5174. C. elegans otEx5174 [unc-31(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH11412 pha-1(e2123) III; otEx5175. C. elegans otEx5175 [maco-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH11416 otIs419. C. elegans otIs419 [snb-1p(prom17)::2xNLS::GFP + elt-2::DsRed2]. Ubiquitous GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH11462 swsn-2.2(ok3161) I; otEx5094. C. elegans otEx5094 [swsn-2.2p::swsn-2.2::mChopti + ttx-3::GFP]. Pick GFP+ to maintain. ok3161 homozygotes arrest in early larval development. otEx5094 rescues lethality, but animals are still somewhat sick at 25C.
OH11496 otEx5208. C. elegans otEx5208 [inx-17(fosmid)::GFP + rol-6(su1006)]. Strain does not roll well, but GFP expression is easily detected. GFP tag inserted into fosmid WRM0619cH12.
OH11620 otIs429; otIs337. C. elegans otIs429 [pag-3(fosmid)::mChOpti + ttx-3::GFP]. otIs337 [unc-86(fosmid)::NLS:::YFP::H2B + ttx-3::mCherry].
OH11630 lsy-27(ot108) II; ntIs1 V. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. 2 ASER.
OH11674 otIs437 V. C. elegans otIs437 [unc-3p::rab-3::GFP + ttx-3p::mCherry] V. Reporter contains 558bp upstream of unc-3 start site; marks presynapses of DA/DB class motor neurons innervating muscle and VD motor neurons in dorsal nerve cord. Reference: Kratsios P, et al. Curr Biol. 2015 May 18;25(10):1282-95.
OH11704 ham-3(tm3309) III. C. elegans Egl. Slow growing. Lethal/sterile at 25C. Maintain at 15-20C.
OH11705 ham-3(n1654) III; otEx5093. C. elegans otEx5093 [ham-3p::ham-3::GFP + elt-2::DsRed]. Strain can be maintained at 25C to increase frequency of array transmission. Pick GFP+ or DsRed+ to maintain. DsRed expression is difficult to detect at low magnification. otEx5093 rescues n1654; animals carrying the array are essentially wild-type. n1654 homozygotes without the array are Egl, slow growing, and lethal/sterile at 25C.
OH11738 otIs439. C. elegans otIs439 [lad-2p::GFP + pha-1(+)].
OH11744 otIs445; gwIs39. C. elegans otis445 [ace-2p::RFP + LacO repeats]. gwIs39 [baf-1p::GFP::lacI::let-858 3'UTR + vit-5p::GFP]. RFP expression in cholinergic motor neurons. LACI::GFP aggregates on LacO repeats to form two dots in every nucleus. vit-5::GFP is expressed in intestine at L4 stage and later. Reference: Patel T & Hobert O. eLife 2017.
OH11746 pha-1(e2123) III; otIs447 IV. C. elegans otIs447 [unc-3p::mCherry + pha-1(+)] IV. DA/DB/VA/VB motor neuron class-specific red fluorescent reporter. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH11809 otIs450. C. elegans otIs450 [oig-1(fosmid)::SL2::GFP + rol-6(su1006)]. Rollers. Integrated fosmid-based oig-1 transcritpional reporter.
OH12050 otEx5449. C. elegans otEx5449 [fozi-1(fosmid)::YFP + che-1p::mCherry]. otEx5449 is a complex array derived from injection with PvuII-digested E. coli genomic DNA. Onset of fozi-1::YFP expression is around 3-fold stage in embryos. Pick animals with che-1p::mCherry exprssion in ASE neurons to maintain.
OH122 mgIs25. C. elegans mgIs25 [unc-97::GFP]. Translational fusion of the complete encoding sequence of unc-97.
OH12312 otIs388 pha-1(e2123) III; him-5(e1490) V. C. elegans otIs388 [eat-4(fosmid)::SL2::YFP::H2B + pha-1(+)] III. Him. Reference: Serrano-Saiz E, et al. Cell. 2013 Oct 24;155(3):659-73.
OH12343 lin-13(ot785) III; otIs476 V. C. elegans otIs476 [glr-4p::TagRFP] V. ot785 is a H2121Y missense mutation in the DNA-binding site. De-repression of ectopic effector genes in AS class motor neurons. Reference: Kerk SY, et al. Neuron. 2017 93(1):80-98.
OH12344 cfi-1(ot786) I. C. elegans De-repression of ectopic effector genes in DA/DB class motor neurons. Reference: Kerk SY, et al. Neuron. 2017 (in press).
OH12372 otIs494 [flp-6fosmid::sl2::1xNLS::mChOpti]. C. elegans otIs494 [flp-6(fosmid)::sl2::1xNLS::mChOpti]. Cytoplasmic mChOpti expression in ASE, AFD, ASG, I1, PVT and VC neurons. Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision)
OH12389 mab-9(ot788) II; hdIs1 X. C. elegans hdIs1 [unc-53p::GFP + rol-6(su1006)] X. Rollers. De-repression of ectopic effector genes in DA/DB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH12412 otIs502. C.elegans otIs502 [hlh-2(fosmid)::YFP + myo-3p::mCherry]. Broad embryonic expression; later in development transgene is expressed in DTCs, vulva, and some gland cells in pharynx. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979.
OH12495 otIs517. C. elegans otIs517 [tph-1(fosmid)::SL2::YFP::H2B + ttx-3::mCherry]. Fosmid-based tph-1 reporter expresses YFP in NSM, ADF, and HSN neurons, as well as in R1B, R3B, and R9B (in males). Adult animals roll, though for reasons unknown.
OH12499 otEx5663. C. elegans otEx5663 [unc-30p::GFP::rab-3::unc-10 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Synaptic GFP marker in D-type motor neurons.
OH12500 otEx5664. C. elegans otEx5664 [oig-1(fosmid)::GFP + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Fosmid-based oig-1 transcritpional reporter.
OH12531 otIs527. C. elegans otIs527 [nlr-1p::GFP::unc-54 3'UTR + pha-1(+)]. Reporter contains 150bp upstream of the nlr-1 start codon. Derived from injection of pMG144; line 4-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH12541 otIs532. C. elegans otIs532 [cho-1(fosmid)::SL2::NLS::YFP::H2B]. YFP expression in cholinergic neurons. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH12543 otIs534. C. elegans otIs534 [cho-1(fosmid)::SL2::NLS::YFP::H2B]. YFP expression in cholinergic neurons. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH12644 otEx5765. C. elegans otEx5765 [lin-14(fosmid)::GFP + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. mCherry might be difficult to see at lower magnification. Fosmid-based lin-14 transcritpional reporter; see Li and Greenwald, Current Biology 2010, Oct 26;20(20):1875-9.
OH127 him-5(e1490) V; otIs14. C. elegans otIs14 [zig-3::GFP + rol-6(su1006)]. Rollers.
OH12734 unc-86(n846) III; otEx5851. C. elegans otEx5851 [unc-86(fosmid)::NLS::mChopti + lin-44::YFP]. Pick YFP+ to maintain.
OH12737 uIs115; otIs14; otEx5853. C. elegans uIs115 [mec-17::RFP]. otIs14 [zig-3::GFP + rol-6(su1006)]. Rollers. otEx5853 [hsp::unc-86 + ttx-3::mCherry]. Temperature-sensitive. Maintain at 15C. Pick ttx-3::mCherry-positive animals to maintain array. Expresses unc-86 ubiquitously upon heat shock.
OH12738 otIs545; otIs593. C. elegans otIs545 [gcy-5p::RFP + LacO repeats]. otIs593 [let-858p::GFP::LacI + ttx-3p::mCherry]. Maintain at 20C; otIs545 is very unstable at lower temperatures. RFP expression in ASER neuron. LACI::GFP aggregates on LacO repeats to form two dots in every nucleus. otIs545 is unstable, presumably due to the highly repetitive nature of the LacO array. Stock should be periodically examined for RFP expression and GFP localization to retain expression of the array. Reference: Patel T & Hobert O. eLife 2017.
OH1277 otEx669. C. elegans otEx669 [exc-4p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Transcriptional GFP fusion expresses in the excretory cell, excretory pore cell, excretory duct cell, rectal gland cell, hypodermis, seam cells, innerlabial sheath cells, and phasmid sheath cells.
OH1279 otEx671. C. elegans otEx671[exc-4p::exc-4::GFP + rol-6(su1006)]. Maintain by picking Rollers. Translational GFP fusion localizes to the lumenal membrane of the excretory cell, to the apical junction of the seam cells, and to the tips of the inner labial and phasmid sheath cells.
OH128 otIs39 II; him-5(e1490) V. C. elegans otIs39 [unc-47(delta)::GFP + lin-15(+)]. Expressed in RMEL/R, AVL, RIS, DVB, PVT and unidentified amphid sensory neuron pair.
OH12849 pha-1(e2123) III; otIs356 V; otEx5886. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx5886 [unc-57(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH12857 pha-1(e2123) III; otIs356 V; otEx5894. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx5894 [egl-3(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH12860 pha-1(e2123) III; otIs356 V; otEx5897. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. Pan-neuronal nuclear RFP expression. otEx5897 [egl-21(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH12863 pha-1(e2123) III; otIs356 V; otEx5900. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx5900 [tbb-4(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH12867 pha-1(e2123) III; otEx5904. C. elegans otEx5904 [rgef-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH12884 pha-1(e2123) III; otEx5921. C. elegans otEx5921 [syd-2(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH12887 otIs476 II; otIs498. C. elegans otIs476 [glr-4::TagRFP] II. otIs498 [rab-3(fosmid)::SL2::NLS::YFP::H2B + hygR]. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH12888 pha-1(e2123) III; otIs356 V; otEx5924. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx5924 [snt-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx5924. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH12889 pha-1(e2123) III; otIs356 V; otEx5925. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx5925 [unc-18(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH12930 pha-1(e2123) III; evIs82b IV; otEx5966. C. elegans evIs82b [unc-129::GFP + dpy-20(+)] IV. otEx5966 [bnc-1p::mChOpti + pha-1(+)]. Maintain at 25C to select for presence of otEx5966 array. VA/VB motor neuron class-specific red fluorescent reporter. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH13027 otIs569. C. elegans otIs569 [snf-11(fosmid)::SL2::H2B::mChopti + pha-1(+)]. Reporter tag inserted into fosmid WRM064dH02. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13083 him-5(e1490) V; otIs576. C. elegans otIs576 [unc-17(fosmid)::GFP + lin-44::YFP]. Him. GFP expression in all cholinergic neurons. Reference: Pereira L, et al. Elife. 2015 Dec 25;4.
OH13098 che-1(ot75) I. C. elegans che-1(ot75) is a null allele caused by an early STOP codon in exon 1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.
OH13099 otIs583. C. elegans otIs583 [gcy-5p*::GFP + ttx-3p::mCherry]. Robust GFP expression in both ASE neurons. mCherry expression in AIY meurons. *This strain contains a short gcy-5 promoter with the CHE-1 binding ASE motif multimerized. GFP expression is strong enough to visualize morphology of both ASE neurons simultaneously. Reference: Patel T & Hobert O. eLife 2017. Etchberger JF, et al. Development. 2009 Jan;136(1):147-60.
OH13102 otIs586 X. C. elegans otIs586 [gcy-6(fosmid)::SL2::NLS::GFP + ttx-3p::mCherry] X. Reporter tag inserted into gcy-6(+) fosmid; expressed only in the ASEL neuron during normal growth conditions. Reference: Patel T & Hobert O. eLife 2017.
OH13104 him-5(e1490) V; otIs565. C. elegans otIs565 [unc-47(fosmid)::SL2::H2B::mChopti + pha-1(+)]. Reporter tag inserted into fosmid WRM0626bG04. Him. Line 5-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13105 him-5(e1490) otIs564 V. C. elegans otIs564 [unc-47(fosmid)::SL2::H2B::mChopti + pha-1(+)] V. Reporter tag inserted into fosmid WRM0626bG04. Him. Line 2-2. Inserted near unc-42. Brighter mCherry expression than in OH13104. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13106 him-5(e1490) V; otIs568. C. elegans otIs568 [unc-46(fosmid)::SL2::H2B::mChopti + pha-1(+)]. Reporter tag inserted into fosmid WRM0611dE07. Him. Line 19-2. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13107 otIs570 I; him-5(e1490) V. C. elegans otIs570 [snf-11(fosmid)::SL2::H2B::mChopti + pha-1(+)] I. Reporter tag inserted into fosmid WRM064dH02. Him. Line 14-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13290 pha-1(e2123) III; otEx6176. C. elegans otEx6176 [ric-19(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH13333 him-5(e1490) V; otIs514. C. elegans otIs514 [unc-25p::unc-25(partial)::GFP::unc-54 3'UTR + pha-1(+)]. Him. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 6. Derived from injection of pMG89; line 14-12. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH134 pha-1(e2123) III; otEx57. C. elegans otEx57 [ttx-3::GFP + pha-1(+)]. Full-length rescuing ttx-3 genomic construct fused to GFP using PCR. Maintain at 25C to select for transgenic animals.
OH13405 inx-6(ot804 [inx-6::SL2::NLS::yfp::H2B]) IV. C. elegans inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH13421 pha-1(e2123) III; otIs356 V; otEx6254. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6254 [snb-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6254. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH13422 pha-1(e2123) III; otIs356 V; otEx6255. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6255 [unc-31(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6254. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH13423 pha-1(e2123) III; otIs356 V; otEx6256. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6256 [unc-10a(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6256. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH13425 pha-1(e2123) III; otIs356 V; otEx6258. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6258 [unc-108(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6258. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Neuron. 2015 Aug 19;87(4):733-50.
OH13426 pha-1(e2123) III; otIs356 V; otEx6259. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6259 [unc-10B(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6259. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH13470 him-5(e1490) V; otIs354. C. elegans otIs354 [cho-1(fosmid)::SL2::YFP::H2B]. Him.
OH13476 tab-1(ot796) II; otIs549 X. C. elegans otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. Derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13513 otIs597. C. elegans otIs597 [ser-7p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M4 pharyngeal neuron. Please contact Oliver Hobert prior to publishing work using this strain.
OH13517 otIs601. C. elegans otIs601[ceh-19p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for MC pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain.
OH13518 otIs602. C. elegans otIs602 [mnm-2p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M3 pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain.
OH13525 inx-6(ot805 [inx-6::gfp]) IV. C. elegans inx-6(ot805) was generated by the insertion of GFP into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH13526 him-5(e1490) V; otIs549 X. C. elegans otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. Him. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. Derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH1353 exc-4(rh133) I; bgIs312. C. elegans bgIs312 [pes-6::GFP]. GFP expression in excretory cell only.
OH1358 kyIs123. C. elegans kyIs123 [trp-1::GFP].
OH1360 bgIs312; otEx718. C. elegans bgIs312 [pes-6::GFP]. GFP expression in excretory cell only. otEx718 [exc-4p::exc-4::DsRed2 + rol-6(su1006)]. Maintain by picking Rollers. Roller phenotype most penetrant at 20C.
OH13605 otIs619 X. C. elegans otIs619 [unc-11(prom8)::2xNLS::TagRFP] X. Pan-neuronal RFP expression. Reference: Stefanakis N, et al. Neuron. 2015 Aug 19;87(4):733-50.
OH13606 otIs620. C. elegans otIs620 [unc-11(prom8)::2xNLS::GFP]. Pan-neuronal nuclear GFP expression. Reference: Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH13645 pha-1(e2123) III; him-5(e1490) V; otIs518. C. elegans otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. Him. Reference: Serrano-Saiz E, et al. Cell. 2013 Oct 24;155(3):659-73.
OH13646 pha-1(e2123) III; him-5(e1490) V; otIs544. C. elegans otIs544 [cho-1(fosmid)::SL2::mCherry::H2B + pha-1(+)]. Him. Reference: Serrano-Saiz E, et al. Cell. 2013 Oct 24;155(3):659-73.
OH13787 otEx6368. C. elegans otEx6368 [GFP::oig-8(fosmid) + ttx-3p::mCherry]. Pick ttx-3p::mCherry to maintain. Fosmid-based oig-8 translational reporter (GFP inserted in N-terminus of OIG-8 after peptide sequence).
OH13795 pha-1(e2123) III; otEx6374. C. elegans otEx6374 [acc-1(fosmid)::GFP + pha-1(+)]. Maintain at 25C. GFP expression in a few neurons. Reference: Pereira L, et al. Elife. 2015 Dec 25;4.
OH13796 pha-1(e2123) III; otEx6375. C. elegans otEx6375 [acc-2(fosmid)::GFP + pha-1(+)]. Maintain at 25C. GFP expression in a few neurons. Reference: Pereira L, et al. Elife. 2015 Dec 25;4.
OH13797 pha-1(e2123) III; otEx6376. C. elegans otEx6376 [acc-4(fosmid)::GFP + pha-1(+)]. Maintain at 25C. Broad neuronal GFP expression. Reference: Pereira L, et al. Elife. 2015 Dec 25;4.
OH13813 oig-8(ot818) II. C. elegans
OH13830 sax-7(ot820) IV; oyIs14 V. C. elegans oyIs14 [sra-6::GFP + lin-15(+)] V. ot820 is an 8bp deletion 15bp from the start of the sax-7S start codon, resulting in a frameshift and sax-7S isoform-specific null allele.
OH13833 pha-1(ee2123) III; otEx6397. C. elegans otEx6397 [srh-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13835 pha-1(e2123) III; otEx6399. C. elegans otEx6399 [srh-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13837 pha-1(e2123) III; otEx6401. C. elegans otEx6401 [srh-7p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13839 pha-1(e2123) III; otEx6403. C. elegans otEx6403 [sri-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13841 pha-1(e2123) III; otEx6405. C. elegans otEx6405 [sri-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13843 pha-1(e2123) III; otEx6407. C. elegans otEx6407 [sri-9p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13845 pha-1(e2123) III; otEx6409. C. elegans otEx6409 [sri-12p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13848 pha-1(e2123) III; otEx6411. C. elegans otEx6412 [sri-18p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13849 pha-1(e2123) III; otEx6413. C. elegans otEx6413 [sri-21p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13851 pha-1(e2123) III; him-5(e1490) V; otEx6415. C. elegans otEx6415 [sri-36p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13853 pha-1(e2123) III; him-5(e1490) V; otEx6417. C. elegans otEx6417 [sri-39p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13855 pha-1(e2123) III; him-5(e1490) V; otEx6419. C. elegans otEx6419 [sri-62p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13857 pha-1(e2123) III; otEx6421. C. elegans otEx6421 [srd-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13859 pha-1(e2123 III; otEx6423. C. elegans otEx6423 [srd-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13861 pha-1(e2123) III; otEx6425. C. elegans otEx6425 [srd-10p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13863 pha-1(e2123) III; otEx6427. C. elegans otEx6427 [srd-11p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13865 pha-1(e2123) III; him-5(e1490) V; otEx6429. C. elegans otEx6429 [srx-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13867 pha-1(e2123) III; him-5(e1490) V; otEx6431. C. elegans otEx6431 [srx-3p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13869 pha-1(e2123) III; him-5(e1490) V; otEx6433. C. elegans otEx6433 [srx-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13871 pha-1(e2123) III; him-5(e1490) V; otEx6435. C. elegans otEx6435 [srx-10p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13873 pha-1(e2123) III; him-5(e1490) V; otEx6437]. C. elegans otEx6437 [srx-17p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13875 pha-1(e2123) III; him-5(e1490) V; otEx6439. C. elegans otEx6439 [srx-22p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13877 pha-1(e2123) III; him-5(e1490) V; otEx6441. C. elegans otEx6441 [sru-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13879 pha-1(e2123) III; him-5(e1490) V; otEx6443. C. elegans otEx6443 [sru-2p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13881 pha-1(e2123) III; him-5(e1490) V; otEx6445. C. elegans otEx6445 [sru-8p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13884 pha-1(e2123) III; him-5(e1490) V; otEx6447. C. elegans otEx6448 [sru-12p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13885 pha-1(e2123) III; him-5(e1490) V; otEx6449. C. elegans otEx6449 [sru-30p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13887 pha-1(e2123) III; him-5(e1490) V; otEx6451. C. elegans otEx6451 [sru-48p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13908 daf-16(ot821[daf-16::mKate2::3xFLAG]) I. C. elegans CRISPR allele of daf-16, tagged at the C-terminus with mKate2::3xFLAG. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.
OH13988 ieSi57 II; unc-3(ot837[unc-3::mNeonGreen::AID*]) X. C. elegans ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. The endogenous unc-3 locus is tagged with mNeonGreen and AID* degron. mNeonGreen expression is seen in the cholinergic motor neurons, command interneurons, and ASI. Reference: Patel T, Hobert O. Elife. 2017 Apr 19;6:e24100. doi: 10.7554/eLife.24100. PMID: 28422646.
OH14014 inx-6(ot804 ot840) IV. C. elegans inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. ot840 was created by targeted disruption of the conserved TAATTA in the tagged inx-6(ot804). Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH14018 him-5(e1490) V; otIs520. C. elegans otIs520 [eat-4(prom11)::GFP + ttx-3::mCherry]. Reference: Serrano-Saiz E, et al. Curr Biol. 2017 Jan 23;27(2):199-209.
OH14021 hpl-1(ot841 [hpl-1::mKate2]) X. C. elegans ot841[hpl-1::mKate2]. Endogenous hpl-1 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted into the protein after amino acid 12. This tag was based on a published hpl-1 protein fusion (Couteau et al., 2002). Reference: Patel T & Hobert O. eLife 2017.
OH14044 evIs82b IV; bnc-1(ot763) V. C. elegans evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14045 evIs82b IV; bnc-1(ot721) V. C. elegans evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14049 otIs629; ntIs1 V. C. elegans otIs629 [gcy-7p::TagRFP + ttx-3p::GFP]. ntIs1 [gcy-5p::GFP + lin-15(+)] V. RFP expression in ASEL neurons. GFP expression appears in ASER (in adults) and AIY neurons. Reference: Patel T & Hobert O. eLife 2017.
OH14070 bnc-1(ot845[bnc-1::mNeonGreen::AID*]) V. C. elegans bnc-1 was modified by CRISPR/Cas9 to create both a GFP-tagged reporter and conditional allele using the auxin-inducible degron (AID*). Reference: Kerk SY, et al. Neuron. 2017 Jan 4;93(1):80-98. doi: 10.1016/j.neuron.2016.11.036. PMID: 28056346
OH14125 daf-16(ot853[daf-16::linker::mNeonGreen::3xFlag::AID*]) I. C. elegans mNeonGreen tag inserted into endogenous daf-16 locus; AID* at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580
OH14130 che-1(ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. C. elegans ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 tagged with GFP. Nuclear GFP localization in ASE neurons. Reference: Leyva-Díaz E, et al. Genetics. 2017 Oct;207(2):529-545.
OH1421 hst-6(ok273) X. C. elegans Phenotypically WT. In hst-6(ok273) , 1064 nt are deleted following position 39378 in Y34B4A (ACC# AC024755) and replaced by four nucleotides CTTT.
OH1422 otIs138 X. C. elegans otIs138 [ser-2(prom3)::GFP + rol-6(su1006)] X. Integrated array derived from otEx449.
OH14220 hpl-2(ot860 [hpl-2::mKate2]) III. C. elegans ot860[hpl-2::mKate2]. Grows normally at 15-20C. Endogenous hpl-2 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted into the protein after amino acid 96; tags both isoforms of hpl-2. This tag was based on a published hpl-2 protein fusion (Couteau et al., 2002). Reference: Patel T & Hobert O. eLife 2017.
OH14221 met-2(ot861[met-2::mKate2]) III. C. elegans ot861[met-2::mKate2] III. Maintain at 15-20C. Endogenous met-2 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted at the C-terminus using a small protein bridge present in the plasmids (Dickinson et al., 2015). Reference: Patel T & Hobert O. eLife 2017.
OH14222 pha-1(e2123) III; him-5(e1490) V; otEx6599. C. elegans otEx6599 [srj-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14224 pha-1(e2123) III; him-5(e1490) V; otEx6600. C. elegans otEx6601 [srj-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14225 pha-1(e2123) III; him-5(e1490) V; otEx6602. C. elegans otEx6602 [srj-20p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14226 pha-1(e2123) III; him-5(e1490) V; otEx6603. C. elegans otEx6603 [srj-22p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14227 pha-1(e2123) III; him-5(e1490) V; otEx6604. C. elegans otEx6604 [srj-25p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14228 pha-1(e2123) III; him-5(e1490) V; otEx6605. C. elegans otEx6605 [srj-27p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14230 pha-1(e2123) III; him-5(e1490) V; otEx6607. C. elegans otEx6607 [srj-38p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14232 pha-1(e2123) III; him-5(e1490) V; otEx6609. C. elegans otEx6609 [srsx-12p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14234 pha-1(e2123) III; him-5(e1490) V; otEx6611. C. elegans otEx6611 [srsx-28p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14235 pha-1(e2123) III; him-5(e1490) V; otEx6612. C. elegans otEx6612 [srsx-38p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14238 pha-1(e2123) III; him-5(e1490) V; otEx6614. C. elegans otEx6614 [srg-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14240 pha-1(e2123) III; him-5(e1490) V; otEx6616. C. elegans otEx6616 [srg-14p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14241 pha-1(e2123) III; him-5(e1490) V; otEx6617. C. elegans otEx6617 [srg-29p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14243 pha-1(e2123) III; him-5(e1490) V; otEx6619. C. elegans otEx6619 [srg-31p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14244 pha-1(e2123) III; him-5(e1490) V; otEx6620. C. elegans otEx6620 [srg-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14246 pha-1(e2123) III; him-5(e1490) V; otEx6622. C. elegans otEx6622 [srg-39p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14248 pha-1(e2123) III; him-5(e1490) V; otEx6624. C. elegans otEx6624 [srg-58p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14250 pha-1(e2123) III; him-5(e1490) V; otEx6626. C. elegans otEx6626 [srg-66p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14265 pha-1(e2123) III; him-5(e1490) V; otEx6628. C. elegans otEx6628 [srz-54p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14271 pha-1(e2123) III; him-5(e1490) V; otEx6634. C. elegans otEx6634 [str-31p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14273 pha-1(e2123) III; him-5(e1490) V; otEx6636. C. elegans otEx6636 [str-52p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14275 pha-1(e2123) III; him-5(e1490) V; otEx6638. C. elegans otEx6638 [str-94p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14277 pha-1(e2123) III; him-5(e1490) V; otEx6640. C. elegans otEx6640 [str-121p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14279 pha-1(e2123) III; him-5(e1490) V; otEx6642. C. elegans otEx6642 [str-178p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14281 pha-1(e2123) III; him-5(e1490) V; otEx6644. C. elegans otEx6644 [str-231p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14283 pha-1(e2123) III; him-5(e1490) V; otEx6646. C. elegans otEx6646 [str-233p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14285 pha-1(e2123) III; him-5(e1490) V; otEx6648. C. elegans otEx6648 [str-247p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14287 pha-1(e2123) III; him-5(e1490) V; otEx6650. C. elegans otEx6650 [str-261p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14289 pha-1(e2123) III; him-5(e1490) V; otEx6652]. C. elegans otEx6652 [srh-62p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14293 pha-1(e2123) III; him-5(e1490) V; otEx6656. C. elegans otEx6656 [srh-100p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14295 pha-1(e2123) III; him-5(e1490) V; otEx6658. C. elegans otEx6658 [srh-142p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14297 pha-1(e2123) III; him-5(e1490) V; otEx6660. C. elegans otEx6660 [srh-193p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14299 pha-1(e2123) III; him-5(e1490) V; otEx6662. C. elegans otEx6662 [srh-199p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14301 pha-1(e2123) III; him-5(e1490) V; otEx6664. C. elegans otEx6664 [srh-201p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14303 pha-1(e2123) III; him-5(e1490) V; otEx6666. C. elegans otEx6666 [srh-277p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14305 pha-1(e2123) III; him-5(e1490) V; otEx6668. C. elegans otEx6668 [srh-127p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14313 pha-1(e2123) III; him-5(e1490) V; otEx6674. C. elegans otEx6674 [srh-210p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14315 pha-1(e2123) III; him-5(e1490) V; otEx6676. C. elegans otEx6676 [srh-211p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14317 pha-1(e2123) III; him-5(e1490) V; otEx6678. C. elegans otEx6678 [srh-218p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14319 pha-1(e2123) III; him-5(e1490) V; otEx6680. C. elegans otEx6680 [srh-240p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14321 pha-1(e2123) III; him-5(e1490) V; otEx6682. C. elegans otEx6682 [srh-241p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14323 pha-1(e2123) III; him-5(e1490) V; otEx6684. C. elegans otEx6684 [srh-269p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14335 otIs637. C. elegans otIs637 [bnc-1p::rab-3::GFP + myo-2p::mCherry]. Reporter for presynapse of VA/VB class motor neurons innervating muscle and DD motor neurons in ventral nerve cord. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14337 pha-1(e2123) III; him-5(e1490) V; otEx6694. C. elegans otEx6694 [srh-270p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14339 pha-1(e2123) III; him-5(e1490) V; otEx6696. C. elegans otEx6696 [srj-21p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14341 pha-1(e2123) III; him-5(e1490) V; otEx6698. C. elegans otEx6698 [srsx-27p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14343 pha-1(e2123) III; him-5(e1490) V; otEx6700. C. elegans otEx6700 [srz-102p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14357 mab-9(ot863[mab-9::TagRFP::AID*]) II. C. elegans mab-9(ot863[mab-9::TagRFP::AID*]) II. mab-9 was modified by CRISPR/Cas9 to create a conditional allele using the auxin-inducible degron (AID*). RFP is not visible in this strain. Reference: Kerk SY, et al. Neuron. 2017 Jan 4;93(1):80-98. doi: 10.1016/j.neuron.2016.11.036. PMID: 28056346
OH14360 pha-1(e2123) III; him-5(e1490) V; otEx6702. C. elegans otEx6702 [srg-25p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14362 pha-1(e2123) III; him-5(e1490) V; otEx6704. C. elegans otEx6704 [srw-145p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14364 pha-1(e2123) III; him-5(e1490) V; otEx6706. C. elegans otEx6706 [srb-17p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14367 pha-1(e2123) III; him-5(e1490) V; otEx6708. C. elegans otEx6709 [sri-26p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14368 pha-1(e2123) III; him-5(e1490) V; otEx6710. C. elegans otEx6710 [srd-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14369 pha-1(e2123) III; him-5(e1490) V; otEx6726. C. elegans otEx6726 [str-253p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14370 pha-1(e2123) III; him-5(e1490) V; otEx6711. C. elegans otEx6711 [srsx-37p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14372 pha-1(e2123) III; him-5(e1490) V; otEx6713. C. elegans otEx6713 [str-97p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14374 pha-1(e2123) III; him-5(e1490) V; otEx6715. C. elegans otEx6715 [str-102p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14376 pha-1(e2123) III; him-5(e1490) V; otEx6717. C. elegans otEx6717 [str-85p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14378 pha-1(e2123) III; him-5(e1490) V; otEx6719. C. elegans otEx6719 [str-84p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14380 pha-1(e2123) III; him-5(e1490) V; otEx6721. C. elegans otEx6721 [str-114p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14384 pha-1(e2123) III; him-5(e1490) V; otEx6725. C. elegans otEx6725 [str-262p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14386 pha-1(e2123) III; him-5(e1490) V; otEx6728. C. elegans otEx6728 [str-250p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14388 pha-1(e2123) III; him-5(e1490) V; otEx6730. C. elegans otEx6730 [str-123p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14390 pha-1(e2123) III; him-5(e1490) V; otEx6732. C. elegans otEx6732 [str-125p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14392 pha-1(e2123) III; him-5(e1490) V; otEx6734. C. elegans otEx6734 [str-129p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14394 pha-1(e2123) III; him-5(e1490) V; otEx6736. C. elegans otEx6736 [str-130p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14396 pha-1(e2123) III; him-5(e1490) V; otEx6738. C. elegans otEx6738 [str-143p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14398 pha-1(e2123) III; him-5(e1490) V; otEx6740. C. elegans otEx6740 [str-148p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14400 pha-1(e2123) III; him-5(e1490) V; otEx6742. C. elegans otEx6742 [str-236p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14402 pha-1(e2123) III; him-5(e1490) V; otEx6744. C. elegans otEx6744 [str-249p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14404 pha-1(e2123) III; otEx6746. C. elegans otEx6746 [gta-1(fosmid)::SL2::mChopti::H2B + pha-1(+)]. Maintain at 25C to maintain array. Reporter tag inserted into fosmid WRM0627bF07. Line 6-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14405 tab-1(gk753) II; otIs549 X; otEx6747. C. elegans otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6747 [tab-1(fosmid)::SL2::YFP::H2B + rol-1(su1006)]. Pick Rollers to maintain otEx6747. Him. otIs549 reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. otIs549 was derived from injection of pMG154; line 2-1. otEx6747 reporter tag inserted into fosmid WRM0617bA03; line 5-4. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14408 elt-1(ok1002) IV; otEx6750. C. elegans otEx6750 [unc-47p::mChopti + elt-1(+)(fosmid)]. Array rescues lethal elt-1 mutation; contains fosmid WRM0619bE05. Line 1-2. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14420 pals-22(ot811) III; otIs381 V; otEx6761. C. elegans otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6761 [pals-22(+) + ttx-3p::mChOPTI]; derived from PCR fragment containing the genomic pals-22 locus. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6761 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH14429 pals-22(ot811) III; otIs381 V; otEx6769. C. elegans otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6769 [pals-22(fosmid) + myo-2p::mChOPTI]; derived from NotI digestion of WRM0616DC09. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6769 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH14431 otIs638. C. elegans otIs638 [unc-6(fosmid)::NLS::YFP::H2B + ttx-3p::mCherry + pha-1(+)]. Integrated fosmid reporter for unc-6. Reference: Weinberg P, et al. Curr Biol. 2018 Feb 19;28(4):623-629.e3.
OH14454 otIs587; otIs304. C. elegans otIs587 [gcy-5(fosmid)::SL2::NLS::GFP + ttx-3p::mCherry]. otIs304 [hsp16-2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. GFP reporter tag inserted into gcy-5(+) fosmid. gcy-5 is normally expressed in ASER and RIGL/R neurons, but upon heatshock, expression of CHE-1 induces ectopic gcy-5 expression (the extent of ectopic expression is dependent on the timing of the heatshock). Reference: Patel T & Hobert O. eLife 2017.
OH14486 gcy-5(ot835[gcy-5::SL2::mNeonGreen]) II; otTi6 X. C. elegans ot835 [gcy-5::SL2::mNeonGreen] III. otTi6 [hsp16-41p::che-1::2xFLAG] X. otTi6 is a miniMOS insertion of heatshock inducible che-1. Under normal growth conditions, very dim expression of gcy-5 is observed in the ASER and RIGL/R neurons. Upon heatshock, induction of CHE-1 leads to ectopic expression of gcy-5 (ectopic expression varies depending upon age at heatshock and genetic background).
OH14529 otTi19. C. elegans otTi19 [npr-9p::inx-6::GFP]. Mos-mediated insertion. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH14542 pha-1(e2123) III; otEx6798. C. elegans otEx6798 [lgc-36(fosmid)::SL2::NLS::YFP::H2B + ttx-3::mChopti + pha-1(+)]. Maintain at 25C to select for array. Reporter tag inserted into fosmid WRM0636cA08. Line 4-2. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14543 pha-1(e2123) III; otEx6799. C. elegans otEx6799 [gab-1(fosmid)::SL2::NLS::YFP::H2B + ttx-3::mChopti + pha-1(+)]. Maintain at 25C to select for array. Reporter tag inserted into fosmid WRM0640aC06. Line 2-3. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14544 pha-1(e2123) III; otEx6800. C. elegans otEx6800 [lgc-37(fosmid)::SL2::NLS::YFP::H2B + ttx-3::mChopti + pha-1(+)]. Maintain at 25C to select for array. Reporter tag inserted into fosmid WRM0640aC06. Line 3-2. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14545 pha-1(e2123) III; otEx6801. C. elegans otEx6801 [lgc-38p::GFP + pha-1(+)]. Maintain at 25C to select for array. PCR used to fuse 3.9 kb lgc-38 promoter with GFP reporter. Line 10. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14546 pha-1(e2123) III; otEx6802. C. elegans otEx6802 [lgc-37p::GFP + pha-1(+)]. Maintain at 25C to select for maintain array. Reporter contains 5 kb of lgc-37 promoter fused with GFP. Derived from injection of pMG249; line 5. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14547 pha-1(e2123) III; otEx6803. C. elegans otEx6803 [gab-1p::GFP + pha-1(+)]. Maintain at 25C to select for array. Reporter contains 5 kb of gab-1 promoter fused with GFP. Derived from injection of pMG250; line 1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14548 tab-1(gk753) II; otIs549 X; otEx6804. C. elegans otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6804 [tab-1(+) + ttx-3::GFP]. Maintain otEx6804 by picking ttx-3::GFP. otEx6804 carries a PCR fragment containing the tab-1 locus; rescues gk753. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14551 unc-25(ot867[unc-25::SL2::1xNLS::GFP::H2B]) III. C. elegans unc-25(ot867[unc-25::SL2::1xNLS::GFP::H2B]) III.
OH14570 otEx6820. C. elegans otEx6820 [ceh-36(prom3)::oig-8 + ttx-3p::mCherry]. Pick ttx-3p::mCherry to maintain.
OH14589 daf-12(ot870[daf-12::GFP::3xFlag]) X. C. elegans Superficially wildtype. GFP tag inserted into endogenous daf-12 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted
OH14619 elt-1(ok1002) IV; him-5(e1490) V; otIs549 X; otEx6751. C. elegans otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. otEx6751 [unc-47p::GFP + elt-1(+)(fosmid)]. Him. otEx6751 rescues lethal elt-1 mutation; contains fosmid WRM0619bE05. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14654 daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; daf-2(e1370) III. C. elegans Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID* conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva U. et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586; PMCID: PMC8099054.
OH14660 snf-3(ok293) II; him-5(e1490) V. C. elegans Him. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
OH14674 otIs348 IV; him-5(e1490) V. C. elegans otIs348 [unc-47p::mChopti::unc-54 3'UTR + pha-1(+)] IV. Him. otIs348 contains 300 bp upstream of the unc-47 start codon; derived from injection of pMG92; line 2-16. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14675 otIs575 I; him-5(e1490) V. C. elegans otIs575 [unc-46p::GFP + pha-1(+)] I. Him. otIs575 contains 234 bp upstream of the unc-46 start codon; derived from injection of pMG117; line 17-2. Integrated in LG I near ceh-8 and ceh-12. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14711 nhr-67(ot795) IV; him-5(e1490) V; otEx5999. C. elegans otEx5999 [nhr-67(fosmid) + unc-47p::mChopti]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx5999 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14712 nhr-67(ot795) IV; him-5(e1490) V; otEx6001. C. elegans otEx6001 [nhr-67(fosmid) + unc-47p::GFP]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx6001 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14750 pha-1(e2123) III; him-5(e1490) V; otEx6853. C. elegans otEx6853 [srv-3p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14751 pha-1(e2123) III; him-5(e1490) V; otEx6854. C. elegans otEx6854 [srv-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14752 pha-1(e2123) III; him-5(e1490) V; otEx6855. C. elegans otEx6855 [srv-8p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14753 pha-1(e2123) III; him-5(e1490) V; otEx6856. C. elegans otEx6856 [srv-12p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14755 pha-1(e2123) III; him-5(e1490) V; otEx6856. C. elegans otEx6856 [srv-17p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14756 pha-1(e2123) III; him-5(e1490) V; otEx6859. C. elegans otEx6859 [srv-27p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14757 pha-1(e2123) III; him-5(e1490) V; otEx6860. C. elegans otEx6860 [srv-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14758 pha-1(e2123) III; him-5(e1490) V; otEx6861. C. elegans otEx6861 [srv-34p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH1476 lin-23(ot1) II; oxIs12 X. C. elegans oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic AVL outgrowth.
OH14760 pha-1(e2123) III; him-5(e1490) V; otEx6863. C. elegans otEx6863 [srm-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14761 pha-1(e2123) III; him-5(e1490) V; otEx6864. C. elegans otEx6864 [srm-2p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14762 pha-1(e2123) III; him-5(e1490) V; otEx6865. C. elegans otEx6865 [srm-3p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14763 pha-1(e2123) III; him-5(e1490) V; otEx6866. C. elegans otEx6866 [srm-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14764 pha-1(e2123) III; him-5(e1490) V; otEx6867. C. elegans otEx6867 [srm-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14765 pha-1(e2123) III; him-5(e1490) V; otEx6868. C. elegans otEx6868 [srm-6p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14766 pha-1(e2123) III; him-5(e1490) V; otEx6869. C. elegans otEx6869 [srr-2p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14767 pha-1(e2123) III; him-5(e1490) V; otEx6870. C. elegans otEx6870 [srr-3p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14768 pha-1(e2123) III; him-5(e1490) V; otEx6871. C. elegans otEx6871 [srr-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14769 pha-1(e2123) III; him-5(e1490) V; otEx6872. C. elegans otEx6872 [srr-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14770 pha-1(e2123) III; him-5(e1490) V; otEx6873. C. elegans otEx6873 [srr-7p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14771 pha-1(e2123) III; him-5(e1490) V; otEx6874. C. elegans otEx6874 [srr-8p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14772 pha-1(e2123) III; him-5(e1490) V; otEx6875. C. elegans otEx6875 [srr-9p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14773 pha-1(e2123) III; him-5(e1490) V; otEx6876. C. elegans otEx6876 [srr-10p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14783 kyIs140 I; oig-8(ot818) II; otTi20. C. elegans kyIs140: [str-2::GFP + lin-15(+)] I. otTi20 [oig-8p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing oig-8p::oig-8 transgene.
OH14785 kyIs140 I; oig-8(ot818) II; otTi22. C. elegans kyIs140: [str-2::GFP + lin-15(+)] I. otTi22 [str-1p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing str-1p::oig-8 transgene.
OH14838 pha-1(e2123) III; him-5(e1490) V; otEx6909. C. elegans otEx6909 [srz-56p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14840 pha-1(e2123) III; him-5(e1490) V; otEx6911. C. elegans otEx6911 [srz-104p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14861 lite-1(ce314) X; otIs644. C. elegans otIs644 [tdc-1::ChR2::YFP]. Reporter contains 4.4 kb of tdc-1 promoter fused to ChR2::YFP; can be used for optogenetic stimulation of tyraminergic and octopaminergic neurons.
OH14864 kyIs140 I; oig-8(ot818) II; otTi24. C. elegans kyIs140: [str-2::GFP + lin-15(+)] I. otTi24 [ceh-36(prom3)::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing ceh-36(prom3)::oig-8 transgene.
OH1487 hse-5(tm472) III. C. elegans Partially penetrant sluggish. tm472 removes 1249nt following 15974 in B0285 (Acc#34533) and inserts an adenosine at position 17228. Putative molecular null allele.
OH14884 pha-1(e2123) III; him-5(e1490) V; otIs646. C.elegans otIs646 [srh-127p::GFP + pha-1(+)]. Robust GFP expression in ADL neurons. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979.
OH14888 daf-16(ot853[daf-16::mNG::3xFlag::AID*]) I; ieSi57 II; daf-2(e1370) III. C. elegans ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva U et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14891 daf-12(ot874[daf-12::TagRFP::3xFlag::AID*]) X. C. elegans Superficially wildtype. CRISPR/Cas9-engineered AID* conditional daf-12 allele. Reference: Aghayeva et al., PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14892 daf-3(ot875[daf-3::GFP::3xFlag]) X. C. elegans Superficially wildtype. GFP tag inserted into endogenous daf-3 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted
OH14896 daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID*]) X. C. elegans Superficially wildtype. CRISPR/Cas9-engineered AID* conditional daf-3 allele. Reference: Aghayeva et al., PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14897 daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; ieSi60 II; daf-2(e1370) III. C. elegans ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH149 ceh-23(ms23) III. C. elegans No obvious phenotype; partial effects on AiY interneuron differentiation; genotyped by PCR that covers the deletion in the ceh-23(ms23) allele.
OH14926 bnc-1(ot721) vsIs33 V. C. elegans vsIs33 [dop-3::RFP] V. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14935 otIs648. C.elegans otIs648 [hlh-3(fosmid)::GFP + ttx-3p::mCherry]. Transgene is expressed in HSN neurons. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979.
OH14945 daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; ieSi61 II; daf-2(e1370) III. C. elegans ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14946 ieSi57 II; daf-7(e1372) III; daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID*]) X. C. elegans ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-3 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14953 pha-1(e2123) III; him-5(e1490) V; otEx6946. C. elegans otEx6946 [sri-50p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14954 pha-1(e2123) III; him-5(e1490) V; otEx6947. C. elegans otEx6947 [srz-24p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14956 pha-1(e2123) III; him-5(e1490) V; otEx6949. C. elegans otEx6949 [srz-66p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14958 pha-1(e2123) III; him-5(e1490) V; otEx6951. C. elegans otEx6951 [srh-74p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14962 pha-1(e2123) III; him-5(e1490) V; otEx6955. C. elegans otEx6955 [srz-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14964 pha-1(e2123) III; him-5(e1490) V; otEx6957. C. elegans otEx6957 [sri-45p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14966 pha-1(e2123) III; him-5(e1490) V; otEx6959. C. elegans otEx6959 [srz-61p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14969 pha-1(e2123) III; him-5(e1490) V; otEx6961. C. elegans otEx6962 [srx-44p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14970 pha-1(e2123) III; him-5(e1490) V; otEx6963. C. elegans otEx6963 [srj-23p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14971 pha-1(e2123) III; him-5(e1490) V; otEx6964. C. elegans otEx6964 [srbc-7p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14973 pha-1(e2123) III; him-5(e1490) V; otEx6966. C. elegans otEx6966 [srw-119p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14975 pha-1(e2123) III; him-5(e1490) V; otEx6968. C. elegans otEx6968 [srj-13p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14984 daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID*]) X. C. elegans Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID* conditional daf-12 allele in daf-7(e1372) background (TIR1-less control). Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14986 ieSi57 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID*]) X. C. elegans ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-12 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14989 ieSi60 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID*]) X. C. elegans ieSi60 [myo-2p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. Pharyngeal muscle-specific depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH15034 otIs653. C. elegans otIs653 [srg-8p::mCherry + cho-1p::mCherry + srg-8p::nlg-1::spGFP1-10 + cho-1p::nlg-1::spGFP11]. GRASP labeling of ASK to AIA synapses. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH15039 pha-1(e2123) III; him-5(e1490) V; otIs625. C. elegans otIs625 [cat-1(fosmid)::SL2::mCherry::H2B + pha-1(+)]. Fosmid-based cat-1 reporter marks aminergic neurons.
OH15089 otIs657. C. elegans otIs657 [klp-6p::mCherry + flp-3p::mCherry + klp-6p::NLG1::GFP1-10 + flp-3p::NLG1::GFP11]. IL2-IL1 GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain.
OH15097 him-5(e1490) V; otIs541. C. elegans otIs541 [lim-6(intron4)::wCherry]. Red fluorescent reporter labels DVB neuron in males and hermaphrodites; also labels AVL, PVT, and 2 additional dim neurons in head. Hart MP & Hobert O. Nature. 2018; 553:165-170. PMID: 29323291.
OH15128 pha-1(e2123) III; him-5(e1490) V; otEx7020. C. elegans otEx7020 [srg-64p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH15134 pha-1(e2123) III; him-5(e1490) V; otEx7026. C. elegans otEx7026 [srn-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH15144 pha-1(e2123) III; otEx7036. C. elegans otEx7036 [pals-22p::GFP::unc-54 3'UTR + pha-1(+)]. Transcriptional reporter containing pals-22 promoter (coordinates -791 to -1 from start). Maintain at 25C to select for otEx7036. Reference: Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15145 pha-1(e2123) III; otEx7037. C. elegans otEx7037 [pals-22p::GFP::unc-54 3'UTR + pha-1(+)]. Translational reporter fusion containing pals-22 promoter (coordinates -791 to -1 from start). Maintain at 25C to select for otEx7037. Reference: Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15178 pals-22(ot810) III; otIs381 V. C. elegans otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. pals-22(ot810) mutant shows transgene-silencing phenotype. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15179 pals-22(ot811) III; otIs381 V C. elegans otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. pals-22(ot811) mutant shows transgene-silencing phenotype. Pan-neuronal nuclear GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15205 otEx7057. C. elegans Pick TagRFP+ animals to maintain. otEx7057 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Injected into N2. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15224 pha-1(e2123) III; otEx7074. C. elegans otEx7074 [inx-20(fosmid WRM066cA02)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15225 pha-1(e2123) III; otEx7075. C. elegans otEx7075 [inx-18a(fosmid WRM0629cH03)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15227 unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID*]) III. C. elegans unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID* (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID* cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, et al. Curr Biol. 2018 Sep 10;28(17):2813-2823.e2. doi: 10.1016/j.cub.2018.06.045. Epub 2018 Aug 23. PMID: 30146154.
OH15242 pha-1(e2123) III; otEx7090. C. elegans otEx7090 [inx-11(fosmid WRM0621cA09)::SL2::NLS::YFP::H2B + pha-1(+) + unc-122::GFP]. Maintain at 25C or pick GFP+ to retain array.
OH15244 pha-1(e2123) III; otEx7092. C. elegans otEx7092 [inx-18b(fosmid WRM0629cH03)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15262 otIs669 V. C. elegans otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15263 otIs670 V. C. elegans otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15265 otIs672. C. elegans otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. Bright panneuronal nuclear GCaMP6s expression. Reference: Yemini E, et al. https://www.biorxiv.org/content/10.1101/676312v1
OH15271 pha-1(e2123) III; otEx7102. C. elegans otEx7102 [inx-5(fosmid WRM0625cD05)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15272 pha-1(e2123) III; otEx7103. C. elegans otEx7103 [inx-14(fosmid WRM0626aA10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15273 pha-1(e2123) III; otEx7104. C. elegans otEx7104 [inx-13(fosmid WRM0621dC07)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15274 pha-1(e2123) III; otEx7105. C. elegans otEx7105 [inx-16(fosmid WRM0619cH12)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15275 pha-1(e2123) III; otEx7106. C. elegans otEx7106 [unc-7(fosmid WRM0627bH02)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15276 pha-1(e2123) III; otEx7107. C. elegans otEx7107 [inx-1b(fosmid WRM0672aB09)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15278 pha-1(e2123) III; otEx7109. C. elegans otEx7109 [unc-9(fosmid WRM0611aH10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15281 pha-1(e2123) III; otEx7112. C. elegans otEx7112 [che-7(fosmid WRM0640dF02)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15282 pha-1(e2123) III; otEx7113. C. elegans otEx7113 [inx-12(fosmid WRM0621dC07)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15285 pha-1(e2123) III; otEx7116. C. elegans otEx7116 [inx-1a(fosmid WRM0672aB09f)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15288 pha-1(e2123) III; otEx7119. C. elegans otEx7119 [inx-10a(fosmid WRM0628bH12):SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15291 pha-1(e2123) III; otEx7121. C. elegans otEx7121 [inx-3(fosmid WRM0636dA10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH153 cog-1(ot28) II. C. elegans No obvious phenotype.
OH15338 ceh-32(ok343) V; otEx7146. C. elegans otEx7146 [ceh-32(+) fosmid WRM0637dA10 + myo-2p::RFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH15363 otIs669 him-5(e1490) V C. elegans High incidence of males (Him). otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Not known where otIs669 maps relative to him-5. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15373 otIs683. C. elegans otIs683 [hlh-4(fosmid)::YFP + ttx-3p::mCherry]. Transgene is expressed in ADL neurons. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979.
OH15422 ceh-14(ot900) X. C. elegans Null allele generated by gRNAs targeted to the first and last exons of ceh-14, resulting in a 4061bp deletion from +35 to +4098 relative to the start of the ORF.
OH15430 pha-1(e2123) III; otIs669 V. C. elegans Maintain at 15C. Temperature-sensitive. Slow growing. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15439 ceh-34(ot903[ceh-34::mNG::3xFLAG::AID*]) V. C. elegans CRISPR/Cas9-engineered insertion of mNeonGreen::3xFLAG::AID* tags into endogenous ceh-34 locus. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH15487 otIs695. C. elegans otIs695 [nlp-3p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH15493 pha-1(e2123) III; otIs669 V; otEx7202. C. elegans otEx7202 [gbb-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15495 otIs696. C. elegans otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. Insertion site unknown, but not on LG V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15499 pha-1(e2123) III; otIs669 V; otEx7206. C. elegans otEx7206 [mgl-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15500 otIs669 V; otIs672. C. elegans otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Bottlenecked 23x for isogenicity. Slow growing. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15511 pha-1(e2123) III; otIs669 V; otEx7209. C. elegans otEx7209 [gar-2(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15518 pha-1(e2123) III; otIs669 V; otEx7215. C. elegans otEx7215 [mgl-3(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15519 pha-1(e2123) III; otIs669 V; otEx7216. C. elegans otEx7216 [gar-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15528 him-5(e1490) V; otIs696. C. elegans High incidence of males (Him). otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15530 pha-1(e2123) III; otEx7225. C. elegans otEx7225 [eat-5(fosmid WRM0621dG04)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15532 pha-1(e2123) III; otEx7227. C. elegans otEx7227 [inx-9(fosmid WRM0632dA04)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15538 him-5(e1490) V; otEx7231. C. elegans otEx7231 [srg-8p::rab-3::GFP + srg-8p::mCherry]. Pick animals with mCherry expression to maintain. Presynaptic RAB-3::GFP reporter for ASK neurons with cytoplasmic ASKp::mCherry in the background. Reference: Majeed M, et al. Elife. 2024 Jan 15:12:RP91775. doi: 10.7554/eLife.91775. PMID: 38224479.
OH15540 pha-1(e2123) III; otEx7232. C. elegans otEx7232 [inx-15(fosmid WRM0619cH12)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15542 pha-1(e2123) III; otEx7233. C. elegans otEx7233 [inx-19(extended fosmid WRM0632bE10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15555 pha-1(e2123) III; otIs669 V; otEx7244. C. elegans otEx7244 [mgl-2(7.9k)::GFP + inx-6(prom18)::TagRFP + pha-1(+)]. 7.9 kb fragment used in otEx7244 reporter covers full mgl-2 5' promoter region. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15566 inx-2(ot906 [inx-2::SL2::NLS::yfp::H2B]) X. C. elegans inx-2(ot906) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-2 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15568 unc-17(ot907[unc-17::mKate2::3xflag]) IV. C. elegans Superficially wild-type. mKate2 and 3xFlag tag added to endogenous unc-17 locus. unc-17::mKate2 labels all cholinergic neurons in the nervous system. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
OH15579 che-1(ot908 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. C. elegans ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).
OH15655 otIs711. C. elegans otIs711 [nlp-8p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH15683 che-1(ot871 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. C. elegans ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).
OH15689 pha-1(e2123) III; otEx7292. C. elegans otEx7292 [inx-7(fosmid WRM0631dH08)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15691 otEx7294. C. elegans otEx7294 [inx-8(fosmid WRM0632dA04)::SL2::NLS::YFP::H2B + rol-6(su1006)]. Pick Rollers to maintain.
OH1571 tax-2(ot25) otIs114 I; him-5(e1490) V. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic lim-6 expression in a set of cells anterior to ASE. Molecular identity: W40Stop. Null allele.
OH15732 mab-3(ot931[mab-3::GFP::3xFlag]) II; him-5 (e1490) V. C. elegans GFP and 3xFlag tag inserted in endogenous mab-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: ggtcaaaattatagatctt Insertion site: II: 9737290-9737291. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
OH15733 dmd-3(ot932[dmd-3::GFP::3xFlag]); him-8 (e1489) IV. C. elegans GFP and 3xFlag tag inserted in endogenous dmd-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: accctttcagccgtattgt Insertion site: V: 19650564-19650565. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
OH158 zig-4(gk34) X. C. elegans C09C7.1 Deletion breakpoints at position 237 and 803 with insertion of CTTGTATAGCAAGAAACC at this breakpoint. Predicted molecular null. About 30% penetrance of displaced axons in the ventral nerve cord. Homozygous viable.
OH15814 him-5(e1490) V; dmd-4(ot935[dmd-4::GFP]) X. C. elegans GFP tag inserted into endogenous dmd-4 locus to create a C-terminal translational GFP fusion.
OH15815 che-1(ot63 ot941[che-1::SEC-GFP::TEV::3xFLAG]) I. C. elegans ot941[che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying ot63 null alllele and tagged with GFP (che-1::SEC-GFP::TEV::3xFLAG). che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.
OH15845 daf-16(ot853[daf-16::mNG::AID*]) I; daf-2(e1370) III; otIs730. C. elegans otIs730 [UPNp::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH15862 him-5 (e1490) V; otEx7353. C. elegans otEx7353 [UPN::tagRFP::TRA-1(active) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Nervous system-specific expression of a TRA-1 gain-of-function construct. UPN is a concatenated panneuronal promoter (containing promoter fragments from unc-11, rgef-1, ehs-1, and ric-19). TRA-1(active) is a shortened version of the TRA-1A cDNA (860aa) predicted to encode the proteolytically activated version of TRA-1A generated by C-terminal cleavage in hermaphrodites (Schvarzstein and Spence 2006).
OH15876 pha-4(ot946[pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]) V. C. elegans GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain.
OH15881 otEx7363. C. elegans otEx7363 [flp-3p::mCherry + flp-3p::GFP::cla-1 + unc-122p::GFP]. Pick GFP+ animals to maintain. Presynaptic GFP::cla-1 reporter for IL1 neurons with cytoplasmic IL1p::mCherry in the background. Reference: Majeed M, et al. Elife. 2024 Jan 15:12:RP91775. doi: 10.7554/eLife.91775. PMID: 38224479.
OH1589 lin-23(ot1) II; oxIs12 X; otEx840. C. elegans otEx840 [lin-23::GFP + rol-6(su1006)]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers.
OH15908 him-5(e1490) V; dmd-4(ot957ot935) X. C. elegans CRISPR-engineered deletion in dmd-4(ot935[dmd-4::GFP]) removing +3201 to +3710 relative to start codon. Partial removal of intron 3 results in loss of somatic nervous system expression without affecting pharyngeal expression.
OH15910 lin-11(ot958[lin-11::GFP::FLAG]) I. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous lin-11 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH15912 vab-7(ot959[vab-7::GFP::FLAG]) III. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous vab-7 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH15913 daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID*]) X; otIs730. C. elegans otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH160 otIs76 mgIs18 IV; lon-2(e678) hst-6(ot17) X. C. elegans otIs76 [pttx-3p::kal-1 + unc-122p::GFP] IV. mgIs18 [ttx-3p::GFP] IV. Long, otherwise phenotypically WT. ttx-3p::GFP labels AIY interneurons. hst-6(ot17) suppresses the branching phenotype of KAL-1 overexpression in AIY. hst-6(ot17) is closely linked to lon-2.
OH16003 otIs742. C. elegans otIs742 [nlp-13p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH16020 exc-7(ot970[exc-7::gfp]) II. C. elegans Superficially wild-type. GFP inserted into endogenous exc-7 locus by CRISPR/Cas9. Reference: Pham K & Hobert O. MicroPubl Biol. 2019; 2019: 10.17912/micropub.biology.000189.
OH16024 daf-16(ot971[daf-16::GFP]) I. C. elegans CRISPR allele of daf-16, tagged at the C-terminus with GFP. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.
OH16029 daf-16(ot975[daf-16::mNeptune2.5::AID*]) I. C. elegans CRISPR allele of daf-16, tagged at the C-terminus with mNeptune2.5::AID*. Reference: Aghayeva U, et al. MicroPubl Biol. 2020 Jan 7;2020:10.17912/micropub.biology.000210. doi: 10.17912/micropub.biology.000210. PMID: 32550509
OH16047 eat-5(ot980[eat-5::GFP]) I. C. elegans GFP tag with 6x GS linker inserted at C-terminus of endogenous eat-5 locus.
OH16085 otIs748 X. C. elegans otIs748 [rab-3p(prom1)::GFP + ttx-3p::mCherry] X. Pan-neuronal cytoplasmic GFP expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH161 ttx-3(ot22) X. C. elegans Thermotaxis defective (cryophilic). Null allele.
OH16103 otDf1X. C. elegans otDf1is a deletion obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method removing ceh-41, ceh-21, T26C11.9, and ceh-39. 8968 bp deletion, from position -159 upstream ceh-39 ATG, to +1608 from ATG ceh-41 (+89 from STOP ceh-41).
OH16111 unc-42(ot986[unc-42::gfp]) V. C. elegans GFP tag inserted at the C-terminus of the endogenous unc-42 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Berghoff EG, et al. Elife. 2021 Jun 24;10:e64903. doi: 10.7554/eLife.64903. PMID: 34165428
OH16219 ceh-44(ot1015[ceh-44::gfp]) III. C. elegans GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method.
OH16224 ceh-49(ot1016[ceh-49::gfp]) V. C. elegans GFP tag inserted at the C-terminus of the endogenous ceh-49 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method.
OH16230 otIs670 V; otIs672. C. elegans otIs672 [rab-3::NLS::GCaMP6s + arrd-4::NLS::GCaMP6s]. otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16263 otEx7457. C. elegans otEx7457 [sri-9::mCherry + sri-9p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ADL>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain.
OH16265 otEx7459. C. elegans otEx7459 [srh-18::mCherry + srh-18p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ASH>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain.
OH16289 otIs696; wtfIs5. C. elegans wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16290 otIs670 V; wtfIs5. C. elegans wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16294 nono-1(ot1018[nono-1::gfp::3xflag]) III. C. elegans Superficially wild-type.
OH16298 him-8(e1489) IV; otIs670 V. C. elegans Him. [NOTE: strain does not segregate many male progeny.] otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16335 ceh-34(ot1014) V; otEx7476. C. elegans otEx7476 [ceh-34(fosmid) + myo-3p::mCherry]. Pick mCherry+ to maintain. ot1014 is a CRISPR/Cas9-engineered allele removing the entire ceh-34 locus. ot1014 homozygotes arrest as L1 larvae. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH16345 ceh-37(ot1023[ceh-37::GFP::FLAG]) X. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-37 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16366 pha-1(e2123) III; otIs669 V; otEx7484. C. elegans otEx7484 [ceh-13::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16367 pha-1(e2123) III; otIs669 V; otEx7485. C. elegans otEx7485 [ceh-28::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16368 pha-1(e2123) III; otIs669 V; otEx7486. C. elegans otEx7486 [ceh-12::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16369 pha-1(e2123) III; otIs669 V; otEx7487. C. elegans otEx7487 [ceh-17::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16370 pha-1(e2123) III; otIs669 V; otEx7488. C. elegans otEx7488 [ceh-45::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16371 pha-1(e2123) III; otIs669 V; otEx7489. C. elegans otEx7489 [nsy-7::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16376 ceh-44(ot1028) III. C. elegans ot1028 = 80bp deletion on Exon 8 (first exon isoform A - isoform with CUT domains), leading to a frameshift and early stop codon in Exon 8 expected to affect only isoform A. Deletion coordinates: +9069 to +9148. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. ot1028 is molecularly identical to ot1031.
OH16377 ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs356 V; otDf1 X. C. elegans otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. CUT Sextuple mutant animals show reduced pan-neuronal gene expression, impaired locomotion and resistance to aldicarb induced paralysis. otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341.
OH16380 nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X. C. elegans Endogenous nlp-45 locus tagged with GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16391 otEx7501. C. elegans otEx7501 [pdfr-1::GFP::cla-1 + pdfr-1::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Presynaptic GFP::cla-1 reporter for pharyngeal I1 neurons. Reference: Cook SJ, et al. J Comp Neural. 2020 Nov 1;528(16):2767-2784. doi: 10.1002/cne.24932. PMID: 32352566.
OH16395 otEx7505. C. elegans otEx7505 [ceh-19p::GFP::cla-1 + ceh-19p::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Presynaptic GFP::cla-1 reporter for pharyngeal MC neurons. Reference: Cook SJ, et al. J Comp Neural. 2020 Nov 1;528(16):2767-2784. doi: 10.1002/cne.24932. PMID: 32352566.
OH16398 otIs763. C. elegans otIs763 [lin-4(fosmid)::NLS::YFP::H2B]. Integrated fosmid transcriptional reporter for lin-4 microRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16445 cdh-1(ot1034) III. C. elegans CRISPR/Cas9 engineered deletion of full cdh-1 locus.
OH16446 cdh-3(ot1035) III. C. elegans CRISPR/Cas9 engineered deletion of full cdh-3 locus.
OH16461 ama-1(ot1037[gfp::ama-1]) IV. C. elegans Superficially wild-type.
OH16463 smo-1(ot1038[smo-1::gfp::3xflag]) I. C. elegans Superficially wild-type.
OH16464 fust-1(ot1039[fust-1::gfp::3xflag]) II. C. elegans Superficially wild-type.
OH16479 pha-1(e2123) III; otIs669 V; otEx7569. C. elegans otEx7569 [ceh-81::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16480 pha-1(e2123) III; otIs669 V; otEx7570. C. elegans otEx7570 [ceh-91::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16481 pha-1(e2123) III; otIs669 V; otEx7571. C. elegans otEx7571 [ceh-99::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16482 rpc-1(ot1041[rpc-1::gfp::3xflag]) IV. C. elegans Superficially wild-type.
OH16487 ceh-76(ot1042[ceh-76::GFP]) V. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-76 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16499 nlp-45(ot1046) X. C. elegans Presumed null allele nlp-45. ot1046 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16500 nlp-45(ot1047) X. C. elegans Presumed null allele nlp-45. ot1047 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16505 ceh-89(ot1050[ceh-89::GFP]) X. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-89 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16508 daf-16(ot975[daf-16::mNeptune2.5::3xFlag::AID*]) I; daf-2(e1370) III; otIs730. C. elegans otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH16543 unc-39(ok2137) V; otEx7581. C. elegans otEx7581 [unc-39(+) fosmid WRM0636cG07 + inx-6(prom18)::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH16551 him-8(e1489) IV; mab-23(ot1057[mab-23::GFP::3xFLAG]) V. C. elegans GFP::3xFLAG tag inserted at C-terminus of endogenous mab-23 locus. Him. crRNA1: AATGACTAGATCAATGACG crRNA2: CGTCATTGATCTAGTCATT Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH16552 dmd-5(ot1058[dmd-5::GFP::3xFLAG]) II; him-5(e1490) V. C. elegans GFP::3xFLAG tag inserted at C-terminus of endogenous dmd-5 locus. Him. crRNA1: CATCGTTTAATGAAAAATG. crRNA2: CATTTTTCATTAAACGATG. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH16554 him-8(e1489) IV; dmd-7(ot1060[dmd-7::GFP::3xFLAG]) V. C. elegans GFP::3xFLAG tag inserted at C-terminus of endogenous dmd-7 locus. Him. crRNA1: CATGTGCTCATTTCTGTTG. crRNA2: CAACAGAAATGAGCACATG. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH16555 him-8(e1489) IV; dmd-8(ot1061[dmd-8::GFP::3xFLAG]) V. C. elegans GFP::3xFLAG tag inserted at C-terminus of endogenous dmd-8 locus. Him. crRNA1: AATTGCAGCGCTAAGCTCA. crRNA2: TGAGCTTAGCGCTGCAATT. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH16557 him-8(e1489) IV; dmd-10(ot1063[dmd-10::GFP::3xFLAG]) V. C. elegans GFP::3xFLAG tag inserted at C-terminus of endogenous dmd-10 locus. Him. crRNA1: ATGTCATTACAGTTTGATT. crRNA2: AATCAAACTGTAATGACAT. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH16563 ceh-45(ot1065) I. C. elegans ot1065 is a CRISPR/Cas9-engineered allele removing the entire ceh-45 locus. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH16564 ceh-53(ot1066) IV. C. elegans ot1066 is an engineered deletion of the full ceh-53 locus. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425
OH16565 ceh-79(ot1067) V. C. elegans ot1067 is an engineered deletion of the full ceh-79 locus. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425
OH16636 pha-1(e2123) III; otIs669 him-5(e1490) V; otEx7603. C elegans otEx7603 [nlp-52p::GFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. The nlp-52 reporter construct contains the full intergenic region of nlp-52 as the promoter. GFP expression in a subset of cells of the nervous system. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
OH1670 him-5(e1490) V; otIs123. C. elegans otIs123 [sra-11::GFP + unc-4(+)]. Might contain an unc-4 mutation in the background.
OH16700 otIs785. C. elegans otIs785 [ceh-34p::GFP::CLA-1 + ceh-34p::TagRFP + rol-6(su1006)]. Rollers. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH16704 fox-1(ot1081[fox-1::gfp::3xflag]) X. C. elegans Superficially wild-type.
OH16737 otIs788. C. elegans otIs788 [cat-4p::GFP::cla-1 + cat-4p::mCherry + inx-16p::tagRFP]. GFP-tagged CLA-1 provides a synaptic marker in HSN neurons. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH16739 casy-1(ot1082) II. C. elegans CRISPR/Cas9 engineered deletion of full casy-1 locus.
OH16748 otIs790. C. elegans otIs790 [UPN::npp-9::mCherry::blrp::3xFlag]. otIs790 contains a pan-neuronal INTACT tag for pull-down of all neuronal nuclei. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16750 cdh-8(ot1084) IV. C. elegans CRISPR/Cas9 engineered deletion of full cdh-8 locus.
OH16765 otIs794. C. elegans otIs794 [cho-1(fosmid)::NLS::SL2::YFP::H2B + eat-4(fosmid)::SL2::LSSmOrange::H2B + unc-47p::tagBFP2 + cat-1p::mMaroon + rab-3p1::2xNLS::tagRFP]. cho-1 fosmid reporter construct labels cholinergic neurons. eat-4 fosmid reporter construct labels glutamatergic neurons. unc-47p::tagBFP2 reporter (contains -2778 to -1 promoter region) labels GABAergic neurons. cat-1p::mMaroon reporter (contains -1599 to -1) labels monoaminergic neurons. rab-3p::tagRFP (contains -1462 to +2921 of prom1) labels all neurons (pan-neuronal marker). Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH16772 fmi-1(ot1090) V. C. elegans CRISPR/Cas9 engineered deletion of full fmi-1 locus.
OH16773 cdh-12(ot1091) III. C. elegans CRISPR/Cas9 engineered deletion of full cdh-12 locus.
OH16774 cdh-1(ot1092[cdh-1::T2A::GFP::H2B]) III. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-1 locus.
OH16783 cdh-9(ot1095[cdh-9::T2A::GFP::H2B]) X. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-9 locus.
OH16790 him-8(e1489) IV; lin-14(cc2841[lin-14::gfp]) X; otEx7578. C. elegans otEx7578 [rab-3p::fem-3::SL2::TagRFP + inx-6(prom18)::TagRFP]. Panneuronal overexpression of fem-3 causes panneuronal masculation. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16795 otEx7677; nlp-45(ot1046) X. C. elegans otEx7677 [mgl-1p::nlp-45 cDNA::SL2::TagRFP::p10 3'UTR + inx-6(prom18)::TagRFP]. Pick RFP+ to maintain. Over-expression of nlp-45 in the RMDD/V neurons in nlp-45 mutant background. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16799 otEx7681; nlp-45(ot1046) X. C. elegans otEx7681 [glr-3p::nlp-45 cDNA::SL2::TagRFP::p10 3'UTR + inx-6(prom18)::TagRFP]. Pick RFP+ to maintain. Overexpression of nlp-45 in the RIA neurons in nlp-45 mutant background. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16816 otIs809. C. elegans otIs809 [glr-7::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH16830 cdh-8(ot1106[cdh-8::T2A::GFP::H2B]) IV. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-7 locus.
OH16831 npr-17(ot1101[npr-17::GFP]) IV. C. elegans Endogenous npr-17 locus tagged with GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16834 otTi71. C. elegans otTi71 [UPN::lin-4::unc-54 3’UTR]. single copy insertion of panneuronally expressed lin-4 pri-miRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16836 otIs669 V; otIs115. C. elegans otIs115 [gcy-12p::GFP]. Integrated promoter fusion reporter for gcy-12. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. References: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2. Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16837 him-8(e1489) IV; nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X; otEx7578. C. elegans otEx7578 [rab-3p::fem-3::SL2::TagRFP + inx-6(prom18)::TagRFP]. Panneuronal overexpression of fem-3 causes panneuronal masculation. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
OH16848 him-5(e1490)V; otIs518; otIs773. C. elegans otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. otIs773 [inx-19(fosmid)::SL2::YFP::H2B + unc-122::GFP + pha-1(+)]. Integrated fosmid transcriptional reporter for inx-19.
OH16866 otIs810. C. elegans otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1]. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH16932 casy-1(ot1108[casy-1::T2A::GFP::H2B]) II. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous casy-1 locus.
OH16971 otIs816. C. elegans otIs816 [klp-6p::mCherry + klp-6p::GFP::cla-1]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH17000 cdh-3(ot1096[cdh-3::T2A::GFP::H2B]) III. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-3 locus.
OH17002 cdh-10(ot1118[cdh-10::T2A::GFP::H2B]) IV. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-10 locus.
OH17030 cdh-12(ot1119[cdh-12::T2A::GFP::H2B]) III. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-12 locus.
OH17051 ceh-48(ot1125[ceh-48::GFP]) IV. C. elegans GFP tag inserted at the C-terminus of the endogenous ceh-48 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH17055 ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otDf1 X; otIs790. C. elegans otIs790 [UPN::npp-9::mCherry::blrp::3xflag]. otIs790 contains a pan-neuronal INTACT tag for pull-down of all neuronal nuclei. CUT sextuple-mutant background. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH17058 cdh-5(ot1127[cdh-5::T2A::GFP::H2B]) IV. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-5 locus.
OH17064 daf-16(ot971[daf-16::GFP]) otDf2 I. C. elegans otDf2 is a 25,484 bp deletion of the insulin cluster from Chr I, removing ins-28, ZC334.13, ins-29, ins-25, ins-27, linc-124, ZC334.12, ZC334.17, ins-24, ins-30, and ins-26. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH17072 otIs833. C. elegans otIs833 [egas-4p::TagRFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH171 otEx103. C. elegans otEx103[lim-7::GFP; rol-6(su1006)]. <50% penetrant Roller line. Maintain by picking Rollers. GFP strongly expressed in gonad sheath cell pair 1.
OH17156 cdh-5(ot1093) IV; him-5(e1490) V; dzIs89 X. C. elegans dzIs89 [inx-1p::BirA::nrx-1 + gcy-13p::AP::nlg-1 + gcy-13p::tagBFP + unc-122p::stretavadin::tagRFP] X. cdh-5(ot1093) is a CRISPR/Cas9 engineered deletion of full cdh-5 locus. Reference: Majeed M, et al. Sci Adv. 2025 Feb 21;11(8):eads2852. doi: 10.1126/sciadv.ads2852. PMID: 39983000.
OH172 lin-15B&lin-15A(n765) X; otEx105. C. elegans otEx105 [lim-7::GFP + lin-15(+)]. Highly penetrant line, but non-Muv/Muv does not correlate well with presence/absence of extrachromosomal array. Maintain by picking GFP-positive animals under GFP-dissecting scope. GFP strongly expressed in gonad sheath cell pair 1.
OH17217 otIs846. C. elegans otIs846 [egas-1p::GFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH17225 otEx7760. C. elegans otEx7760 [cat-4p::mCherry + zig-3p::mCherry + zig-3p::NLG1::GFP1-10 + cat-4p::NLG1::GFP11 + inx-6(prom18)::TagRFP]. BDU-HSN GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain.
OH17241 unc-86(ot1158) III. C elegans unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
OH17294 npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV; otIs669 him-5(e1490) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH17368 otIs854. C. elegans otIs854 [unc-39p::tagRFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH17492 him-5(e1490) V; otEx7809. C. elegans otEx7809 [flp-7p::TagRFP + inx-1::tagRFP + flp-7p::NLG1::GFP1-10 + inx-1p::NLG1::GFP11]. Him. AIB-SAA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain.
OH17502 otIs867. C. elegans otIs867 [srh-71p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH17513 unc-86(ot1184) III; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. C. elegans Null allele of unc-86 generated by gRNAs targeted to the first and last exons, resulting in a 3202 bp deletion from -8 to +3194 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH17514 ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V; ceh-14(ot1185) X. C. elegans Null allele of ceh-14 generated by gRNAs targeted to the first and last exons, resulting in a 4056 bp deletion from +40 to +4096 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH17515 unc-30(ot1186) IV; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. C. elegans Null allele of unc-30 generated by gRNAs targeted to the first and last exons, resulting in a 5168 bp deletion from -37 to +5131 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH17582 daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II; daf-2(e1370) III. C. elegans otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Temperature-senstive daf(c): maintain at 15C. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Constitutive dauer formation at 25 C due to daf-2(e1370). Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH17657 unc-39(syb4537ot1193[unc-39p(bs_del)::unc-39::gfp]) V. C. elegans ot1193 is a CRISPR-engineered mutation of a small unc-39 auto-regulatory region containing a cluster of several predicted homeodomain binding sites in the endogenously-tagged unc-39(syb4537) reporter strain. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH17726 unc-3(ot5008) X. Pristionchus pacificus severe unc
OH17751 otEx7895. C. elegans otEx7895 [nmr-1p::CyoFP + flp-3p::mNeptune + gcy-35p::mNeptune flp-7p::tagRFP + klp-6::tagRFP + C42D4.1::GFP]. Pick animals with red or green fluorescence to maintain. AxoPAL strain for visualizing axonal neighborhoods. Reference: Majeed M, et al. Sci Adv. 2025 Feb 21;11(8):eads2852. doi: 10.1126/sciadv.ads2852. PMID: 39983000.
OH17766 ins-3(syb5421[ins-3::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17767 ins-6(syb5463[ins-6::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
OH17768 ins-24(syb5447[ins-24::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17801 him-5(e1490) V; otIs870. C. elegans otIs870 [mir-228p::3xNLS::TagRFP] Pan-glial expression of tagRFP reporter. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
OH17826 ins-30(syb5526[ins-30::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17870 lin-11(ot1026) I; unc-17(syb4491[unc-17::T2A::GFP::H2B]) IV; otIs669 him-5(e1490) V. C. elegans Egl. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17874 Cbr-dpy-10(ot1210) II. C. briggsae Dpy Rol. Heterozygotes are Left-handed Rol. R92C mutation in Cbr-dpy-10 generated via CRISPR/Cas9. Homologous to the C. elegans dpy-10(cn64) mutation.
OH17918 lep-5(ot1215[lep-5p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. C. elegans The Null Transcriptional Reporter (NuTR) cassette was used to remove the lep-5 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. Males exhibit typical leptoderan tails.
OH17921 linc-3(ot1217[linc-3p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) V. C. elegans The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-3 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.
OH17923 linc-19(ot1219[linc-19p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) III. C. elegans The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-19 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.
OH17929 linc-23(ot1225[linc-23p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. C. elegans The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.
OH17932 linc-26(ot1227[linc-26p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. C. elegans The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad and extremely dim expression in hermaphrodite spermatheca.
OH17935 linc-36(ot1229[linc-36p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. C. elegans The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-36 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the sperm of both hermaphrodites and males.
OH17938 linc-41(ot1231[linc-41p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. C. elegans The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-41 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad, spermatheca of hermaphrodites, as well as several other tissues in the head.
OH17942 tts-1(ot1234[tts-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. C. elegans The Null Transcriptional Reporter (NuTR) cassette was used to remove the tts-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in several tissues including the pharynx but is significantly upregulated in a stress-dependent manner in a variety of tissues.
OH17945 puf-9(ot1236[puf-9::GFP::loxP::3xFLAG]) X. C. elegans SEC cassette was used to generate a C-terminal GFP tag of puf-9. Expression is cytoplasmic and pan-somatic throughout larval development into adults.
OH17963 otIs879. C. elegans otIs879 [sri-1p::NLS::GFP + pha-1(+)]. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17994 cdh-4(ot1246) III. C. elegans CRISPR/Cas9 engineered deletion of full cdh-4 locus.
OH17995 cdh-9(ot1247) X. C. elegans CRISPR/Cas9 engineered deletion of full cdh-9 locus.
OH18019 linc-1(ot1249[linc-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. C. elegans The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.
OH18043 rab-3(ot1178 syb3072) II; him-8(e1489) IV. C. elegans CRISPR-engineered mutation of CUT transcription factor binding site in endogenously-tagged rab-3(syb3072[rab-3::T2A::3xNLS::GFP]). Causes a reduction in rab-3 expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH18062 nlp-11(syb4759[nlp-11::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH18108 otIs669 V; nlp-66(syb4403[nlp-66:SL2:GFP::H2B])X. C. elegans GFP tag inserted at the C-terminus of the endogenous nlp-66 locus by CRISPR. Allele generated by SUNY Biotech. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH18111 ttx-1(syb1679[ttx-1::GFP]) ot1264) V. C. elegans ot1264 is a CRISPR deletion removing -10.8 kb to -1.8 kb before the first exon of ttx-1, made in the context of the ttx-1::GFP allele syb1679. Notably ttx-1 expression in RIB is lost, and RIB markers are off or dim. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH18145 otIs883. C. elegans otIs883 [srab-20p::GFP::cla-1 + unc-122p::mCherry]. Presynaptic GFP::cla-1 reporter for PHB neurons. Reference: Majeed M, et al. Elife. 2024 Jan 15:12:RP91775. doi: 10.7554/eLife.91775. PMID: 38224479.
OH18190 unc-4(ot5018) II. Pristionchus pacificus unc
OH18203 ceh-44(ot1294[*ot1015[ceh-44::gfp]]) III. C. elegans ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. Reporter expression is not affected. Please contact Oliver Hobert prior to publishing work using this strain.
OH18237 lim-6(ot1312) X. C.elegans Full gene deletion of the lim-6 locus (-51 to +5144) by CRISPR. Please contact Oliver Hobert prior to publishing work using this strain.
OH18268 ceh-44(ot1402[*ot1015[ceh-44::gfp]]) III. C. elegans ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1402 is a deletion removing the UNC-75 binding site within intron 7 of the endogenously-tagged ceh-44 locus. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH18297 spig-2(ot1324[spig-2::SL2::GFP::T2A::H2B *syb6670]) V. C. elegans Derived by CRISPR edit of spig-2(syb6670[spig-2::SL2::GFP::H2B]) in parental strain PHX6670 to insert T2A was inserted between GFP and H2B to convert the reporter from nuclear to cytoplasmic localization. Reference: Aguilar GR & Hobert O. (2024). A protocol to transform a fluorescent reporter from a nuclear to a cytoplasmic location. microPublication Biology. https://doi.org/10.17912/micropub.biology.000954
OH18320 ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I. C. elegans ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH18398 otIs669 him-5(e1490) V; unc-6(syb5064[unc-6::SL2::GFP::H2B]) X. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
OH18410 cone-1(syb5437[GFP::cone-1]) ceh-44(ot1294[*ot1015[ceh-44::gfp]]) III. C. elegans GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. Normally broad, punctate expression of GFP::CEH-44 is not present. Please contact Oliver Hobert prior to publishing work using this strain.
OH18463 unc-75(ot1351) I; ceh-44(ot1015[ceh-44::GFP]) III. C. elegans ot1351 is a CRISPR-engineered deletion of unc-75 gene rendering all 3 RNA recognition motifs null on unc-75; reduces pan-neuronal nuclear GFP expression fluorescence. GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Please contact Oliver Hobert prior to publishing work using this strain.
OH18465 ceh-38(tm321) II; ceh-44(ot1015[ceh-44::gfp]) III; ceh-48(tm6112) IV; otDf1 X. C. elegans ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. CUT Quintuple-mutant background. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH1849 pha-1(e2123) III; otEx980. C. elegans otEx980 [dop-2::GFP + pha-1(+)].
OH18501 aex-1(ot1357) I. C. elegans ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH18508 daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. C. elegans ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH18512 pha-1(e2123) III; otEx8085. C. elegans otEx8085 [pha-4(prom2)::GFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to select for animals carrying the array. pha-4 cis-regulatory element drives expression specifically in all 20 pharyngeal enteric neurons, 2 hindgut enteric neurons, as well as RIS and PVT. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH18559 him-5(e1490) V; otIs810. C. elegans otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1].
OH18562 unc-119(ed3) III; otIs898[*oxTi553] V. C. elegans otIs898 [pha-4prom2::3xNLS::ceGCaMP6s::unc-54 3' UTR]. Neuron-specific cis regulatory fragment of pha-4 driving expression of C. elegans codon-optimized GCaMP6s in enteric neurons. The multicopy array was inserted at the oxTi553 landing site (EG7944) by FLInt. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH18594 Cbr-eat-4(ot1371[Cbr-eat-4::T2A::GFP::H2B]) III. C. briggsae T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18595 unc-25(ot1372[unc-25::T2A::GFP::H2B] III. C. elegans Endogenous unc-25 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
OH18596 Cbr-unc-25(ot1373[Cbr-unc-25::T2A::GFP::H2B]) III. C. briggsae T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18614 hlh-13(ot1388) X. C. elegans CRISPR/Cas9-engineered deletion removing entire hlh-13 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
OH18615 hlh-15(ot1389) X. C. elegans CRISPR/Cas9-engineered deletion removing entire hlh-15 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
OH18619 lim-6(ot1391[lim-6::GFP]) X. C. elegans C-terminal GFP tag inserted before STOP codon of endogenous lim-6 locus using CRISPR/Cas9. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18624 Ctr-lim-6(ot1392[Ctr-lim-6::GFP]) X. C. tropicalis C-terminal GFP tag inserted before STOP codon of endogenous Ctr-lim-6 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18640 Cbr-lim-6(ot1393[Cbr-lim-6::GFP]) X. C. briggsae C-terminal GFP tag inserted before STOP codon of endogenous Cbr-lim-6 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18653 ins-2(syb6543[ins-2::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
OH18671 Ctr-unc-25(ot1397[Ctr-unc-25::T2A::GFP::H2B]) III. C. tropicalis T2A::GFP::H2B tag inserted before STOP codon of endogenous Ctr-unc-25 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18694 col-105(syb6767[col-105::SL2::GFP::H2B]) him-8(e1489) IV. C. elegans Endogenous locus tagged with SL2::GFP::H2B at C-terminus using CRISPR/Cas9. The reporter is linked to him-8(e1489) in the background. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
OH18707 otIs904 V. C. elegans otIs904 [ges-1p::ins-1::tagRFP-T::SL2::GFP::his-44::tbb-2 3’ UTR + inx-6p18::tagRFP::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of INS-1 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH18749 cone-1(ot1409[*syb5437[GFP::con-1]) III. C. elegans syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1409 is a deletion removing exons 1-7 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.
OH18750 cone-1(ot1410[*syb5437[GFP::con-1]) III. C. elegans syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1410 is a deletion removing exon 5 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.
OH18755 unc-30(ot5019) IV. Pristionchus pacificus unc
OH1876 hst-2(ok595) X. C. elegans
OH18772 ins-5(syb6245[ins-5::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
OH18779 unc-25(ot5020) III. Pristionchus pacificus unc
OH18821 nlp-18(ot1421[nlp-18::SL2::GFP::H2B]) II. C. elegans SL2::GFP::H2B tag inserted after STOP codon of endogenous nlp-18 locus using CRISPR/Cas9. The 15 first nucleotides of the standard SL2 sequence (immediately downstream of nlp-18 STOP) are missing but bright GFP fluorescence is clearly detectable. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18826 Ctr-nlp-11(ot1422[Ctr-nlp-11::SL2::GFP::H2B]) II. C. tropicalis SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-11 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18829 Cbr-nlp-3(ot1423[Cbr-nlp-3::SL2::GFP::H2B]) X. C. briggsae SL2::GFP::H2B tag inserted after STOP codon of endogenous Cbr-nlp-3 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18832 Cbr-nlp-18(ot1424[Cbr-nlp-18::SL2::GFP::H2B]) II. C. briggsae SL2::GFP::H2B tag inserted after STOP codon of endogenous Cbr-nlp-18 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18835 ins-7(ot1427) IV. C. elegans ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH18840 hlh-32(ot1347) IV. C. elegans CRISPR/Cas9-engineered 1691 bp deletion removing entire hlh-32 locus; similar to syb6773 deletion. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
OH18853 Ctr-ceh-32(ot1430[Ctr-ceh-32::GFP]) V. C. tropicalis C-terminal GFP tag inserted before STOP codon of endogenous Ctr-ceh-32 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18854 Cbr-ceh-32(ot1431[Cbr-ceh-32::GFP]) V. C. briggsae C-terminal GFP tag inserted before STOP codon of endogenous Cbr-ceh-32 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18863 unc-18(ot1432(unc-18::SL2::GFP::H2B)) X. C. elegans Endogenous reporter generated by the insertion of SL2::GFP::H2B into the endogenous unc-18 locus. Expression in intestine and nervous system. Reference: Boeglin M, et al. Genetics. 2023 Dec 6;225(4):iyad180. doi: 10.1093/genetics/iyad180. PMID: 37793339.
OH18871 ceh-44(ot1433[*ot1015[ceh-44::gfp]]) III. C. elegans ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1433 is a deletion removing exons 4-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH18872 ceh-44(ot1434[*ot1015[ceh-44::gfp]]) III. C. elegans ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 1-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH18892 Cbr-unc-17(ot1440[Cbr-unc-17::T2A::mScarlet3::H2B]) IV. C. briggsae T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-unc-17 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH18895 ins-35(ot1443) V. C. elegans ot1443 is CRISPR-engineered 646 bp deletion of the ins-35 gene removing all the coding sequence except the last 7 aa, which should not be translated due to the absence of an ATG. Sequence after edit: ttctgaaatttttgaaattgtctaattttcCAGCAGACTCAGATGAACTATTCAATTAATAATTTAAGTT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH18902 degt-1(ot1445[degt-1::GFP]) V. C. elegans GFP tag inserted at the C-terminus of the endogenous degt-1 locus directly before the DEGT-1 stop codon. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
OH18948 ceh-44(ot1447[*ot1015[ceh-44::gfp]]) III. C. elegans ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1447 is a deletion removing exon 5 of the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH18961 Ctr-nlp-3(ot1453[Ctr-nlp-3::SL2::GFP:H2B]) X. C. tropicalis SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-3 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH19034 degt-1(ot1466) V. C. elegans Null allele. ot1466 is a CRISPR-engineered deletion removing the complete CDS. Normal growth & viability. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
OH19054 pha-1 (e2123) III; otEx8199. C. elegans otEx8199 [sshk-1p::GFP + pha-1(+)]. Maintain at 25C. 370 bp of promoter directly upstream of sshk-1 fused to GFP. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
OH19078 daf-16(ot853[daf-16::mNG::AID*]) I; otIs908 V. C. elegans otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. TIR1(F79G) expression in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19089 Ctr-nlp-18(ot1474[Ctr-nlp-18::SL2::GFP:H2B]) II. C. tropicalis SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-18 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH19094 Cbr-lgc-37(ot1475[Cbr-lgc-37::T2A::mScarlet3::H2B]) III. C. briggsae T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-lgc-37 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH19118 otIs913 V. C. elegans otIs913 [pha-4(prom2)::daf-2(DN)::eBFP2::tbb-2 3’ UTR + unc-122p::mCherry::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. pha-4(prom2) drives expression of daf-2(DN) in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19119 cone-1(ot1485[*syb5500[cone-1::oxGFP]]) III. C. elegans syb5500 is an oxGFP tag inserted at the C-terminus of the endogenous cone-1 locus by CRISPR. ot1485 is an early stop codon introduced into exon 3 of the endogenously-tagged cone-1 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH19120 ceh-44(ot1486[*ot1015[ceh-44::gfp]]) III. C. elegans ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1468 is an early stop codon introduced into exon 3 of the endogenously-tagged ceh-44 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH19123 Ctr-lgc-37(ot1487[Ctr-lgc-37::T2A::mScarlet3::H2B]) III. C. tropicalis T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-lgc-37 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH19124 pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. C elegans SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
OH19125 pks-1(ot1489[pks-1::SL2::GFP::H2B]) X. C elegans GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
OH19186 cone-1(ot1502[GFP::H2B::SL2::cone-1]) III. C. elegans GFP::H2B tag with SL2 inserted at N-terminus of endogenous cone-1 locus. Ubiquitous nuclear green at all stages (as early as 2-cell). GFP signal is very bright compared to C-terminal tag in OH19215. Please contact Oliver Hobert prior to publishing work using this strain.
OH19202 Cbr-eat-4(ot1507[Cbr-eat-4::SL2::mScarlet3::H2B]) III. C. briggsae SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH19204 golg-4(ot1508[GFP::golg-4]) III. C elegans GFP tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
OH19205 golg-4(ot1509[mScarlet3::golg-4]) III. C elegans mScarlet3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
OH19206 golg-4(ot1510[mScarlet-I3::golg-4]) III. C elegans mScarlet-I3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
OH19210 him-8(e1489) IV; unc-42(ot1187) V. C. elegans CRISPR/Cas9 full deletion removing the entire coding-region of unc-42. Him and Unc. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
OH19211 Ctr-eat-4(ot1512[Ctr-eat-4::SL2::mScarlet3::H2B]) III. C. tropicalis SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-eat-4 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH19212 Ctr-unc-17(ot1513[Ctr-unc-17::T2A::mScarlet3::H2B]) IV. C. tropicalis T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-unc-17 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH19215 cone-1(ot1514[cone-1::SL2::GFP::H2B]) III. C. elegans CRISPR reporter, substitution of SL2 for T2A. A broad nuclear expression begins around the Comma stage. Brighter expression with earlier initiation than T2A reporter. Expression becomes restricted to non-neuronal cells as animals mature to larval stages. Please contact Oliver Hobert prior to publishing work using this strain.
OH19219 ceh-44(ot1515[*ot1015[ceh-44::gfp]]) III. C. elegans ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH19232 daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II. C. elegans otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19259 Cbr-unc-25(ot1524[Cbr-unc-25::SL2::mScarlet3::H2B]) III. C. briggsae SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH19278 aex-4(ot1530[aex-4::SL2::gfp::his-44]) X. C. elegans SL2::GFP::HIS-44 tag inserted into the endogenous aex-4 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19280 aex-5(ot1532[aex-5::SL2::gfp::his-44]) I. C. elegans SL2::GFP::HIS-44 tag inserted into the endogenous aex-5 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19295 unc-25(ot1536[unc-25b.1::T2A::GFP::H2B]) III; him-5(e1490) V. C. elegans CRISPR-engineered T2A::GFP::H2B insertion specifically tags isoform b.1 of the endogenous unc-25 locus. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
OH19299 unc-75(ot1539[mScarlet-I3::unc-75]) I. C elegans mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
OH19333 aex-1(ot1543[aex-1::SL2::gfp::his-44]) I. C. elegans SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19337 tph-1(ot1545) II. C. elegans ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19404 dmd-6(ot1059[dmd-6::GFP::3xFLAG]) II; mel-28(bq6[mKate2::mel-28]) III; him-5(e1490) V. C. elegans GFP::3xFLAG tag inserted at C-terminus of endogenous dmd-5 locus. mKate2 tag inserted at N-terminus of endogenous mel-28 locus. Him. crRNA1: TCTTTGACTTAGACCGGGT. crRNA2: ACCCGGTCTAAGTCAAAGA. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH19406 him-8(e1489) IV; dmd-10(syb1703[GFP::3xFLAG::dmd-10]) V. C. elegans GFP::3xFLAG tag inserted at N-terminus of endogenous dmd-10 locus. Him. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH19410 him-8(e1489) IV; dmd-7(syb5992[dmd-7::SL2::GFP::H2B]) V. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous dmd-7 locus. Him. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH19411 him-8(e1489) IV; dmd-7(syb4035[GFP::tev::loxP::3xFLAG::dmd-7]) V. C. elegans GFP::tev::loxP::3xFLAG tag inserted at N-terminus of endogenous dmd-7 locus. Him. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH19441 mab-23(ot1574) him-5(e1490) V. C. elegans CRIPSR/Cas9-engineered mab-23 null mutant. Him. Abnormal male tail. Generated in N2 background. crRNA1: AGTGTACTTGGTCCCAAAAG. crRNA2: CGTTTTGCTTCATTTTACAC. ssODN: ATTGGTCCACGCACTGTTCTATGGCCACGCCTCTTTAAAATGAAGCAAAACGAATCCAAGTCAACACAGA. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH19444 dmd-3(ot1577) him-5(e1490) V. C. elegans CRIPSR/Cas9-engineered dmd-3 null mutant. Him. Abnormal male tail. Generated in N2 background. crRNA1: ACAAGTTTTATATTGTGATA. crRNA2: AAATCAATATGGTAACGTTT. ssODN: TTTTTTTTCTGAATAAAAAAAAAATTGTACCTTATCGTTACCATATTGATTTTCTCGGTGATTTGATCAC. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH19575 otIs927 V. C. elegans otIs927 [ges-1p::nlp-40::tagRFP-T::SL2::GFP::his-44::tbb-2 3’ UTR + inx-6(prom18)::tagRFP-T::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of NLP-40 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19587 php-3(syb1549[php-3::GFP]) III; otIs669 him-5(e1490) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
OH1960 pha-1(e2123) III; otEx1043. C. elegans otEx1043 [dop-1(prom2)::GFP + pha-1(+)].
OH19735 otIs937 V. C. elegans otIs937 [ceh-19(prom2)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. ceh-19(prom2) drives expression of daf-2(DN) specifically in the MC neurons in the pharyngeal nervous system. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19767 otIs942 V. C. elegans otIs942 [tph-1(prom5)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. tph-1(prom5) drives expression of daf-2(DN) specifically in the NSM neurons. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19781 Cbr-cat-1(ot1621[Cbr-cat-1::SL2::mScarlet3::H2B]) X. C. briggsae SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-cat-1 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH19827 Ctr-cat-1(ot1631[Ctr-cat-1::SL2::mScarlet3::H2B]) X. C. tropicalis SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-cat-1 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
OH19864 fog-29(q71) pha-4(ot1506)/stu-3(q265) rol-9(sc148) V. C. elegans Heterozygous. Pick wild-type to maintain. ot1506 is a full (6665bp) deletion of the pha-4 locus coding region from the start codon of the longest isoform to the stop codon. Heterozygotes appear wild-type, and segregate wild-type heterozygotes, fog-29(q71) pha-4(ot1506) homozygotes (arrest as embryos or L1s), Sterile Rollers. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH19945 pha-4(syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG] *ot1078 *ot946) otIs908 V. C. elegans otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. Endogenously-tagged pha-4::GFP::AID crossed with enteric neuron-specific TIR1(F79G), allowing depletion of PHA-4 from pharyngeal nerons, AVL, and RIS by addition of 5-Ph-IAA. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH2000 lin-23(ot1) II; oxIs12 X; otEx1076. C. elegans otEx1076 [unc-47p(long)::lin-23cDNA(yk784a08) + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers.
OH20048 mab-3(ot1666[mab-3::SL2::GFP::H2B]) II; him-8(e1489) IV. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous mab-3 locus. Him. crRNA: TGGTCAAAATTATAGATCTT. ssODN primers: FWD 5' GGAGTATGTATCTGAAAAATTATGGTCTGCAAGCCTAAgctgtctcatcctactttcacctag 3'; REV 5' ttttctaaaaatcaataattggtcaaaattatagatcctacttgctggaagtgtacttg 3'. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
OH20089 otEx8333. C. elegans otEx8333 [sre-22p::GFP::H2B::tbb-2 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH20095 egl-3(nu1711[loxP::egl-3::loxP]) V; otEx8339. C. elegans otEx8339 [sre-22p::2xFlag::NLS::Cre::unc-54 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron, allowing PVT cell-specific Cre-Lox elimination of egl-3 in animals carrying the array. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH20099 pha-4(ot1078[loxp::pha-4::GFP::loxP] *ot946) V; otEx8343. C. elegans otEx8343 [sre-22p::2xFlag::NLS::Cre::unc-54 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron, allowing PVT cell-specific Cre-Lox elimination of pha-4 in animals carrying the array. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH20145 zfh-2(ot1709)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. C. elegans Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus ot1709 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. zfh-2(ot1709) is a CRISPR/Cas9-engineered >30kb deletion of the entire zfh-2 locus. crRNA1: CTACCATTTAGCCAATATAT. crRNA2: GTAGTAGTAGTAGTATGAGG. ssODN: aaattcatccaaaaaaatttccagagttgccccgcccataCATACTACTACTACTACCACGACGACGCCATAAcaaaacc. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069.
OH2018 mgIs18 IV; otIs35 hst-6(ot19) X. C. elegans mgIs18 [ttx-3p::GFP] IV. otIs35 [ttx-3p::kal-1 + rol-6(su1006)] X. otIs35 has been mapped to LG X between lon-2 and hst-6. Rollers. ttx-3p::GFP labels AIY interneurons. ot19 suppresses the branching phenotype of KAL-1 overexpression in AIY. hst-6(ot19) is closely linked to otIs35.
OH2024 exc-4(rh133) I; otEx1000. C. elegans otEx1000 [hsp16-2::exc-4(cDNA)::GFP + rol-6(su1006)]. Maintain by picking Rollers.
OH20419 zfh-2(syb10278[zfh-2::GSGGSGGTGGSG::mIAA7::wrmScarlet-I3-mIAA7]) I; otSi4 II. C. elegans otSi4 [myo-2p::TIR1(F79G)::mRuby::unc-54 3'UTR *ieSi60] II. Endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069.
OH2042 lin-49(ot78) dpy-20(?) IV; otIs3 V. C. elegans otIs3 [gcy-7::GFP + lin-15(+)] V. Whole genome sequenced strain.
OH20425 zfh-2(ot1787 *syb10278)/tmC20[unc-14(tmIs1219) dpy-5(tm9715)] I. C. elegans Homozygous sterile mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus ot1709 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Second homeodomain deleted from endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. ot1787 crRNA1: TCCTGCAACACGTCGTCCAG. crRNA2: CGGCGTTCTCACAAATCGAT. ssODN: ATGACACCGAGCACTCCTTCCTGCAACACGTCGTCCtcTGGACGAATCTATGAGAATCAGCCGAATCACGAGAGTTCtGATCGATTTGTGAGAACGCCGGGATCGAACTTTCAGTGC. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069.
OH2096 lin-23(ot1) II; oxIs12 X; otEx1131. C. elegans otEx1131[unc-47::GFP + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers.
OH2143 otIs39 II; wrk-1(ok695) X. C. elegans otIs39 [unc-47(delta)::GFP + lin-15(+)].
OH2204 otEx1182. C. elegans otEx1182[gst-44p::gst-44::GFP + rol-6(dom)]. Maintain by picking Rollers.
OH2211 otEx1184. C. elegans otEx1184 [exl-1p::exl-1::GFP + rol-6(su1006)]. Maintain by picking Rollers. Translational GFP fusion localizes to lysosomal membranes in the intestine and to the Golgi apparatus in neurons and muscle.
OH2225 unc-4(e120) die-1(ot26) II. C. elegans
OH2246 otIs107. C. elegans otIs107 [ser-2::GFP + lin-15(+)]. Not on LG X.
OH2344 eno-2(ot2) I; oxIs12 X. C. elegans oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
OH2345 eno-3(ot3) oxIs12 X. C. elegans Ectopic DVB outgrowth. oxIs12 [unc-47p::GFP + lin-15(+)].
OH2346 eno-6(ot6) V; oxIs12 X. C. elegans oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
OH2347 eno-11(ot40) I; oxIs12 X. C. elegans oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
OH2382 eno-7(ot7) IV; oxIs12 X. C. elegans oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
OH2383 eno-8(ot8) III; oxIs12 X. C. elegans oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
OH2411 pha-1(e2123) III; otEx233. C. elegans otEx233 [dop-1(prom1)::GFP + pha-1(+)].
OH2475 otIs157. C. elegans otIs157 [lim-6r::GFP + rol-6(su1006)].
OH2535 lsy-6(ot71) V. C. elegans Worms appear WT. 1071 bp deletion removes the entire lsy-6 hairpin and part of the predicted C32C4.3 gene. ASEL takes on ASER gene expression profile.
OH2638 dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1467. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx1467 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1467 are DpyUnc. Animals which have lost the otEx1467 array are DpyUncLet.
OH2639 dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1468. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx1468 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1468 are DpyUnc. Animals which have lost the otEx1468 array are DpyUncLet.
OH2672 otEx1495. C. elegans otEx1495 [sul-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. GFP expression in hypodermis and AVL.
OH2724 otIs133; otEx1545. C. elegans otIs133 [pttx-3::RFP + unc-4(+)]. otEx1545 [F11H8.2::GFP + rol-6(su1006)]. Maintain by picking GFP+ Rollers. RFP expressed in AIY only. Reference: Wenick AS, Hobert O. Wenick AS, Hobert O. Developmental Cell. 2004 Jun;6(6):757-70.
OH2862 otEx731. C. elegans otEx731[lin-23::GFP + rol-6(su1006)]. lin-23prom::GFP transcriptional fusion.
OH2871 che-1(ot101) I; ntIs1 V; otIs151. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V; integration of adEx1262 [gcy-5p::GFP + lin-15(+)]. otIs151 [ceh-36p::RFP + rol-6(su1006)]. Rollers. Both ASEL and ASER show GFP expression from ntIs1.
OH2984 otEx1765. C. elegans otEx1765 [let-765::GFP + rol-6(su1006)]. Maintain by picking Rollers.
OH2985 otEx1766. C. elegans otEx1766 [let-765::GFP + rol-6(su1006)]. Maintain by picking Rollers.
OH2987 otEx1768. C. elegans otEx1768 [let-756::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers.
OH2990 otEx1771. C. elegans otEx1771[egl-15::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers.
OH2996 ntIs1; lsy-2(ot64) X; otEx1777. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. otEx1777 [lsy-2::GFP + rol-6(su1006)]. Maintain by picking Rollers.
OH3112 otIs159. C. elegans otIs159 [die-1::GFP + rol-6(su1006)]. GFP expressed in embryonic hypodermis and head neurons.
OH313 ser-2(pk1357) X. C. elegans
OH3150 otIs160; otIs151. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. otIs160 [lsy-6::GFP + coelomocyte::GFP]. Rollers.
OH3191 otIs3 V. C. elegans otIs3 [gcy-7::GFP + lin-15(+)]. Integrated from adEx1288; genetically mapped between 3.05 m.u. (T19B10) and 5.86 m.u. (AH10) on V. GFP expression appears in ASEL and the excretory cell in adult animals.
OH3192 ntIs1 V. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V; integration of adEx1262 [gcy-5p::GFP + lin-15(+)]. GFP expression appears in ASER in adult animals.
OH3313 oyIs14 V; otIs37 X. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otIs37 [unc-47(del)::GFP]. GFP fluorescence in PVT and DBV.
OH3314 oyIs14 V; otIs38 X. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otIs38 [unc-47(del)::GFP]. otIs38 is integrated juEx60 [(pCZ114) unc-47(del)::GFP]. GFP fluorescence in PVT and DBV.
OH3351 otIs162; him-5(e1490) V. C. elegans otIs162[gcy-6::GFP + lin-15(+)].
OH3455 oyIs14 V; egl-15(n1456) X; otEx1254. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx1254 [egl-15p::egl-15(5B) genomic hybrid + ceh-22p::GFP + pBS]. otEx1254 rescues the lethal phenotype of egl-15(n1456).
OH3467 oyIs14 V; egl-15(n1456) X; otEx1267. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx1267 [pTB71=egl-15p::egl-15(5B) genomic hybrid + ceh-22p::GFP + pBS]. otEx1267 rescues the lethal phenotype of egl-15(n1456).
OH3478 oyIs14 V; egl-15(n484) X; otEx1270. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx1270 [dpy-7p::egl-15(5A)cDNA + ceh-22p::GFP + pBS]. Maintain by picking worms with GFP expression in their pharynx.
OH3487 otIs114 I; cog-1(ot119) II. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot119. Rollers.
OH3491 otIs114 I; cog-1(ot123) II. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. ot123 is a semi-dominant deletion allele of part of the cog-1 3' UTR, a lsy-6 miRNA target. Loss of miRNA regulation leads to ectopic expression of cog-1 in ASEL, which transforms ASEL to have ASER fate. otIs114, normally expressed in only ASEL and excretory gland cells, is lost in ASEL in ot123. Animals tend not to Roll.
OH3503 otEx2040. C. elegans otEx2040 [hse-5p::GFP + rol-6(su1006)]. Transcriptional hse-5s::GFP fusion.Maintain by picking Rollers.
OH3556 che-1(ot124) otIs114 I. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3568 otIs114 I; cog-1(ot155) II. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot155. Rollers. Animals look Dpy.
OH3645 otIs114 I; lsy-6(ot149) V. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lsy-6 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3646 otIs114 I; lsy-6(ot150) V. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lsy-6 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3679 che-1(ot151) otIs114 I. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3681 otIs114 che-1(ot153) I. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3682 otIs114 I; lsy-12(ot154) V. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. 2 ASER.
OH3684 otIs114 I; lsy-12(ot170) V. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers. Worms are slow growing.
OH3701 otIs173 III. C. elegans otIs173 [F25B3.3::DsRed2 + ttx-3pB::GFP].
OH3754 otIs114 I; fozi-1(ot159) III. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH3890 otIs114 I; ced-4(ot188) III. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.
OH3895 otIs114 I; die-1(ot198) II. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of die-1 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3900 otIs114 I; fozi-1(ot191) III. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH3902 otIs114 I; cog-1(ot200) II. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot200. Rollers.
OH3903 otIs114 I; cog-1(ot201) II. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot201. Rollers.
OH3923 otIs114 I; ced-4(ot228) III. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.
OH3926 otIs114 I; nhr-67(ot136) IV. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Shows ASE asymmetry defects. Mildly temperature sensitive. Maintain at 25C.
OH3928 otIs114 I; nhr-67(ot202) IV. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Mildly cold-sensitive; maintain at 25C. ASE asymmetry defects.
OH3955 pha-1(e2123) III; otEx193. C. elegans otEx193[C09E7.3(oig-1)::GFP].
OH3957 otIs114 I; ced-4(ot248) III. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.
OH3959 otIs114 I; die-1(ot231) II. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of die-1 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3962 otIs114 I; fozi-1(ot236) III. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH3963 otIs114 I; ced-4(ot238) III. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.
OH3966 otIs151; otEx2304. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2304 [gcy-11(prom1)::GFP + unc-122::GFP]. Expresses GFP in pharyngeal muscle. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH3972 otIs151; otEx2310. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2310 [gcy-19(prom1)::GFP + unc-122::GFP]. Expresses GFP in IL2, faint in ASEL/R, and faint pairs in head. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH3976 otIs151; otEx2314. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2314 [gcy-2(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASI, RIA, PVT and AWA. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH3992 otIs151; otEx2322. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2322[gcy-14(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASEL, and dim GFP in ASER and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH3997 otIs151; otEx2327. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2327 [gcy-20(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASEL, dim in ASER and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4013 otIs114 che-1(ot232) I. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH4025 otIs114 I; nhr-67(ot190) IV. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Shows ASE asymmetry defects.
OH4027 otIs114 I; fozi-1(ot234) III. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH4041 ham-1(ot253) IV; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Missing or extra cells expressing dat-1::GFP.
OH4120 rhIs4 III; wrk-1(ok695) X. C. elegans rhIs4 [glr-1p::GFP + dpy-20(+)] III.
OH4121 juIs76 II; wrk-1(ok695) X. C. elegans juIs76 [unc-25p::GFP + lin-15(+)] II.
OH4124 oyIs14 V; wrk-1(ok695) X. C. elegans oyIs14 [sra-6::GFP + lin-15(+)].
OH4125 evIs82b IV; wrk-1(ok695) X. C. elegans evIs82b [unc-129::GFP + dpy-20(+)] IV.
OH4127 zdIs13 IV; oyIs14 V; wrk-1(ok695) X. C. elegans zdIs13 [tph-1p::GFP] IV. oyIs14 [sra-6::GFP + lin-15(+)] V.
OH4128 juIs76 II; evIs82b IV. C. elegans juIs76 [unc-25p::GFP + lin-15(+)] II. evIs82b [unc-129::GFP + dpy-20(+)] IV.
OH4129 jcIs1 IV; wrk-1(ok695) X. C. elegans jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.
OH4130 bwIs2 vab-1(dx31) II; wrk-1(ok695) X. C. elegans bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped.
OH4132 vab-1(dx31) II; rhIs4 III; wrk-1(ok695) X. C. elegans rhIs4 [glr-1p::GFP + dpy-20(+)] III.
OH4133 bwIs2 II; vab-1(dx31) II. C. elegans bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped.
OH4134 otIs173 III; zdIs13 IV. C. elegans otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP] III. zdIs13 [tph-1p::GFP] IV.
OH4135 otIs173 III; zdIs13 IV; wrk-1(ok695) X. C. elegans otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP]. zdIs13 [tph-1p::GFP] IV.
OH4136 rhIs4 III; wrk-1(tm1099) X. C. elegans rhIs4 [glr-1p::GFP + dpy-20(+)] III.
OH4137 bwIs2 II; wrk-1(tm1099) X. C. elegans bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped.
OH4138 zdIs13 IV; wrk-1(tm1099) X. C. elegans zdIs13 [tph-1p::GFP] IV.
OH4139 vab-1(dx31) II; oyIs14 V. C. elegans oyIs14 [sra-6::GFP + lin-15(+)].
OH4140 vab-1(dx31) II; oyIs14 V; wrk-1(ok695) X. C. elegans oyIs14 [sra-6::GFP + lin-15(+)].
OH4141 zdIs21 IV; wrk-1(ok695) X. C. elegans zdIs21 [zag-1::GFP] IV.
OH4142 bwIs2 II; wrk-1(ok695) X. C. elegans bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped.
OH4143 vab-1(dx31) II; zdIs13 IV. C. elegans zdIs13 [tph-1p::GFP] IV.
OH4144 vab-1(dx31) II; zdIs13 IV; wrk-1(ok695) X. C. elegans zdIs13 [tph-1p::GFP] IV.
OH4147 zdIs13 IV; wrk-1(ok695) X. C. elegans zdIs13 [tph-1p::GFP] IV.
OH4149 wrk-1(tm1099) X. C. elegans
OH4158 otIs151; otEx2409. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2409 [gcy-4(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASE, biased to right. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4160 otIs151; otEx2411. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2411[gcy-13(prom1)::GFP + unc-122::GFP]. Expresses GFP in RIM. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4163 otIs151; otEx2414. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2414 [gcy-17(prom1)::GFP + unc-122::GFP]. Expresses GFP in PHA. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4165 otIs151; otEx2416. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2416 [gcy-21(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASG and ADL(weak). Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4168 otIs151; otEx2419. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2419 [gcy-1(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASER, ASI, URX, PVT, and AIY. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4172 otIs151; otEx2423. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2423[gcy-3(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASER. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4174 otIs151; otEx2425. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2425 [gcy-25(prom1)::GFP + unc-122::GFP]. Expresses GFP in AQR, PQR, URX. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4176 otIs114 I; cog-1(ot242) II. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot242.
OH4177 otIs114 I; ced-4(ot248) III. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.
OH4224 ham-1(ot257) IV; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP.
OH4226 vtIs1 V; lin-32(ot259) X. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Fewer or extra cells expressing dat-1::GFP in various penetrances.
OH4240 lin-17(ot260) I; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. PDEs often do not express dat-1::GFP. Whole genome sequenced strain.
OH4247 vtIs1 V; dopy-6(ot263) X. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Missing or extra PDEs based on dat-1::GFP expression. Whole genome sequenced strain.
OH4254 vtIs1 V; vab-3(ot266) X. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP.
OH4265 lin-22(ot267) IV; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP in the V1 to V4 lineages.
OH4270 lin-22(ot268) IV; vtIs1V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1 in the V1 to V4 lineages. Missense mutation (L68F) affecting a conserved leucine residue in the helix-loop-helix domain.
OH4271 lin-22(ot269) IV; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)]. Rollers. Extra cells expressing dat-1::GFP in the V1 to V4 lineages.
OH4274 ztf-6(ot271) I; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll well, but GFP expression is easily detected. Extra cells expressing dat-1::GFP.
OH4276 ztf-6(ot273) I; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP.
OH4277 ztf-6(ot274) I; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. More cells express dat-1::GFP.
OH4299 vtIs1 V; vab-3(ot276) X. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP.
OH4303 ztf-6(ot280) I; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP. Whole genome sequenced strain.
OH4305 egl-1(ot282) vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP. Whole genome sequenced strain.
OH4306 dopy-5(ot283)/+ III; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Homozygous ot283 animals are 100% sterile and variable CEP phenotype. Maintain by picking single animals that segregate Sterile worms (the sterility is easy to see by eye because the sterile worms do not produce eggs or oocytes).
OH4307 dopy-5(ot284)/+ III; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Homozygous ot284 animals are 100% sterile and variable CEP phenotype. Maintain by picking single animals that segregate Sterile worms (the sterility is easy to see by eye because the sterile worms do not produce eggs or oocytes).
OH4309 otIs151; otEx2491. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2491[gcy-29(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASE and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4320 lin-22(ot287) IV; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP in the V1 to V4 lineages.
OH4322 ced-3(ot289) IV; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. The undead sisters of CEPvs and PVDs express dat-1::GFP.
OH4326 pha-1(e2123) III; otEx239. C. elegans otEx239 [C53B7.1::GFP + pha-1(+)]. Maintain by picking GFP+. At 25C, only animals with the array should be alive.
OH4329 lsy-6(ot71) dpy-11(e224) V; otEx2322. C. elegans otEx2322[gcy-14(prom1)::GFP + unc-122::GFP]. Faint ASE GFP expression (2 right). Expresses bright GFP in coelomocytes. Dpy.
OH4334 dopy-5(ot296)/+ III; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Homozygous ot296 animals are 100% sterile and variable CEP phenotype. Maintain by picking single animals that segregate Sterile worms (the sterility is easy to see by eye because the sterile worms do not produce eggs or oocytes).
OH4335 vtIs1 V; lin-32(ot297) X. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Missing CEPVs and PDEs; ADEs variably affected.
OH4339 dopy-5(ot298)/+ III; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Homozygous ot298 animals are 100% sterile and variable CEP phenotype. Maintain by picking single animals that segregate Sterile worms (the sterility is easy to see by eye because the sterile worms do not produce eggs or oocytes).
OH4343 otIs133 II; otEx2498. C. elegans otEx2498 [gcy-18(prom1)::GFP + rol-6(su1006)]. Expresses GFP in AFD and AIM. Maintain by picking GFP+ animals (which should also be Rollers). otIs133 [pttx-3::RFP + unc-4(+)]. RFP expressed in AIY only.
OH4346 otIs151; otEx2501. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2501[gcy-23(prom1)::GFP + unc-122::GFP]. Expresses GFP in AFD. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4348 otEx2503. C. elegans otEx2503[gcy-27(prom1)::GFP + rol-6(su1006)]. Expresses GFP in ASK, ASI, ASJ. Maintain by picking GFP+ animals (which should also be Rollers).
OH4350 otIs151; otEx2504. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2504 [gcy-28(prom1)::GFP + unc-122::GFP]. Expresses GFP in many head neurons, ventral cord and tail neurons, body wall muscle, hypodermis, somatic germline and intestine. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH438 unc-4(e120) II; otIs117 IV. C. elegans otIs117 [unc-33p::GFP + unc-4(+)]. Pan-neuronal GFP.
OH439 otIs118. C. elegans otIs118 [unc-33::GFP + unc-4(+)]. Pan-neural expression. Might still carry unc-4(e120) in background.
OH4397 otIs151; lsy-6(ot71) dpy-11(e224) V; otEx2419. C. elegans otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2419 [gcy-(prom1)::GFP + unc-122::GFP]. Bilateral expression of GFP in ASE. Expresses bright GFP in coelomocytes. Rollers. Dpy. Maintain by picking GFP+.
OH4400 lim-6(nr2073) X; otEx2322. C. elegans otEx2322 [gcy-14(prom1)::GFP + unc-122::GFP]. ASEL biased GFP expression. Expresses bright GFP in coelomocytes.
OH441 otIs45 V. C. elegans otIs45 [unc-119::GFP]. Pan-neural expression. No injection marker.
OH443 otEx304. C. elegans otEx304 [unc-75p::GFP + rol-6(su1006)]. 5kb upstream of promoter of unc-75 cloned into pPD95.75. Expressed pan neuronally. Pick Rollers to maintain.
OH4460 otEx2572. C. elegans otEx2572 [unc-97::NLS::GFP]. GFP expressed strongly in muscle. Maintain by picking GFP+ animals.
OH4461 lin-15B&lin-15A(n765); otEx2571. C. elegans otEx2571 [unc-97::GFP + lin-15(+)]. GFP strongly expressed in muscle. Maintain by picking GFP+, non-Muv animals.
OH4605 unc-37(ot59)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); him-8(e1489) IV; otIs3 V. C. elegans otIs3 [gcy-7::GFP + lin-15(+)] V. Heterozygotes are WT and GFP+ in the pharynx. ot59 is homozygous inviable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. In WT animals, gcy-7::GFP expressed in ASEL. unc-37(ot59) mutants, otIs3 is expressed in both ASEL and ASER.
OH4609 otEx2646. C. elegans otEx2646 [ceh-36::GFP::unc-54 3' UTR + rol-6(su1006)]. Maintain by picking Rollers.
OH4610 otEx2647. C. elegans otEx2647 [ceh-36p2::GFP::cog-1 3'UTR + rol-6(su1006)].
OH4617 otEx2654. C. elegans otEx2654 [ceh-36p2::GFP::cog1 3' UTR + rol-6(su1006)].
OH4768 kyIs140 I; ttx-3(mg158) X. C. elegans kyIs140 [str-2::GFP + lin-15(+)] I.
OH4769 ttx-3(mg158) X; nuIs11. C. elegans nuIs11 [osm-10::GFP + lin-15(+)]. Array contains pool28; KP#57-59 (osm-10::GFP insert at Nrul site) and pJM24 [lin-15(+) rescues n765 at 20C]. GFP expressed in ASH, ASI, PHA and PHB after 3-fold. nuIs11 may be inserted on LG I.
OH4770 ttx-3(mg158) X; otIs24. C. elegans otIs24 [sre-1::GFP + dpy-20(+)].
OH481 otIs20. C. elegans otIs20 [zig-4::GFP + rol-6(su1006)]. Rollers. otIs20 does not mate.
OH4830 otIs114 I; tax-4(ot35) III; him-5(e1490) V. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)].
OH4836 otIs7. C. elegans otIs7 [zig-2::GFP + rol-6(su1006)]. Expression variable. Whenever tail non-neuronal cells are on, then PVT is on; apparently more penetrant in adult.
OH4837 lim-6(nr2073) X; otIs11. C. elegans otIs11 [zig-5::GFP + rol-6(su1006)]. Rollers.
OH4838 otIs25. C. elegans otIs25 [zig-1::GFP + rol-6(su1006)].
OH4839 gcy-22(tm2364) V. C. elegans Reference: Ortiz CO, et al., Curr Biol. 2009 Jun 23;19(12):996-1004.
OH4840 otIs85. C. elegans otIs85 [F59B2.13::GFP + rol-6(su1006)]. Rollers. Not constipated.
OH4841 otIs92. C. elegans otIs92 [flp-10::GFP]. Derived by integration of ynEx2.
OH4844 gcy-5(tm897) II. C. elegans No visible phenotype. Normal chemotaxis to ammonium chloride.
OH4887 otIs182. C. elegans otIs182[inx-18::GFP].
OH4974 otIs114 I; lsy-12(ot89) V. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers.
OH6020 otIs185. C. elegans otIs185 [ceh-36::GFP::cog-1 3' UTR + rol-6(su1006)]. Rollers.
OH6071 trp-4(ot337) I; vtIs1 vsIs33 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer cells expressing dat-1::GFP. Whole genome sequenced strain.
OH6072 vtIs1 vsIs33 V; lin-32(ot338) X. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Missing CEPVs and PDEs; ADEs variably affected.
OH6086 ceh-43(ot345) III; vtIs1 vsIs33 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. CEPDs, ADEs and PDEs variably affected. Rollers.
OH6087 ceh-43(ot340) III; vtIs1 vsIs33 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Few cells expressing dat-1::GFP. Whole genome sequenced strain.
OH610 che-1(ot63) I; otIs3. C. elegans otIs3 [gcy-7::GFP + lin-15(+)]. che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. otIs3 was derived by integration of adEx1288 [gcy-7::GFP + lin-15(+)]. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.
OH7007 ham-1(ot342) IV; vtIs1 vsIs33 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer or extra cells expressing dat-1::GFP in various penetrances.
OH7008 vtIs1 vsIs33 V; lin-32(ot343) X. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer or extra cells expressing dat-1::GFP in various penetrances.
OH7016 ham-1(ot339) IV; vtIs1 vsIs33 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. CEP vells variably affected (sometimes fewer, sometimes more cells expressing GFP).
OH7058 vtIs1 vsIs33 V; vab-3(ot346) X. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Extra cells expressing dat-1::GFP.
OH7061 ref-2(ot327) X; otEx3091. C. elegans otEx3091[ref-2::ven + rol-6(su1006)]. ot327 is larval lethal. otEx3091 carries a ref-2::venus translational fusion and rescues the lethality.
OH707 cog-1(ot38)/+ II; otIs114 I. C. elegans otIs114 [lim-6::GFP + rol-6(su1006)]. Rollers. Heterozygous strain. Heterozygotes should be fertile and segregate some sterile progeny. Maintain by picking plenty of animals with GFP in both ASEL and ASER; many of them will be sterile (homozygotes). otIs114 is normally expressed only in ASEL and excretory gland cell. Homozygous ot38; otIs114 is sterile and expresses GFP in both ASEL and ASER neurons. Heterozygotes display a semi-dominant, partially penetrant "ASEL + ASER" phenotype.
OH7074 otIs173 III; ttx-3(ot355) X. C. elegans otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OH7075 otIs173 III; ttx-3(ot356) X. C. elegans otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OH7076 otIs173 III; ttx-3(ot357) X. C. elegans otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OH7079 otIs173 III; ttx-3(ot360) X. C. elegans otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OH7095 ham-1(ot361) IV; vtIs1 vsIs33 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. CEP vells variably affected (sometimes fewer, sometimes more cells expressing GFP).
OH7098 ham-1(ot364) IV; vtIs1 vsIs33 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer or extra cells expressing dat-1::GFP in various penetrances.
OH7103 otIs173 III; ttx-3(ot365) X. C. elegans otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OH7115 lsy-22(ot244) otIs114 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are Rollers and GFP+. Homozygous lsy-22(ot244) otIs114 animals are Rollers and have a maternal effect embryonic lethal phenotype.
OH7116 lsy-22(ot114) unc-101(m1) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); otIs3 V. C. elegans otIs3 [gcy-7::GFP + lin-15(+)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are WT and GFP+. Homozygous lsy-22(ot114) unc-101(m1) animals are Unc and have a maternal effect embryonic lethal phenotype. Whole genome sequenced strain.
OH7118 vtIs1 vsIs33 V; lin-32(ot366) X. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Missing CEPVs and PDEs; ADEs variably affected.
OH7150 ham-1(ot371) IV; vtIs1 vsIs33 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. CEP vells variably affected (sometimes fewer, sometimes more cells expressing GFP).
OH7155 otIs181 III; F19F10.1(tm456) V. C. elegans otIs181 [dat-1::mCherry + ttx-3::mCherry]. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH7158 vtIs1 V; C52B9.2(tm413) X. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH7159 C24A1.2(tm801) III; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH7160 vtIs1 V; ets-5(tm866) X. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH7169 C50A2.4(tm440) IV; vtIs1 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH7193 otIs181 III; him-8(e1489) IV. C. elegans otIs181 [dat-1::mCherry + ttx-3::mCherry]. Him. Expression in DA neurons (ADE, PDE, CEP, male tail) and AIY. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH7202 sax-7(ky146) IV; oyIs14 V; otEx3124. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx3124 [rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.
OH7203 sax-7(ky146) IV; oyIs14 V; otEx3125. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx3125 [rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.
OH7204 sax-7(ky146) IV; oyIs14 V; otEx3135. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx3135 [myo-3p::sax-7cDNA short + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.
OH7213 sax-7(ky146) IV; oyIs14 V; otEx3126. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx3126 [dpy-7p::sax-7cDNA long + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.
OH7216 sax-7(ky146) IV; oyIs14 V; otEx3140. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx3140 [unc-14p::sax-7cDNA long-delta11 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.
OH7217 sax-7(ky146) IV; oyIs14 V; otEx3141. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx3141 [unc-14p::sax-7cDNA long-delta11 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.
OH7219 sax-7(ky146) IV; oyIs14 V; otEx3139. C. elegans oyIs14 [sra-6::GFP + lin-15(+)]. otEx3139 [unc-14p::sax-7cDNA long + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.
OH7235 zdIs13 IV; otEx3154. C. elegans zdIs13 [tph-1p::GFP] IV. otEx3154 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 1.
OH7236 zdIs13 IV; otEx3155. C. elegans zdIs13 [tph-1p::GFP] IV. otEx3155 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 2.
OH7237 zdIs13 IV; otEx3156. C. elegans zdIs13 [tph-1p::GFP] IV. otEx3156 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 3.
OH7251 zdIs13 IV; otEx3163. C. elegans zdIs13 [tph-1p::GFP] IV. otEx3163 [unc-120p::hif-1(p621A) + ttx-3::RFP]. Line 1.
OH7253 zdIs13 IV; otEx3165. C. elegans zdIs13 [tph-1p::GFP] IV. otEx3165 [unc-120p::hif-1(p621A) + ttx-3::RFP]. Line 3.
OH7260 zdIs13 IV; otEx3168. C. elegans zdIs13 [tph-1p::GFP] IV. otEx3168 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 1.
OH7261 zdIs13 IV; otEx3169. C. elegans zdIs13 [tph-1p::GFP] IV. otEx3169 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 2.
OH7262 zdIs13 IV; otEx3170. C. elegans zdIs13 [tph-1p::GFP] IV. otEx3170 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 3.
OH7310 otIs193 syIs63 IV. C. elegans otIs193 [cog-1p::lsy-6hp + rol-6(su1006)]; derived from otEx1450. syIs63 [cog-1::GFP + unc-119(+)]. Egl. Pvul.
OH7317 F21H12.1(ot86) rol-6(e187) II; ntIs1 V. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. Ectopic expression of ntIs1 in ASEL. Rollers. Whole genome sequenced strain.
OH7323 ceh-43(ot406) III; vtIs1 vsIs33 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer or extra cells expressing dat-1::GFP.
OH7410 unc-37(ot37) otIs114 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers.
OH750 otEx427. C. elegans otEx427 [hst-6p::GFP + rol-6(su1006)]. Transcriptional hst-6::GFP fusion. Maintain by picking Rollers.
OH7511 otIs197. C. elegans otIs197 [unc-14p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments.
OH7546 vtIs1 V; otIs198. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. otIs198 [hsp16-2::ast-1 + ttx-3::DsRed + hsp16-2::NLS::mCherry]. Rollers. Heat shock induces expression of nuclear mCherry and AST-1. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH7547 otIs199. C. elegans otIs199 [cat-2::GFP + rgef-1(F25B3.3)::DsRed + rol-6(su1006)]. Rollers. GFP expressed in dopaminergic neurons and dsRed expressed pan-neuronally. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH7566 mgIs18 unc-24(e138) nhr-67(ot407) IV; ntIs1 V; otEx3103. C. elegans mgIs18 [ttx-3p::GFP] IV. ntIs1 [gcy-5p::GFP + lin-15(+)] V. otEx3103 [elt-2::GFP]. All worms have mgIs18 and ntIs1. mgIs18 labels AIY interneurons. ntIs1 marks one GFP+ neuron (ASER) in the head. otEx3103 [elt-2::GFP] is expressed in intestinal cells; maintain by picking animals with intestinal GFP. Worms that have lost the array are Emb, Lvl, and have an ASE defect.
OH7631 nhr-67(ok631) IV; otEx3362. C. elegans otEx3362 [nhr-67(fosmid)::mCherry + elt-2::GFP]. Pick GFP+ to maintain. otEx3362 rescues nhr-67(ok631).
OH7677 lin-59(ot104) I; lsy-12(ot563) ntIs1 V. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. Whole genome sequenced strain.
OH7687 otEx3401. C. elegans otEx3401 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 1. Pick Rollers.
OH7688 otEx3402. C. elegans otEx3402 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 2. Pick Rollers.
OH7689 otEx3403. C. elegans otEx3403 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 3. Pick Rollers.
OH7690 otEx3398. C. elegans otEx3398 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 1. Pick Rollers.
OH7691 otEx3399. C. elegans otEx3399 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 2. Pick Rollers.
OH7692 otEx3400. C. elegans otEx3400 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 3. Pick Rollers.
OH7726 otIs114 I; nhr-67(ot158) IV. C. elegans otIs114 contains [lim-6p::GFP + rol-6(su1006)]. Rollers.
OH775 eno-4(ot4) II; oxIs12 X. C. elegans oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
OH7805 otIs204. C. elegans otIs204 [ceh-36p2::lsy-6 + elt-2p::GFP]. Reference: Poole RJ, et al. PLoS Genet. 2011 June; 7(6): e1002109.
OH7917 ast-1(ot417) II; otIs199. C. elegans otIs199 [cat-2::GFP + rgef-1(F25B3.3)::DsRed + rol-6(su1006)]. Rollers. No cat-2::GFP expression in DA neurons (CEP, ADE, PDE). Maintain under normal conditions. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH8 ttx-3(mg158) X. C. elegans Thermotaxis defective (cryophilic); strong loss of function.
OH8001 otIs114 I; lsy-12(ot177) V. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers. Whole genome sequenced strain.
OH8014 zdIs13 IV; otEx3567. C. elegans zdIs13 [tph-1p::GFP] IV. otEx3567 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 1.
OH8015 zdIs13 IV; otEx3568. C. elegans zdIs13 [tph-1p::GFP] IV. otEx3568 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 2.
OH8016 zdIs13 IV; otEx3569. C. elegans zdIs13 [tph-1p::GFP] IV. otEx3569 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 3.
OH812 otIs114 I. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)].
OH8249 otIs224. C. elegans otIs224 [cat-1(2493bp)::GFP].
OH8421 dpy-11 lsy-20(ot219) unc-76 V. C. elegans Whole genome sequenced strain.
OH8480 otIs221 III; him-8(e1489) IV. C. elegans otIs221 [cat-1::GFP]. GFP expression in monoaminergic neurons. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH8481 otIs226 IV; him-5(e1490) V. C. elegans otIs226 [bas-1::GFP]. Expression in monoaminergic neurons. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH8545 trp-4(ot477) I; vtIs1 vsIs33 V. C. elegans vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Whole genome sequenced strain.
OH8585 otIs4; otEx3822. C. elegans otIs4 [gcy-7::GFP]. otEx3822 [ceh-36::CZ-caspase3(p17) + gcy-7::caspase3(p12)-NZ + myo-3::mCherry].
OH8593 ntIs1 V; otEx3830. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. otEx3830 [ceh-36::CZ-caspase3(p17) + gcy-5::caspase3(p12)-NZ + myo-3::mCherry].
OH8882 otEx3909. C. elegans otEx3909 [ceh-36(fosmid)::YFP + rol-6(su1006)]. otEx3909 is a complex array derived from injection with PvuII-digested E. coli genomic DNA. ceh-36::YFP is broadly expressed in early stage embryos and becomes restricted to ASE and AWC later in development. Pick rollers to maintain.
OH898 pha-1(e2123) III; otEx536. C. elegans otEx536 [ser-2(prom2)::GFP + pha-1(+)]. Maintain at 25C to select for transgenic animals.
OH8993 otIs252. C. elegans otIs252 [lsy-6(fosmid)::YFP + rol-6(su1006)]. Rollers. YFP expression in ASEL.
OH9016 ntIs1 V; lsy-2(ot90) X. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. Loss of ASEL fate. 2 cells GFP+ for ASER marker.
OH9019 otIs4; otIs253. C. elegans otIs4 [gcy-7::GFP]. otIs253 [ceh-36::CZ-caspase3(p17) + gcy-7::caspase3(p12)-NZ + myo-3::mCherry].
OH9022 ntIs1 V; otIs256. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs256 [ceh-36::CZ-caspase3(p17) + gcy-7::caspase3(p12)-NZ + myo-3::mCherry].
OH904 otIs33 IV. C. elegans otIs33 [kal-1::GFP]. Transcriptional kal-1::GFP reporterd expressed in specific subset of neurons, including interneurons (e.g. AIY, AIZ), sensory neurons, motorneurons (e.g. HSN). Expression is also seen in non-neuronal tissues (e.g. spermatheca).
OH906 otIs39 II. C. elegans otIs39 [unc-47(delta)::GFP + lin-15(+)]. Expressed in RMEL/R, AVL, RIS, DVB, PVT and unidentified amphid sensory neuron pair.
OH910 otIs77 II. C. elegans otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. Overexpressing line from P. Loria. The integrated array has been mapped to LG II between stP36 and maP1. AIY interneurons have a 100% penetrant axon branching phenotype. Otherwise, the animals look phenotypically wild type.
OH911 him-5(e1490) V; otIs35 X. C. elegans otIs35 [ttx-3p::kal-1 + rol-6(su1006)] X. otIs35 has been mapped to LG X between lon-2 and hst-6. Superficially wild-type; AIY interneurons have a 100% penetrant axon branching phenotype.
OH912 otIs76 mgIs18 IV. C. elegans otIs76 [pttx-3p::kal-1 + unc-122p::GFP] IV. mgIs18 [ttx-3p::GFP] IV. otIs76 is closely linked to mgIs18 on LG IV. Superficially wild-type. AIY interneurons have a 100% penetrant axon branching phenotype.
OH9279 otIs266. C. elegans otIs266 [cat-1p::mCherry]. A 2.5 kb upstream region of cat-1 ATG was cloned into pPD95.75 vector and GFP was replaced with mCherry. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH9294 otIs274. C. elegans otIs274 [FOSMID::die-1::2xFLAG::VENUS]. 2 ASER.
OH9305 unc-37(ot240) otIs114 I. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. Whole genome sequenced strain.
OH9330 hlh-3(ot354) II; otIs173 III. C. elegans otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OH9331 ttx-3(ot358). C. elegans Whole genome sequenced strain.
OH9370 otIs232; otEx4149. C. elegans otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. otEx4149 [cog-1(fosmid)::YFP + elt-2::DsRed]. Maintain by picking animals dsRed(+) in gut nuclei. Rollers. mCherry expression in ASER and ASEL.
OH9482 lol-1(ot567); otIs138 X. C. elegans otIs138 [ser-2(prom3)::GFP + rol-6(su1006)] X. Integrated array derived from otEx449. Whole genome sequenced strain.
OH9545 otIs287 IV. C. elegans otIs287 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] IV. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH96 him-5(e1467) V; mgIs19 X. C. elegans Rollers. Throws males. mgIs19 [lim-4::GFP + rol-6(su1006)].
OH9609 otIs291 V. C. elegans otIs291 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] V. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH9625 otIs292. C. elegans otIs292 [eat-4::mCherry + rol-6(su1006)]. Rollers. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH9639 ntIs1 V; him-8 IV; lim-6(ot146) X. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. 2 ASER. Him.
OH9668 che-1(ot489) I; him-5(e1490) V. C. elegans
OH9671 otIs114 I; lsy-27(ot108) II; otIs220 IV. C. elegans otIs220 [gcy-5::mCherry]. otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. 2 ASER.
OH9679 otIs300. C. elegans otIs300 [8xASEmotif::GFP + elt-2::DsRed]. elt-2::DsRed prone to silencing; maintain by picking DsRed+. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH9729 otIs302. C. elegans otIs302 [lsy-6::GFP (fosmid) + F25B3.3::DsRed2]; injected with bacterial DNA to form a complex array. otIs302 and otIs301 are different integrants of the same extrachromosomal array and behave similarly. Maintain at 15-20C. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH9838 otIs232; otEx4359. C. elegans otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL. otEx4359 [die-1(prom8)::2NLS::YFP + elt-2::DsRed]. Pick animals with dsRed+ intestinal nuclei to maintain otEx4359. otEx4359 carries a minimal (1 kb) promoter driving 2NLS::YFP only in ASEL.
OH9846 otIs305 ntIs1 V. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp16-2p::che-1::3xHA::BLRP + rol-6(su1006)] V; injected as complex array with Pvu II bacterial DNA. Rollers. Rol is prone to silencing in otIs305, but hsp transgene is still active in Hobert Lab assays. otIs305 is homozygous by PCR analysis (Hobert). Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH9882 otEx4390. C. elegans otEx4390 [8xASE::GFP::cog-1 3'UTR + rol-6(su1006)]. Maintain by picking Rollers.
OH99 mgIs18 IV. C. elegans mgIs18 [ttx-3p::GFP] IV. ttx-3p::GFP labels AIY interneurons.
OH998 otIs114 I; lin-49(ot78) IV; him-5 V. C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. Him. 2 ASER. Whole genome sequenced strain.
OH9991 otIs114 I; otIs220 IV; lsy-12(ot563) ntIs1 V. C. elegans ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs220 [gcy-5::mCherry]. otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. 2 ASER.
OH9995 otIs313. C. elegans otIs313 [sem-2(fosmid)::YFP + rol-6(su1006)]. Rollers. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.
PHX10278 zfh-2(syb10278[zfh-2::GSGGSGGTGGSG::mIAA7::wrmScarlet-I3::mIAA7]) I. C. elegans Endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069.
PHX1048 hdl-1(syb1048[hdl-1::gfp]) IV. C. elegans GFP tag inserted at the C-terminus of the endogenous hdl-1 locus by CRISPR/Cas9. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PHX1551 ceh-51(syb1551[ceh-51::GFP]) V. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-51 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1587 tab-1(syb1587[tab-1::GFP]) II. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous tab-1 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1592 ceh-5(syb1592[ceh-5::GFP]) I. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-5 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1610 ceh-92(syb1610[ceh-92::GFP]) III. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-92 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1656 ceh-8(syb1656[ceh-8::GFP]) I. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-8 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1658 unc-4(syb1658[unc-4::GFP]) II. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous unc-4 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1679 ttx-1(syb1679[ttx-1::GFP]) V. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ttx-1 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1849 ceh-23(syb1849[ceh-23::GFP)] III. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-23 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1884 ceh-75(syb1884[ceh-75::GFP]) V. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-75 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1955 ceh-87(syb1995[ceh-87::GFP]) II. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-87 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX2015 ceh-58(syb2015[ceh-58::GFP]) II. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-58 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX2517 ceh-86(syb2517[ceh-86::GFP::FLAG]) II. C. elegans Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-86 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX2575 rsp-4(syb2575[rsp-4::GFP]) II. C. elegans GFP tag inserted into endogenous rsp-1 locus. Reference: Pham K, et al. Genetics. 2021 Mar 3;217(1):1-17. doi: 10.1093/genetics/iyaa016. PMID: 33683371.
PHX2587 wac-1.1&wac-1.2(syb2587) I. C. elegans Superficially wild-type. Deletion removes of wac-1.1/Y40B1A.1 and wac-1.2/Y40B1A.3 (I:13344075 to 13358647, version WS276, PRJNA13758).
PHX2616 ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X. C. elegans Endogenous ins-9 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX2634 flp-3(syb2634[flp-3::T2A::3XNLS::GFP]) X. C. elegans GFP tag inserted at the C-terminus of the endogenous flp-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Tekieli T. et al. Development. 2021 Sep 15;148(18):dev199687. doi: 10.1242/dev.199687. PMID: 34415309.
PHX2658 flp-1(syb2658[flp-1::T2A::3XNLS::GFP]) IV. C. elegans GFP tag inserted at the C-terminus of the endogenous flp-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253.
PHX2685 ins-6(syb2685[ins-6::T2A::3xNLS::GFP]) II. C. elegans Endogenous ins-6 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX2704 nlp-50(syb2704[nlp-50::T2A::3xNLS::GFP]) II. C. elegans Endogenous nlp-50 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX2805 nlp-51(syb2805 [nlp-51::T2A::3xNLS::GFP]) II. C. elegans GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253.
PHX2878 ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. C. elegans T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous ric-4 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX2880 ceh-16(syb2709[loxP] syb2880[ceh-16::loxP::GFP]) III. C. elegans GFP tag inserted at the C-terminus of the endogenous ceh-16 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX2934 ceh-37(syb2933[loxP]) ceh-36(syb2934[ceh36::loxP::GFP]) X. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3072 rab-3(syb3072[rab-3::T2A::3xNLS::GFP]) II. C. elegans T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous rab-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX3112 nlp-12(syb3112[nlp-12::T2A::3×NLS::GFP]) I. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3169 flp-12(syb3169[flp-12::T2A::3xNLS::GFP]) X. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3172 flp-25(syb3172[flp-25::T2A::3×NLS::GFP]) III. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3179 nlp-10(syb3179[nlp-10::T2A::3×NLS::GFP]) III. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3184 flp-17(syb3184[flp-17::T2A::3xNLS::GFP]) IV. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3186 nlp-3 (syb3186 [nlp-3::T2A::3XNLS::GFP]) X. C. elegans GFP tag inserted at the C-terminus of the endogenous nlp-3 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3187 flp-10(syb3187[flp-10::T2A::3xNLS::GFP]) IV. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3191 nlp-58(syb3191 [nlp-58::T2A::3xNLS::GFP]) V. C. elegans GFP tag inserted at the C-terminus of the endogenous nlp-58 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX3193 flp-18(syb3193[flp-18::T2A::3×NLS::GFP]) X. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3195 flp-33(syb3195[flp-33::T2A::3xNLS::GFP]) I. C elegans GFP tag inserted into endogenous flp-33 locus using CRISPR/Cas9 engineering. GFP expression in ADE (in head). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
PHX3203 flp-6 (syb3203 [flp-6::T2A::3XNLS::GFP]) V. C. elegans GFP tag inserted at the C-terminus of the endogenous flp-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3207 flp-28(syb3207[flp-28::T2A::3xNLS::GFP]) X. C. elegans Endogenous flp-28 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3208 nlp-40(syb3208 [nlp-40::T2A::3XNLS::GFP]) I. C. elegans GFP tag inserted at the C-terminus of the endogenous nlp-40 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3212 flp-21(syb3212 [flp-21::T2A::3×NLS::GFP]) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3222 nlp-17(syb3222[nlp-17::T2A::3×NLS::GFP]) IV. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3229 flp-9(syb3229[flp-9::T2A::3xNLS::GFP]) IV. C. elegans CRISPR/Cas9 engineered tagged endogenous locus.
PHX3230 flp-15(syb3230[flp-15::T2A::3xNLS::GFP]) III. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3238 nlp-42(syb3238[nlp-42::T2A::3XNLS::GFP]) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3240 nlp-1(syb3240[nlp-1::T2A::3XNLS::GFP]) X. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3241 flp-20 (syb3241 [flp-20::T2A::3xNLS::GFP]) X. C. elegans GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX3242 flp-23(syb3242[flp-23::T2A::3xNLS::GFP]) III. C. elegans CRISPR/Cas9 engineered tagged endogenous locus.
PHX3250 capa-1(syb3250[capa-1::T2A::3xNLS::GFP]) X. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3251 flp-16(syb3251[flp-16::T2A::3XNLS::GFP]) II. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3252 unc-10(syb2898 syb3252[unc-10::T2A::3xNLS::GFP]) X. C. elegans T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous unc-10 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX3257 flp-34(syb3257[flp-34::T2A::3xNLS::GFP]) V. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3262 nlp-47(syb3262[nlp-47::T2A::3XNLS::GFP]) IV. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3275 pdf-2(syb3275[pdf-2::T2A::3xNLS::GFP]) X. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. pdf-2 also known as nlp-37. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3277 flp-13 (syb3277 [flp-13::T2A::3XNLS::GFP]) IV. C. elegans GFP tag inserted at the C-terminus of the endogenous flp-13 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3278 flp-19(syb3278 [flp-19::T2A::3xNLS::GFP]) X. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
PHX3285 nlp-54(syb3285 [nlp-54::T2A::3xNLS::GFP]) IV. C. elegans GFP tag inserted at the C-terminus of the endogenous nlp-54 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3288 nlp-23(syb3288[nlp-23::T2A::3xNLS::GFP]) X. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3301 flp-22(syb3301[flp-22::T2A::3xNLS::GFP]) I. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3306 nlp-62(syb3306[nlp-62::T2A::3XNLS::GFP]) I. C. elegans GFP tag inserted at the C-terminus of the endogenous nlp-62 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3317 flp-11b(syb3317[flp-11b::T2A::3XNLS::GFP]) X C. elegans CRISPR/Cas9 engineered tagged endogenous locus.
PHX3319 nlp-22(syb3319[nlp-22::T2A::3×NLS::GFP]) X. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3320 nlp-49(syb3320[nlp-49::T2A::3XNLS::GFP]) X. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX3321 ntc-1(syb3321[ntc-1::T2A::3xNLS::GFP]) X. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3323 flp-14(syb3323[flp-14::T2A::3xNLS::GFP]) III. C. elegans Endogenous flp-14 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3330 pdf-1(syb3330[pdf-1::T2A::3xNLS::GFP]) III. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3334 flp-24(syb3334[flp-24::T2A::3×NLS::GFP]) III. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3372 rgba-1(syb3372[rgba-1::T2A::3xNLS::GFP]) I. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3373 nlp-70(syb3373[nlp-70::T2A::3xNLS::GFP]) V. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3384 nlp-64(syb3384[nlp-64::T2A::3xNLS::GFP]) X. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3388 nlp-38(syb3388[nlp-38::T2A::3xNLS::GFP]) I. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3411 nlp-13(syb3411[nlp-13::T2A::3xNLS::GFP]) V. C. elegans Endogenous nlp-13 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3426 ceh-27(syb2714[loxP] syb3286[loxP] syb3426[ceh27::GFP]) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3436 flp-4(syb3436[flp-4::T2A::3XNLS::GFP]) II. C. elegans Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3588 flp-26(syb3588[flp-26::T2A::3xNLS::GFP]) X. C. elegans Endogenous flp-26 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3596 tph-1(mg280) pah-1(syb3596) II. C. elegans Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX3601 pah-1(syb3601) II. C elegans Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX362 vglu-2(syb362[vglu-2::gfp]) III. C. elegans GFP tag inserted into C-terminus of endogenous vglu-2 locus. Reference: Serrano-Saiz E, et al. Genetics. 2019 Nov 27. pii: genetics.302855.2019. PMID: 31776169
PHX3634 pah-1(syb3634[GFP::H2B::T2A::pah-1]) II. C elegans Superficially wild-type. GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
PHX3678 tph-1(mg280) pah-1(syb3678[GFP::H2B::T2A::pah-1]) II. C elegans GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
PHX3936 nlp-51(syb3936[nlp-51::SL2::GFP::H2B]) II. C. elegans GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
PHX4049 flp-20(syb4049[flp-20::SL2::GFP::H2B]) X. C. elegans GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX4257 eat-4(syb4257[eat-4::T2A::GFP::H2B]) III. C. elegans Endogenous eat-4 locus tagged with T2A::GFP::H2B. Healthy strain that has all glutamatergic neurons marked with GFP. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425
PHX4373 nova-1(syb4373[nova-1::GFP]) V. C. elegans GFP tag inserted at the C-terminus of the endogenous nova-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX4374 flp-32(syb4374[flp-32::SL2::gfp::H2B]) X. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
PHX4376 rbm-25(syb4376[rbm-25::GFP]) V. C. elegans GFP tag inserted at the C-terminus of the endogenous rbm-25 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX4399 nlp-82(syb4399[nlp-82::SL2::GFP::H2B]) II. C. elegans GFP tag inserted at the C-terminus of the endogenous nlp-82 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX4406 nlp-73(syb4406 [nlp-73::SL2::GFP::H2B]) V. C. elegans GFP tag inserted at the C-terminus of the endogenous nlp-73 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX4413 flp-27(syb4413 [flp-27::SL2::GFP::H2B]) II. C. elegans GFP tag inserted at the C-terminus of the endogenous flp-27 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
PHX4421 trh-1(syb4421[trh-1::SL2::GFP::H2B]) IV. C. elegans CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.
PHX4426 ehs-1(syb4426[ehs-1::SL2::GFP::H2B]) II. C. elegans SL2::GFP::H2B tag inserted at the C-terminus of the endogenous ehs-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX4430 kcc-3(syb4430[kcc-3::SL2::TagRFP-T::H2B]) II. C. elegans Endogenous locus tagged with SL2::TagRFP-T::H2B at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX4433 npr-32 (syb4433 [npr-32::SL2::GFP::H2B] IV. C. elegans GFP tag inserted at the C-terminus of the endogenous npr-32 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX4440 npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV. C. elegans GFP tag inserted at the C-terminus of the endogenous npr-37 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
PHX4442 dmsr-6 (syb4442 [dmsr-6::SL2::GFP::H2B]) I. C. elegans GFP tag inserted at the C-terminus of the endogenous dmsr-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX4447 aex-2(syb4447 [aex-2::SL2::GFP::H2B)] X. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
PHX4453 trhr-1(syb4453[trhr-1::SL2::GFP::H2B]) I. C. elegans CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.
PHX4454 hmr-1(syb4454 [hmr-1::SL2::GFP::H2B]) I. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous hmr-1 locus.
PHX4476 cdh-4(syb4476[cdh-4::SL2::GFP::H2B]) III. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-4 locus.
PHX4478 egl-3(syb4478[egl-3::SL2::GFP::H2B]) V. C. elegans SL2::GFP::H2B tag inserted at the C-terminus of the endogenous elg-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX4491 unc-17(syb4491[unc-17::T2A::GFP::H2B]) IV. C. elegans CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
PHX4502 ser-7(syb4502[ser-7::SL2::GFP::H2B]) X. C. elegans CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
PHX4512 nlp-69(syb4512[nlp-69::SL2::gfp::H2B]) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
PHX4513 flp-5(syb4513[flp-5::SL2::GFP::H2B]) X. C. elegans CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.
PHX4514 dmsr-2(syb4514 [dmsr-2::SL2::gfp::H2B]) I. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
PHX4517 nmur-2(syb4517 [nmur-2::SL2::GFP::H2B)] II. C. elegans GFP tag inserted at the C-terminus of the endogenous nmur-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX4523 frpr-19(syb4523[frpr19::SL2::GFP::H2B]) IV. C. elegans GFP tag inserted at the C-terminus of the endogenous frpr-19 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX4537 unc-39(syb4537[unc-39::gfp]) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
PHX4563 fmi-1(syb4563)[fmi-1::SL2::GFP::H2B]) V. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous fmi-1 locus.
PHX4595 tkr-1 (syb4595 [tkr-1::SL2::GFP::H2B]) III. C. elegans GFP tag inserted at the C-terminus of the endogenous tkr-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX4677 kin-36(syb4677[GFP::HIS::SL2::kin-36]) IV. C. elegans CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
PHX4678 ceh-30(syb4678[ceh-30::GFP]) X. C. elegans GFP tag inserted at the C-terminus of the endogenous ceh-30 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX4693 che-7(syb4693[che-7::SL2::gfp::H2B]) V. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
PHX4729 rig-6(syb4729[rig-6::SL2::GFP::H2B]) II. C. elegans CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
PHX4763 rig-3(syb4763[rig-3::SL2::GFP::H2B]) X. C. elegans CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
PHX4799 ceh-38(syb4799[ceh-38::GFP]) II. C. elegans GFP tag inserted at the C-terminus of the endogenous ceh-38 locus by CRISPR. Allele generated by SUNY Biotech.
PHX4861 gpla-1(syb4861[flr-2::SL2::GFP::H2B]) V. C. elegans CRISPR/Cas9-engineered reporter allele. gpla-1 formerly known as flr-2. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
PHX4895 htrl-1(syb4895[htrl-1::SL2::GFP::H2B]) V. C. elegans CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
PHX4901 ceh-41(syb4901[ceh-41::GFP]) X. C. elegans GFP tag inserted at the C-terminus of the endogenous ceh-41 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX5073 ceh-43(syb5073[ceh-43::SL2::GFP::H2B]) III. C elegans GFP tag inserted into endogenous ceh-43 locus using CRISPR/Cas9 engineering. GFP expression in IL1, CEP, AIN, AIZ, ASJ, ADE, BDU, SDQ, PDE, PVQ, and possibly glia. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
PHX5218 cest-4(syb5218[cest-4::SL2::GFP::H2B]) IV. C elegans GFP tag inserted into endogenous cest-4 locus by CRISPR/Cas9.
PHX5229 degl-2(syb5229[degl-2::SL2::gfp::H2B]) IV. C. elegans CRISPR/Cas9 engineered tagged endogenous locus.
PHX5349 tpan-1(syb5349[tpan-1::GFP]) V. C. elegans GFP tag inserted at the C-terminus of the endogenous tpan-1 locus by CRISPR. Allele generated by SUNY Biotech.
PHX5400 golg-5(syb5400[golg-5::wrmScarlet]) I. C. elegans wrmScarlet tag inserted at the C-terminus of the endogenous golg-5 locus by CRISPR. Broad punctate expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX5413 flp-7(syb5413[flp-7::SL2::GFP::H2B]) X. C. elegans Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX5424 ins-7(syb5424[ins-7::SL2::GFP::his-44]) IV. C. elegans SL2::GFP::HIS-44 tag inserted into the endogenous ins-7 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
PHX5437 cone-1(syb5437[gfp::cone-1]) III. C elegans GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. [NOTE: Previously described as ceh-44(syb5437[gfp::ceh-44]) III. ceh-44 and cone-1 are located in the same locus and may share many exons, but are two separate genes with different functions and expression patterns. Please contact Oliver Hobert prior to publishing work using this strain.
PHX5452 ins-1(syb5452[ins-1::SL2::gfp::H2B]) IV. C. elegans CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
PHX5462 ins-18(syb5462[ins-18::SL2::GFP::his-44]) I. C. elegans SL2::GFP::HIS-44 tag inserted into the endogenous ins-18 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
PHX5500 ceh-44(syb5500[ceh-44::oxGFP]) III. C elegans oxGFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX5536 ins-9(syb5536[ins-9::SL2::gfp::H2B]) X. C. elegans GFP tag inserted at the C-terminus of the endogenous ins-9 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX5561 ins-33(syb5561[ins-33::SL2::gfp::his-44]) I. C. elegans SL2::GFP::HIS-44 tag inserted into the endogenous ins-33 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
PHX5697 nlp-2(syb5697 [nlp-2::SL2::GFP::H2B]) X. C. elegans GFP tag inserted at the C-terminus of the endogenous nlp-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
PHX5755 pha-4(syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG] *ot1078 *ot946) V. C. elegans Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID* after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.
PHX5804 egl-3(syb5804[flag::NLS::Cre::SL2::egl-3]) V. C. elegans Cre inserted into the endogenous egl-3 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX5843 ceh-44(syb5843[ceh-44::gfp(exon8)]) III. C elegans GFP tag inserted at the N-terminus of the endogenous ceh-44 locus by CRISPR. Pan-neuronal nuclear expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX5859 ceh-48(syb5859[flag::NLS::Cre::SL2::ceh-48]) IV. C. elegans Cre inserted into the endogenous ceh-48 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX5923 bas-1(syb5923[bas-1::SL2::GFP::H2B]) III. C elegans GFP tag inserted into endogenous bas-1 locus by CRISPR/Cas9.
PHX6078 hlh-32(syb6078[hlh-32::GFP]) IV. C. elegans Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX6112 hlh-31(syb6112[hlh-31::GFP]) IV. C. elegans Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX6123 T07A9.10(syb6123[T07A9.10::SL2::GFP::H2B) IV. C. elegans GFP tag inserted at the C-terminus of the endogenous T07A9.10 locus by CRISPR. Punctate ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6153 latd-1(syb6153[latd-1::GFP) X. C. elegans C39D10.6. GFP tag inserted at the C-terminus of the endogenous latd-1 locus by CRISPR. Punctate GFP expression in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6236 ins-35(syb6236[ins-35::SL2::GFP::his-44]) V. C. elegans SL2::GFP::HIS-44 tag inserted into the endogenous ins-35 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
PHX6281 ceh-44(syb6281[ceh-44::gfp(exon7)]) III. C elegans GFP tag inserted at exon 7 of the endogenous ceh-44 locus by CRISPR. Nuclear pan-neuronal nuclear and broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6303 hlh-17(syb6303[hlh-17::GFP]) IV. C. elegans Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX6304 syx-3(syb6304[syx-3::SL2::GFP::H2B]) X. C. elegans GFP tag inserted at the C-terminus of the endogenous syx-3 locus by CRISPR. Ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6325 unc-13(syb6325[unc-13::SL2::GFP::H2B) I. C. elegans GFP tag inserted at the C-terminus of the endogenous unc-13 locus by CRISPR. Nuclear neuronal and hypodermal expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6345 W02D7.3(syb6345[GFP::W02D7.3]) V. C. elegans GFP tag inserted at the N-terminus of the endogenous W02D7.3 locus by CRISPR. Expression of GFP in pharynx, excretory gland cell, and some additional cells in the head. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6377 uncp-18(syb6377) IV. C.elegans T07A9.10. syb6377 deletion removes all but exon 1 and part of exon 2 of uncp-18 locus. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6394 Y71G12B.26(syb6394[Y71G12B.26::GFP]) I. C. elegans GFP tag inserted at the C-terminus of the endogenous Y71G12B.26 locus by CRISPR. Expression of GFP in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6451 tph-1(syb6451[tph-1::SL2::GFP::H2B]) II. C. elegans Endogenous tph-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PHX6466 F36D1.23(syb6466[F36D1.23::tagRFP]) I. C. elegans tagRFP tag inserted at the C-terminus of the endogenous F36D1.23 locus by CRISPR. Strong and specific expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6486 cat-1(syb6486[cat-1::SL2::GFP::H2B]) X. C. elegans Endogenous cat-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PHX6499 unc-75(syb6499[gfp::unc-75]) I. C elegans GFP tag inserted at the N-terminus of the endogenous unc-75 locus by CRISPR. Pan-neuronal nuclear expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6541 spex-2(syb6541[spex-2::SL2::GFP]) I. C. elegans GFP tag inserted at the C-terminus of the endogenous spex-2/F36D1.7 locus by CRISPR. Expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6547 golg-4(syb6547[wrmScarlet::golg-4]) III. C elegans wrmScarlet tag inserted at the N-terminus of the endogenous golg-4 locus by CRISPR. Broad punctate wrmScarlet expression. Allele generated by SUNY Biotech. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
PHX6635 hlh-17 hlh-31(syb6635) IV. C. elegans CRISPR/Cas9-engineered 5421 bp deletion entirely removing both hlh-17 and hlh-31. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX6640 cdh-5(syb6640[cdh-5::GFP]) IV. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-5 locus.
PHX6670 spig-2(syb6670[spig-2::SL2::GFP::H2B]) V. C. elegans SL2::GFP::H2B cassette inserted directly before the stop codon of the endogenous spig-2 locus. spig-2 also known as txt-17 or F20A1.10. Reference: Aguilar GR & Hobert O. (2024). A protocol to transform a fluorescent reporter from a nuclear to a cytoplasmic location. microPublication Biology. https://doi.org/10.17912/micropub.biology.000954
PHX6680 golg-2(syb6680[wrmScarlet::golg-2]) II. C elegans wrmScarlet tag inserted at the N-terminus of the endogenous golg-2 locus by CRISPR. Broad punctate wrmScarlet expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6739 unc-64(syb6739[unc-64::SL2::GFP::H2B) III. C.elegans GFP tag inserted at the C-terminus of the endogenous unc-64 locus by CRISPR. Ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6764 cdh-4(syb6764[cdh-4::GFP]) III. C. elegans SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-4 locus.
PHX6773 hlh-17 hlh-31(syb6635) hlh-32(syb6773) IV. C. elegans Triple mutant for hlh-17, hlh-31, and hlh-32. CRISPR/Cas9-engineered 1691 bp deletion of the entire hlh-32 locus in hlh-17 hlh-31(syb6635) double mutant parental strain. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX679 vglu-3(syb679[vglu-3::gfp]) III. C. elegans GFP tag inserted at C-terminus endogenous vglu-3 locus. Reference: Serrano-Saiz E, et al. Genetics. 2019 Nov 27. pii: genetics.302855.2019. PMID: 31776169
PHX6898 cone-1(syb6898 [cone-1::T2A::GFP::H2B]) III. C elegans GFP tag inserted at C-terminus of endogenous cone-1 locus by CRISPR. Broad nuclear GFP expression in non-neuronal cells. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7278 unc-46(syb7278[unc-46::SL2::GFP::H2B]) V. C. elegans Endogenous unc-46 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PHX7290 snf-3(syb7290[snf-3::tagRFP::SL2::GFP::H2B]) II. C. elegans Endogenous snf-3 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PHX7352 nlp-29(syb7352[nlp-29::SL2::GFP::H2B]) V. C. elegans Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7377 nlp-7b(syb7377[nlp-7b::SL2::GFP::H2B]) X. C. elegans Endogenous nlp-7 locus (B-isoform) tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7380 cone-1(syb7380[wrmScarlet::cone-1]) III. C. elegans Broad puncate expression in non-neuronal cells, later expression initiatiated ~1.5-2 fold stage. wrmScarlet tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7394 nlp-36(syb7394[nlp-36::SL2::GFP::H2B]) III. C. elegans Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7422 nlp-39(syb7422[nlp-39::SL2::GFP::H2B]) I. C. elegans Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7428 nlp-15(syb7428[nlp-15::SL2::GFP::H2B]) I. C. elegans Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7529 ceh-44(syb7529[ceh-44(exon 4)::GFP]) III. C. elegans GFP tag inserted in exon 4 of endogenous ceh-44 locus. Broad, weak, punctate GFP expression in non-neuronal cells. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7537 nlp-20(syb7537[nlp-20::SL2::GFP::H2B]) IV. C. elegans Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7564 nlp-79(syb7564[nlp-79::SL2::GFP::H2B]) IV. C. elegans Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7566 unc-47(syb7566[unc-47::SL2::GFP::H2B]) III. C. elegans Endogenous unc-47 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PHX7685 hlh-13(syb7685 [hlh-13::GFP]) X. C. elegans Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX7688 hlh-15(syb7688 [hlh-15::GFP]) X. C. elegans Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX7768 tdc-1(syb7768[GFP::linker::H2B::T2A::tdc-1]) II. C. elegans Endogenous tdc-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PHX7786 tbh-1(syb7786[tbh-1::SL2::GFP::H2B]) X. C. elegans Endogenous tbh-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PHX8255 cat-2(syb8255[cat-2::SL2::GFP::H2B]) II. C. elegans Endogenous cat-2 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PHX8612 bcat-1(syb8612[bcat-1::SL2::GFP::H2B]) X. C. elegans Endogenous locus tagged with SL2::GFP::H2B at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX8870 oct-1(syb8870[oct-1::SL2::GFP::H2B]) I. C. elegans Endogenous oct-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PHX9045 degt-1(syb9045[degt-1::SL2::GFP::H2B]) V. C. elegans SL2::GFP::H2B tag inserted at the C-terminus of the endogenous degt-1 locus. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
PHX9810 btbz-2(syb9810[btbz-2::GFP]) II. C. elegans GFP tag inserted at C-terminus of endogenous btbz-2 locus. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501.
TU2589 dpy-20(e1282) IV; uIs25 X. C. elegans uIs25 [mec-18::GFP + dpy-20(+)].

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
ot406 Allele
ot9 Allele
ot22 Allele substitution nonsense
ot71 Allele deletion
ot108 Allele substitution
ot1 Allele substitution
ot28 Allele substitution
ot25 Allele substitution
ot17 Allele substitution
ot19 Allele substitution
ot26 Allele substitution nonsense
ot2 Allele
ot3 Allele
ot6 Allele
ot40 Allele
ot7 Allele
ot8 Allele
ot101 Allele substitution
ot64 Allele substitution nonsense
ot119 Allele substitution
ot123 Allele deletion
ot124 Allele substitution
ot155 Allele substitution
ot149 Allele substitution
ot150 Allele substitution
ot151 Allele substitution nonsense
ot153 Allele substitution
ot154 Allele substitution nonsense
ot170 Allele substitution nonsense
ot159 Allele substitution splice_site
ot188 Allele substitution
ot198 Allele substitution
ot191 Allele substitution nonsense
ot200 Allele substitution
ot201 Allele substitution
ot228 Allele substitution nonsense
ot136 Allele substitution splice_site
ot202 Allele substitution splice_site
ot248 Allele substitution
ot231 Allele substitution nonsense
ot236 Allele substitution
ot238 Allele
ot232 Allele substitution
ot190 Allele substitution
ot234 Allele substitution
ot253 Allele
ot242 Allele substitution splice_site
ot257 Allele
ot259 Allele
ot266 Allele substitution nonsense
ot267 Allele
ot269 Allele
ot271 Allele
ot273 Allele
ot274 Allele
ot276 Allele
ot282 Allele
ot283 Allele
ot284 Allele
ot287 Allele
ot289 Allele
ot296 Allele
ot297 Allele
ot298 Allele
ot59 Allele
ot35 Allele substitution
ot89 Allele
ot338 Allele
ot345 Allele
ot342 Allele
ot343 Allele
ot339 Allele
ot346 Allele
ot327 Allele substitution
ot38 Allele substitution
ot355 Allele substitution splice_site
ot356 Allele substitution
ot357 Allele substitution nonsense
ot360 Allele substitution splice_site
ot361 Allele
ot364 Allele
ot365 Allele substitution splice_site
ot244 Allele
ot366 Allele
ot371 Allele
ot37 Allele
ot407 Allele substitution
ot158 Allele substitution
ot4 Allele
ot417 Allele substitution
ot90 Allele substitution
ot146 Allele substitution
ot78 Allele substitution splice_site
ot563 Allele substitution