| CGC98 |
C. elegans |
lin-4(umn10[lin-4p::mScarlet-I + Lox511I::let-858 3'UTR sqt-1(d) hsp::CRE hygR Lox511I::let-858 3'UTR])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet. Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CGC99 |
C. elegans |
lin-4(umn11[lin-4p+SL1(short)::mScarlet-I + Lox511I::let-858 3'UTR sqt-1(d) hsp::CRE hygR Lox511I::let-858 3'UTR])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (short sequence). Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| cku-80;let-418 |
C. elegans |
Show Description
Increase in apoptotic nuclei and defective in RAD-51 removal. Decreased number of offspring.
|
|
| CL4176 |
C. elegans |
smg-1(cc546) I; dvIs27 X. Show Description
dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL6180 |
C. elegans |
smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL691 |
C. elegans |
dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.
|
|
| CP38 |
C. briggsae |
Cbr-tra-1(nm2)/Cbr-let(nm28) III. Show Description
When singled, hermaphrodites should throw 2/3 hermaphrodites and 1/2 nm2 XX males. The lethal appears to balance the nm2 allele pretty well, but precise recombination mapping has not been performed. The XX males maintain their phenotypic resemblance to the unbalanced strain and are probably not fertile due to obvious gonadal deficiencies. This strain has been successfully grown at 15C and 20C. Both strains appear to have complete penetrance of the mutant phenotypes.
|
|
| CT12 |
C. elegans |
zaEx5. Show Description
zaEx5 [let-7::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.
|
|
| CV391 |
C. elegans |
cra-1(tm2144) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); acer-1(rj15) II. Show Description
acer-1(rj15) is a 7 nt deletion (removes nt 35-41 from the start codon) resulting in an out-of-frame deletion and increased histone acetylation. cra-1(tm2144) is a homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm2144 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Gao J, et al., PLoS Genet. 2015 Mar 13;11(3):e1005029.
|
|
| CZ22695 |
C. elegans |
juEx6908. Show Description
juEx6908 [nmr-1p::PH::miniSOG(Q103L) + nmr-1p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Interneuron expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
|
|
| CZ22698 |
C. elegans |
juEx6911. Show Description
juEx6911 [unc-25p::PH::miniSOG(Q103L) + unc-25p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in GABAergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
|
|
| CZ22703 |
C. elegans |
juEx6916. Show Description
juEx6916 [myo-3p::PH::miniSOG(Q103L) + myo-3p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in body wall muscles. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
|
|
| CZ23277 |
C. elegans |
juEx7101. Show Description
juEx7101 [col-19p::PH::miniSOG(Q103L) + ttx-3::RFP]. Pick RFP+ to maintain. Adult epidermal expression of PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
|
|
| CZ23279 |
C. elegans |
juEx7103. Show Description
juEx7103 [unc-17p(beta)::PH::miniSOG(Q103L) + acr-2p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in cholinergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. [NOTE: strain was previously described as carrying ttx-3::GFP, but appears to be ttx-3::RFP instead.]
|
|
| CZ23281 |
C. elegans |
juEx7105. Show Description
juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
|
|
| CZ25415 |
C. elegans |
nmat-2(ju1514) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP nmat-2(ju1514) homozygotes (sterile adults). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420
|
|
| DA1042 |
C. elegans |
egl-19(ad1008) unc-24(e138) IV/nT1 [unc-?(n754) let-?] (IV;V) Show Description
Heterozygotes are Unc and segregate Uncs and dead eggs. ad1008 homozygotes are Pat.
|
|
| DA497 |
C. elegans |
let-59(s49) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and lethal twitchers. Lethal early larval. Pick twitchers in 1% nicotine.
|
|
| DCR9089 |
C elegans |
olaIs138 IV. Show Description
olaIs138 [ttx-3p::SL2::HYlight::let-858 3'UTR + elt-7p::mCherry] IV. Expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells, in the neuron pair AIY. Derived by UV/TMP insertion of the olaEx5367 transgene. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527.
|
|
| DH246 |
C. elegans |
let-2(b246) X. Show Description
Temperature sensitive embryonic lethal. Grows at 15C, 20C. Lethal at 25C (embryonic). See also CGC 1806.
|
|
| DLW124 |
C. elegans |
wrdSi22 I; unc-52(knu968[AID*::unc-52]) II. Show Description
wrdSi22 [eft-3p::TIR1::F2A::mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DM3414 |
C. elegans |
unc-4(e120) let-268(ra414)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys and lethals.
|
|
| DQM104 |
C. elegans |
bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.
|
|
| DR1056 |
C. elegans |
unc-42(e270) ama-2(m323) V/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. (Chromosome carrying unc-42 ama-2 is homozygous lethal.) Strain is resistant to _-amanitin.
|
|
| DR1172 |
C. elegans |
let-60(s59) unc-22(s7) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Lethal Twitchers, and dead eggs. Lethal mid-larval (leaky). Maintain by picking WT. Heterozygotes twitch in 1% nicotine.
|
|
| DR1215 |
C. elegans |
unc-22(s7) let-67(s214) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, dead eggs and Twitchers that arrest as larvae. Maintain by picking WT. Hets twitch in 1% nicotine.
|
|
| DR1218 |
C. elegans |
mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-265(mn188) II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, and Lethal Unc-4 (lethal mid-larval). Maintain by picking WT.
|
|
| DR1809 |
C. elegans |
unc-4(e120)/mIn1 [dpy-10(e128) let-?(m727)] II. Show Description
Heterozygotes are WT and segregate WT, unc-4, and lethal mIn1 homozygotes. Pick WT and check for correct segregation of progeny.
|
|
| DR2054 |
C. elegans |
mIn1 [unc-4(e120) dpy-10(e128)]/let-552(e2542) rol-1(e91) II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc [mIn1(mc6) homozygotes], and two-fold arrest Let Rol progeny. Well balanced. Male stock. Cross WT males to WT hermaphrodites and check for correct segregation of progeny.
|
|
| DR2055 |
C. elegans |
mIn1(+) II. Show Description
Dark-bodied, unmarked variant of mIn19mC6) with small broods. Presumably balances let-552 to rol-1 (hermaphrodite stock obtained from outcrossing these males to dpy-10 unc-4 was shown to balance this interval). Isolated from DR1982 as a stock that no longer segregated Dpy-10 animals. Not clear whether this strain is the result of chromosome rearrangement in DR1982, or if DR1982 stock was a mixture of mIn1(+)/mIn[dpy-10] and mIn1(+) homozygotes.
|
|
| DR2075 |
C. elegans |
mIn1 [unc-4(e120)]/let-552(e2542) rol-1(e91) II. Show Description
Heterozygotes are WT and segregate WT, Lethal Rollers (arrested 2-fold hatchlings), and Unc-4 mIn1(mC6) homozygotes. Pick WT and check for correct segregation of progeny.
|
|
| DR2102 |
C. elegans |
mIn1 [rol-1(e91)]/let-552(e2542) unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, Lethal Uncs and Roller mIn1 homozygotes. let-552 unc-4 chromosome is well balanced. Rol does not express until late L4/early adult. Pick WT and check for correct segregation of progeny.
|
|
| DR2150 |
C. elegans |
mIn1 [rol-1(e91) dpy-10(e128)]/let-552(e2542) unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, DpyRol mIn1 homozygotes and 2-fold arrest Unc larvae. Male stock; mate WT males and WT hermaphrodites to maintain.
|
|
| DR690 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-272(m243) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLet.
|
|
| DR691 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-287(m244) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are sterile adults. Maintain by picking semi-Dpy.
|
|
| DR692 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-275(m245) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. Lethal mid-larval. Maintain by picking semi-Dpy.
|
|
| DR694 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-281(m247) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
|
|
| DR695 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-285(m248) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adult steriles. Maintain by picking semi-Dpy.
|
|
| DR703 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-274(m256) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. Lethal early larval. Maintain by picking semi-Dpy.
|
|
| DR705 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-282(m258) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
|
|
| DR706 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-280(m259) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
|
|
| DR709 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-279(m261) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
|
|
| DR710 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-277(m262) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpys, Uncs and Lets. Lethal mid-larval. Maintain by picking semi-Dpy.
|
|
| DR711 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-273(m263) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
|
|
| DR715 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-284(m267) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
|
|
| DR717 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-286(m269) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adults which lay eggs that do not hatch. Maintain by picking semi-Dpy.
|
|
| DR767 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-288(m306) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. DpyLets are adult steriles. Maintain by picking semi-Dpy.
|
|
| DR787 |
C. elegans |
dpy-13(e184) ama-1(m118) let-276(m240)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, DpyLet and dead eggs. Lethal early larval. Maintain by picking semi-Dpy.
|
|
| DR789 |
C. elegans |
dpy-13(e184) IV/nT1 [let-?(m435)] (IV;V); unc-42(e270) V/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
|
|
| DR793 |
C. elegans |
dpy-13(e184) mDf7 IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy and dead eggs (mDf7/mDf7, nT1/nT1 and aneuploids). This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle. Rec'd new stock 11/99 from Riddle lab.
|
|