Search Strains

zpEx204 [pat-4::YFP + pat-3::CFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. zpEx204 produces a fully functional YFP-tagged pat-4 protein that localizes to the dense bodies in muscle cells, and rescues the lethal phenotype of pat-4(st551) homozygous animals. Reference: Mackinnon AC, et al. Curr Biol. 2002 May 14;12(10):787-97.

Auxin-inducible degron (AID*) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Can be used in conjunction with tissue-specific TIR1-expressing lines to degrade RAGA-1 protein via the Auxin Inducible Degron system. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.

wbmIs83 [rab-3p::3xFlag::TIR1::rab-3 3'UTR] *wbmIs66 IV. Auxin-inducible degron (AID*) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Neuronal-specific expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the nervous system. wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.

wbmEx49 [rab-3p::crtc-1(S76A, S179A)::tdTomato::unc-54 UTR]. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression in neurons. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.

wbmIs118 [myo-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs114] I. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in muscle. wrmScarlet expression in muscle. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs114. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs99 [rab-3p::3xFLAG::rpl-22::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs89] IV. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs89. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs119 [eft-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs88] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in soma. wrmScarlet expression in soma. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs88. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Auxin-inducible degron (AID*) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Somatic expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the soma. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 3772195

wbmIs131 [nep-17p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs119] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the intestine. wrmScarlet expression in the intestine. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs119. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs133 [rab-3p::3XFLAG::rpl-22::SL2::scarlet::rab-3 3'UTR, *wbmIs127] (V:8645000). N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs127. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmEx69 [ges-1p::crtc-1(cDNA S76A, S179A)::tdTOMATO::unc-54 3'UTR]. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression in intestinal cells. Fluorescence may be difficult to see at lower magnifications. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.

uthIs205 [crtc-1p::crtc-1::tdTOMATO::unc-54 3'UTR + rol-6(su1006)]. Rollers. tdTOMATO-tagged CRTC-1 expression from native promoter. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.

uthIs226 [crtc-1p::crtc-1(S76A, S179A)::tdTOMATO::unc-54 3'UTR + rol-6(su1006)]. Rollers. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression from native promoter. Constitutively nuclear expression in neurons and intestine. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.

cwEx266 [cam-1p::cam-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Unc. GFP-tagged CAM-1 rescues gm122. Generated in N2 background.

Heterozygotes are WT and segregate WT, dead eggs and Uncs. At 25C the Unc Spds are Sterile; at 16C the Unc Spds are fertile but produce mostly dead eggs. Unc Spd animals will exhibit a fully penetrant maternal-effect embryonic lethal phenotype if shifted to 25C at the L4 stage. unc-13 spd-2 homozygotes may be propagated at 16C but may become sick causing immense frustration! See also WBPaper00004200.

ojIs34 [GFP::car-1 + unc-119(+)]. N'-tagged GFP::CAR-1 (Y18D10A.17) fusion. Labels P-granules and small cytoplasmic puncta in all cells. Bombardment with pNL1.6::GFP::unc-119 (pfj-1::pie-1 promoter driving GFP::Y18D10A.17 (N-terminal) with unc-119 rescuing fragment).

Temperature sensitive: maintenance at 15-20C. Reduced number of progeny at elevated temperatures. PH domain added to the 3xFLAG::GFP-tagged endogenous wago-4 locus in parental strain YY1325. This allele localizes WAGO-4 to the plasma membrane, but de-localization is not complete (some residual germ granule signal is detected).

Temperature sensitive: maintain at 15-20C. Reduced number of progeny and mortal germline phenotype at elevated temperatures. Mitochondria Targeting Sequence (mts) added to the 3xFLAG::GFP-tagged endogenous wago-4 locus localizes tagged WAGO-4 to mitochondria. This allele was introduced into 3xFlag::GFP tagged endogenous wago-4 locus in parental strain YY1325.

Temperature sensitive: maintain at 15-20C. Reduced number of progeny at elevated temperatures. wago-4(jog272) is an engineered Y611E point mutation predicted to disrupt small RNA binding and exhibits a diffuse cytoplasmic localization. This allele was introduced into 3xFlag::GFP tagged endogenous wago-4 locus in parental strain YY1325.

Heterozygotes are WT and segregate WT, DpyUncs, and Unc-4 animals which arrest at the L4 stage. Rarely, a recombination will occur and unc-4 and pir-1 will become unlinked. Propagate the strain by picking single WT animals and checking for correct segregation of progeny. 6/2007: Daniel Chavez notes that tm1496 may also delete part of sec-5, which could be responsible for the developmental arrest of tm1496.

Engineered Y145C substitution mutation in endogenously GFP-tagged ahcy-1 locus. ahcy-1(Y145C) mutation mimics the pathogenic human mutation AHCY Y143C. ahcy-1(Y145C) mutants have a prolonged lifespan and are larger than control animals. ahcy-1(Y145C) mutants are fertile and produce a brood of laid and hatched eggs similar to control animals. ahcy-1(Y145C) mutants show a slight increase in SAH and a decrease in SAM levels, leading to an increased SAH to SAM ratio. See WOP122 for control strain. Derived by out-crossing parental strain PHX784 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.

opIs206 [hif-1p::hif-1(genomic)::GFP::hif-1 3'UTR + unc-119(+)]. Weak GFP signal in early embryonic stages (2-cell, 4-cell, 8-cell, etc.). Reference: Sendoel A, et al. Nature. 2010 Jun 3;465(7298):577-83.

Non-Glp; remains fertile even with sygl-1(RNAi). Endogenous lst-1 locus tagged with a 3xFLAG N-terminally. Visible in cytoplasm of 5-6 cell diameters of distal germline in young adults. Reference: Kocsisova Z, et al. Development. 2019 Apr 23;146(8).

Non-Glp; remains fertile even with lst-1(RNAi). Endogenous sygl-1 locus tagged with a 3xFLAG N-terminally. Visible in cytoplasm of 10-12 cell diameters of distal germline in young adults. Reference: Kocsisova Z, et al. Development. 2019 Apr 23;146(8).

Sequence across the breakpoint i: ggccattagcagaagtacgaaaattaaaactctcagaggtggaa. unc-80(pd48) allele identified 3/2008 by Neline Kriek.

Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).

ZC317.3 Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Length: 2746. Estimated Deletion Size: 1200. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/

qaIs8400 [let-858p::Ov-GST-3 + rol-6(su1006)]. Called AK1 in the reference article. The Ov-GST-3 gene was amplified from genomic DNA of O. volvulus with 1µM of the sequence specific primer 5'Klon and 3'Klon (5'Klon: 5'-GGCGTACGATGTCAAGATTTCCTCAACAAG-3'; 3'Klon: 5'-GGTCTAGATTTATTTAGGAATGATTGAATCGGTCG-3'; representing bases 4 - 25 and the complementary sequence of bases 821 - 841 of the published Ov-GST-3 cDNA (AF203814); bold underlines indicate restriction sites for Pfl23II (SplI) and XbaI, respectively; dotted underline indicates the start codon for translation; italics indicates the conserved sequence for the polyadenylation signal for transgenic transcript processing; the 8 5'-nucleotides of primer 3'Klon and the fourteen 5'-nucleotides of primer 5'Klon do not correspond to the template and introduce the sequences to the amplicon), 200 µM of each deoxynucleotide (Gibco BRL) and 2.5 units of Taq polymerase (Gibco BRL). After an initial denaturation of 3 minutes at 93°C, 35 cycles of annealing at 55°C for 1 minute, synthesis at 72°C for 2 minutes and a 1 minute denaturation at 93°C were performed, followed by a final extension at 72°C for 5 minutes. The genomic Ov-GST-3 fragment obtained by PCR (see above) was ligated into the pGEM-T Easy vector (Promega) by TA-cloning, cleaved with the restriction enzymes Pfl23II (SplI) and XbaI (restriction sites introduced by the primer) and inserted between the unique Pfl23II (SplI) and XbaI sites of the vector pPD103.05 (kindly provided by A. Fire). The sequence of the genomic Ov-GST-3 fragment in the resulting plasmid pAK1 was confirmed by automated dye terminator, dideoxy sequencing (ABI Prism 377TM Sequencer, PE Applied Biosystems) using the PCR primers (see above). The pAK1 DNA was injected in combination with the marker plasmid pRF4 [rol-6(su1006)] into the gonads of N2 C. elegans at a concentration of approximately 100 ng/µl for each plasmid. Transgenic worms were identified by the selectable Roller marker phenotype and the stable transmitting line AK1ex (AK1 extrachromosomal) was established. Integration of the extrachromosomal arrays was achieved by irradiation of AK1ex worms with 3600 rad (1 rad = 0.01 Gy) of x-rays (x-ray chamber: RUM 9421-070-77002, Philips, Netherlands; dosimeter: PTW-SN4, PTW, Germany). The progeny of these worms was then screened for 100% transmittance of the Roller phenotype to obtain the C. elegans line AK1int (AK1 integrated) with the chromosomally integrated transgenes.

oyIs14 [sra-6p::GFP] V. wpEx369 [sra-6p::mito::TagRFP + odr-1p::RFP]. Maintain by picking animals with red fluorescence. PVQ neurons are marked with integrated GFP marker. Mitochondria in PVQ neurons are visualized with sra-6p::mito::TagRFP. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. doi: 10.7554/eLife.73557. PMID: 35285800.

ccIs4595 [ceh-24::GFP + rol-6(su1006)]. wpEx482 [ceh-17::NLS::TagRFP + pha-1(+)]. Maintain at 25C to retain array. GFP expression in vulval muscles, m8, and set of neurons in the head. The four SIA neurons are marked with both GFP and RFP. Can be used to isolate SIA by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otIs707 [bnc-1p(1.8kb)::GFP]. wpEx525 [nlp-38p::NLS::TagRFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. GFP expression in VA neurons can be used to isolate VA by FACS (exclude TagRFP). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.

yakEx137 [unc-14p::hif-1(P621A)::YFP + myo-2p::mCherry]. Pick animals with red pharynx to maintain. Non-degradable form of HIF-1 tagged with YFP expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx137 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

Becomes very sick if starved for extended periods of time or if frozen and thawed repeatedly. Primer sequences provided by the C. elegans Reverse Genetics Core Facility for ok410 are: Outer Left Sequence: AAGACTGTCAGCTGGTGGGT. Outer Right Sequence: TTAGCCTTACATTGCCGCTT. Inner Left Sequence: TCATGCGCAACATCTAAAGC. Inner Right Sequence: CGAATAAAGCAATTTCCCGA. Inner primer WT PCR product: 2825.

vrEx6 [nst-1p::nst-1::GFP::nst-1 3' UTR + unc-119(+)]. Stable array; high transmission rate and low percentage of mosaicism. Maintain by picking wild-type. Reference: Kudron et al. (2008) PLos Genet 4(8):e1000181.

vrIs121 [let-607(fosmid)::GFP + unc-119(+)]. let-607 locus in fosmid tagged at the carboxy-terminus with GFP. Derived by crossing the LET-607::GFP transgenic strain (YL529) to let-607(tm1423) mutants. vrIs121 transgene rescues the lethal mutant phenotype of let-607(tm1423) homozygous mutants. Reference: Weicksel SE, et al. Development. 2016 Oct 1;143(19):3540-3548.

HA::tagRFP inserted into endogenous znfx-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.

gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.

3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.

iaIs7 contains [nhr-57p::GFP + unc-119(+)]. ia61 was induced by Mos1 mutagenesis. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

iaIs21 [gcy-35p::GFP + unc-119(+)]. gcy-35::GFP is expressed in fifteen neurons, all of which also express ahr-1: AQR, PQR, URXR/L, ALNL/R, BDUL/R, SDQL/R, PLML/R, AVM, and two neurons in the tail tentatively identified as PLNL/R. gcy-35::GFP is only transiently expressed in PLML/R during the first larval stage.

hpIs727 [rig-3p::zif-1::sl2::RFP + ttx-3p::GFP]. twk-40(bln282) is a CRISPR generated allele of the endogenous twk-40 locus, inserting TagRFP and ZF1 allowing visualization of endogenous protein expression and localization as well as ZIF-1-mediated degradation. hpIs727 provides AVA neuron-specific expression of ZIF-1, leading to depletion of TWK-40 from AVA. Animals have loopy forward and reversal movements compared to twk-40(bln282) alone.

hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neurons are marked with red fluorescence. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Dorsal-coiler in L1, kinker in Adult after 1 hr illumination with blue light. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.