Search Strains

More Fields
Strain Species Genotype Add
VC963 C. elegans ppk-1(ok1411)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
F55A12.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and ok1411 homozygotes (arrest stage/phenotype undetermined). May also segregate viable ok1411 hemizygotes (WT males), but homozygous ok1411 hermaphrodites have not been recovered. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC971 C. elegans +/mT1 II; act-5(ok1397)/mT1 [dpy-10(e128)] III. Show Description
T25C8.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1397 homozygotes (arrest stage/phenotype undetermined; may be sterile adult). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC972 C. elegans arx-4(ok1093)/sC1 [dpy-1(s2170)] III. Show Description
Y6D11A.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1093 homozygotes (arrest stage/phenotype undetermined)). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC979 C. elegans F18A12(gk911) II. Show Description
F18A12. External left primer: TAGTCGGCGCTTCAGGTACT. External right primer: CTGGGCTCTTTACTTCCGTG. Internal left primer: TTTCATGGCTTCTATCCGCT. Internal right primer: TTATCTGGAATCGGCTTTGG. Internal WT amplicon: 1859 bp. Deletion size: 721 bp. Deletion left flank: AATAAGGAAACATACCCGAAAAACTCGAGG. Deletion right flank: AAAAAATGGGGTTTTAATATTGTTTTTATA. Insertion Sequence: AAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC996 C. elegans pas-5(ok1808) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F25H2.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1808 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGAGTGTTCACAAACCCAA. External right primer: TGGATTCTTTCCGAGGTGTC. Internal left primer: GCTCTGTCACCTCGAAGACC. Internal right primer: GCGGACGTATTGAATGTGTG. Internal WT amplicon: 2116 bp. Deletion size: 880 bp. Deletion left flank: GAGTACGATCGTGGAGTCAACACTTTTTCT. Deletion right flank: TTATTTGTCGTTCTTTTATACATTTTTGAA. Insertion Sequence: AAAAAATAGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH1195 C. elegans hdIs42. Show Description
hdIs42[ast-1::YFP + rol-6(su1006)]. GFP expression in neurons; contains full length AST-1 tagged with GFP at the C terminus. Rollers.
VH7000 C. elegans F21D5.6(hd7000[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Deletion of 964 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAAGCAGATTTTTTTCCAAAAAATGAGCT; Right flanking sequence: CGGATTCTGGTAATTTTGCAGGTTTAGTTT. sgRNA #1: GATTGATTTGGTTCCCTTCG; sgRNA #2: TTTTCTCGAATAACTCTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7001 C. elegans gna-1(hd7001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Deletion of 439 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTAACGTGTGAAATTTAGAAGCGCTGAG; Right flanking sequence: AGGAATGTGTGGAGCTAACACAGACGCATC. sgRNA #1: TCATAAAATTGCAATCGTCC; sgRNA #2: AAATTGTCAGGAAGATTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7018 C. elegans col-144(hd7006[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAACATATACATAGGTTACTACGATCCCA; Right flanking sequence: AGTAAGGTCATTCTGCGTCTCTCTTCATTT. sgRNA #1: AGAACCGCAATTACGATTAT; sgRNA #2: CAAAAGAATCTGCCGATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7022 C. elegans ctf-18(hd7009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7030 C. elegans F43C1.7(hd7013[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGATAAAAATTAGGTATTTCAGGTTTTCCA; Right flanking sequence: GGGTTACTGTAGACGAAATGAATCCGAAAA. sgRNA #1: AACAACTTGAAGGAACTCAA; sgRNA #2: CATAAATATTAAAGCCGGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7033 C. elegans F36G9.3(hd7033[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2120 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTTTTGGGTTTCAAAATGAAGTATTTACCA; Right flanking sequence: TTTCAATATTCTCAATTCTGGCACTCATAT. sgRNA #1: TAAAACTAGACGGACGAGTC; sgRNA #2: GGATTGTGAGCACCCAGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7034 C. elegans F17C8.6(hd7034[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGAAGATTTTGCATTGATTTTTAGATAGT; Right flanking sequence: TGCAACCATTTTAAGATTGTTTATTTGAAA. sgRNA #1: AAAGTACACGTATGCCACCT; sgRNA #2: CCATACCATCAGGAGGCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7035 C. elegans col-176(hd7035[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1915 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTGTACTTCCTTCTTCTCATGACCTCCG; Right flanking sequence: CCGGGCGGCTATCCGCCAGGCCCAAACGGC. sgRNA #1: AAAACATAGGTGGTCGGGCA; sgRNA #2: ACACAACGGCCGTCTACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7036 C. elegans ZC373.5(hd7036[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1827 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAGTTTCGAAGTAATCTCAATAAAATCCG; Right flanking sequence: TGGCAAGCACTCTTGTTGTGTTGGTCTCTT. sgRNA #1: GTTCGAAGACCATTCATGCT; sgRNA #2: TTCTCTAATCTCTCCGTCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7037 C. elegans arrd-15(hd7037[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 7272 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTCAAAGCATATTCCACGTACTTTAGT; Right flanking sequence: TGGCAAACCTTCAAAACTGCTCTTTTCGGT. sgRNA #1: TCTCAAATACTTCGCGTGCT; sgRNA #2: TGCTAATGAGGTCATCGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7038 C. elegans T07E3.3(hd7038[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGCCAAACTTCAAAATGGCTCCATTGCCA; Right flanking sequence: CATCAGTTTAGTCTTTTTTTTTCCCAAATC. sgRNA #1: TCGAAATAACATTTCACACG; sgRNA #2: CGAGTAAAGTGCAATAAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7039 C. elegans trcs-1(hd7039[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2438 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTATAAATCAAATTAACGGAGATCGTA; Right flanking sequence: GGGAGATCAAAACGTGTTTAGAATCTTTGC. sgRNA #1: GCGAGACCCAATGCGAAATT; sgRNA #2: TTCACATTAGGCTATTTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7040 C. elegans ZK512.2(hd7040[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ III. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 2129 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGGCCTTTCTCTTCAAAGCCTTCTTCTCCT; Right flanking sequence: CTATGCTTTTTCTTGTATATTTCAAACATT. sgRNA #1: TGGAACTGGTAGAAAAGCAG; sgRNA #2: CATAAAATGGGTCAGAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7041 C. elegans ech-3(hd7017[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1031 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCACTATGGGTGCGATTGTGGCGAATCCCA; Right flanking sequence: TGGCTGATAGAGAATCCACGTATTACTCGT. sgRNA #1: GGCACACTCGGGTTTCAAAG; sgRNA #2: TCATCCGGAAATATGCATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7042 C. elegans mpz-6(hd7015[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1556 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGACATAGTGACACGCATTGGAAGCCG; Right flanking sequence: GGGAAACTCCGCCCACAAACGCTGAAAGTT. sgRNA #1: AACTATTTCAATGGTTCAGT; sgRNA #2: CCACACTCTCCGAGCAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7044 C. elegans otpl-5(hd7011[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2727 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGAAATGAACAAAAAGTTACGGAGGAGGC; Right flanking sequence: ATTTCCCATCAAACTGCCTGATAGCTACTC. sgRNA #1: GAACTCCCACCCTCCCTTAA; sgRNA #2: CCAAAGTTCAATTCAGTAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7045 C. elegans cal-3(hd7045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 6270 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACGTACGTTATACGTAATAGAAGCACGTG; Right flanking sequence: CTCGGGGCGAATTCAAATAAAGATGCGGCT. sgRNA #1: CGTAATAGAAGCACGTGAGA; sgRNA #2: CGCAATTTGATCACACTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7046 C. elegans ubc-1(hd7046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGAGTTAGGTTATCAATATGACGACGCCC; Right flanking sequence: TGGAAATTGAAGAAATTGCTGCTCCAGGAG. sgRNA #1: CTCATCAAACGTCTACGGCT; sgRNA #2: CGCAGTGCTCAAGGATGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7047 C. elegans gst-15(hd7047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2693 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTCTTTTTGAGAATTCGATTGAGAAGA; Right flanking sequence: GACATTTCGGCGGCAGTCAACATTAATGAA. sgRNA #1: ATAAAGTAGACATCTCGAGC; sgRNA #2: CTTGTCAATACTCTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7049 C. elegans efl-2(hd7049[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 4502 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTGCTCGAGGGGCTCGGTTATGTGGAGA; Right flanking sequence: GGGCTTACCATTTTGTGGGCGTGGTTAGCT. sgRNA #1: GCTCGGTTATGTGGAGAAGG; sgRNA #2: CACAAAATGGTAAGCCCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7053 C. elegans ZK697.8(hd7053[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 946 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCATTGGTAAATTTAGAATTTCAAGGTATC; Right flanking sequence: TACTGGCCTAAAAGATAAAAAGTCTTGTTT. sgRNA #1: TAGAATTTCAAGGTATCGGC; sgRNA #2: TGCATATGATTTCCTAGTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7055 C. elegans rfth-1(hd7055[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Show Description
Heterozygous strain. Homozygous early larval arrest without immediately obvious morphological defects. Deletion of 4370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCGTCAGCTGCTCCTTCGTGTCGCCCCT; Right flanking sequence: CCTAAAACATCGTTATTGATCCTCCGCAAA. sgRNA #1: ATAGTATGGAGAGAGCCCTC; sgRNA #2: ATTAGTGAATGTGAGGTGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7056 C. elegans cest-13(hd7056[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 4312 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAACATATGATGTGACAGTGCAAACACCA; Right flanking sequence: GCCTCAGTAGAGGTCCTCCGCCCCATCTTT. sgRNA #1: CGTATCGTTGCAGATCCATT; sgRNA #2: CATGTCACAACACGTAGGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7058 C. elegans ctf-18(hd7008[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7059 C. elegans prk-1(hd7059[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 11634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTCCTGGGGCACCGCCTACTTTTGCCGCCG; Right flanking sequence: CGAAAGAAATCGAGTATTTTCAAATCATTT. sgRNA #1: ATTGCTGACGGTGGGCGCGG; sgRNA #2: CATCCGAACTAAATTATAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7061 C. elegans F10E9.4(hd7061[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ III. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 1418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAACGAGGATGGAACTACAGAAGTCCAGGA; Right flanking sequence: AGGATATTGATCTCAATAGCTCCAATTAAA. sgRNA #1: AACAGAAAGTGAAGCACCAA; sgRNA #2: ATTATGACTATGTACTTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7066 C. elegans pph-1(hd7066[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTATTTTTTCGTTTTCAAAAAATAGTACCG; Right flanking sequence: CTGTCCCGGGTCCTTTCTTTTCTCCCGATT. sgRNA #1: CCTAGGTATTTTTGTTTTCT; sgRNA #2: CCCTTCAAACCATCACTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7067 C. elegans T25B9.2(hd7067[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1673 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTCGGCAGGAGTTTGTTTTTTTTTCCT; Right flanking sequence: TGGTAAAAAATGTTCTACAATTTTTTACAT. sgRNA #1: ACATTATTCACAGTACTCAC; sgRNA #2: GTTAGAAATCATTACATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7070 C. elegans hda-5(hd7070[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7071 C. elegans hda-5(hd7071[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7072 C. elegans C25A6.1(hd7072[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 988 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGAAACATTTTTCAAGTCATGATTCCA; Right flanking sequence: TTTCCGGTAGAAATTTTCACCAACTTCCCG. sgRNA #1: AATTGCCCGGGAATTTCACC; sgRNA #2: GGTGTCGTTGTTTGTCAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7074 C. elegans Y38H6C.8(hd7074[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1106 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAAGAGATGCTATGACAATCAAGAATAA; Right flanking sequence: ATTTAAGTTTTTTTTATTACAACAAAGTAC. sgRNA #1: ATTAATTCAAAGAAGGGTGG; sgRNA #2: CATCAAATCTCTAGGCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7076 C. elegans M176.9(hd7076[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2297 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTGCCAGAAGCCTATTTTTCGCTTTTCCC; Right flanking sequence: CTGATTACGACCTTTTAATAGCATAACTTG. sgRNA #1: GAAGATGGGACATTACAGAT; sgRNA #2: CTTTGTAGAAGGGATACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7077 C. elegans F45G2.9(hd7077[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATCGGCACAGCTCGATAAGCCTCAAGTGA; Right flanking sequence: GAGCTTTAACCGCAAATTCGTCTGTTGATT. sgRNA #1: TCCGTAGCGTTATCTCCAGT; sgRNA #2: GTGAGCACAATTACCGAGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7078 C. elegans W01F3.2(hd7078[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGAGAAGAAGAACTGCAACTACTACAGGA; Right flanking sequence: AGGGAAAGAGAATTTGGTGTCAGTAGGTGA. sgRNA #1: ATTCCAGTGATTTCTGTGGG; sgRNA #2: ACACAACGCATCAGTATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7080 C. elegans tcab-1(hd7080[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 4236 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATAGGAGACGTCCGGATTTGTCGATGGA; Right flanking sequence: CGGTTTTCTGGGATTTCTTCGGGAATTTCT. sgRNA #1: GAATCGTGTACGGTGTGTGG; sgRNA #2: TCTCTTTTCGATTTAATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7081 C. elegans F26H9.5(hd7081[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTTATCCATTTGAGAACGAGATTTGTT; Right flanking sequence: GAAAATTTGTCTTGAATTCTCACAATATCC. sgRNA #1: GTGTAGATACCTCCAGTTGG; sgRNA #2: AGAAATGTCGCATAGATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7089 C. elegans C50F2.5.1(hd7089[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAGCACGAATCTACAAACATTTTATTTT; Right flanking sequence: TGGCCCATAATTATGGGGCTCGAGTTGCTC. sgRNA #1: GCAATAGTTCTCAGTTCTCA; sgRNA #2: ACAGAGATTTTACTTCAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7093 C. elegans acs-21(hd7093[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1797 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGTAAATTAGAAATATTCTAGTTTTAGG; Right flanking sequence: TGGAAGATGAGCAGAAGTTTGAAGAAGATT. sgRNA #1: TATTGTTCATCGATGATGGC; sgRNA #2: AGTTGTGCCGAAGAATATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7095 C. elegans C30A5.4(hd7095[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTTCTTGCGCTTAGCACCGCCCATTTTAAA; Right flanking sequence: AGACCCATGCAGAGAAACTGCTTGTGCCTT. sgRNA #1: ATCAATCAGCGAACTTTTGG; sgRNA #2: CTCCACGATCTCAGCTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7097 C. elegans twk-47(hd7097[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2010 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACACGGAAACCATACGTTGAAGCCTTTCCA; Right flanking sequence: TGGCAAAGCATCATCACTTATTCCAGAAAT. sgRNA #1: GAAGATGTTGCTTCACTTGG; sgRNA #2: CTTCTTTTAGTCCATCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7108 C. elegans E01A2.1(hd7099[loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7099 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7099 and CGC92. hd7099 is a 1508 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7115 C. elegans F46F11.10(hd7096 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7096 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7096 and CGC92. hd7096 is a 667 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7120 C. elegans ubh-1(hd7120[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAATAGCTTACTATTAGCTAGAAAATCCG; Right flanking sequence: GAGCGGCCATATTTAGACAGTTTTTTTGGTTCT. sgRNA #1: GGTTGGAATTGAGGAACGTT; sgRNA #2: TTCGAGCGGAGTCCATGGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.