| PHX4442 |
C. elegans |
dmsr-6 (syb4442 [dmsr-6::SL2::GFP::H2B]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous dmsr-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX4447 |
C. elegans |
aex-2(syb4447 [aex-2::SL2::GFP::H2B)] X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
|
|
| PHX4453 |
C. elegans |
trhr-1(syb4453[trhr-1::SL2::GFP::H2B]) I. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.
|
|
| PHX4454 |
C. elegans |
hmr-1(syb4454 [hmr-1::SL2::GFP::H2B]) I. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous hmr-1 locus.
|
|
| PHX4476 |
C. elegans |
cdh-4(syb4476[cdh-4::SL2::GFP::H2B]) III. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-4 locus.
|
|
| PHX4478 |
C. elegans |
egl-3(syb4478[egl-3::SL2::GFP::H2B]) V. Show Description
SL2::GFP::H2B tag inserted at the C-terminus of the endogenous elg-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX4491 |
C. elegans |
unc-17(syb4491[unc-17::T2A::GFP::H2B]) IV. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4502 |
C. elegans |
ser-7(syb4502[ser-7::SL2::GFP::H2B]) X. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4512 |
C. elegans |
nlp-69(syb4512[nlp-69::SL2::gfp::H2B]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| PHX4513 |
C. elegans |
flp-5(syb4513[flp-5::SL2::GFP::H2B]) X. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.
|
|
| PHX4514 |
C. elegans |
dmsr-2(syb4514 [dmsr-2::SL2::gfp::H2B]) I. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
|
|
| PHX4517 |
C. elegans |
nmur-2(syb4517 [nmur-2::SL2::GFP::H2B)] II. Show Description
GFP tag inserted at the C-terminus of the endogenous nmur-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX4523 |
C. elegans |
frpr-19(syb4523[frpr19::SL2::GFP::H2B]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous frpr-19 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX4537 |
C. elegans |
unc-39(syb4537[unc-39::gfp]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| PHX4563 |
C. elegans |
fmi-1(syb4563)[fmi-1::SL2::GFP::H2B]) V. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous fmi-1 locus.
|
|
| PHX4595 |
C. elegans |
tkr-1 (syb4595 [tkr-1::SL2::GFP::H2B]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous tkr-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX4677 |
C. elegans |
kin-36(syb4677[GFP::HIS::SL2::kin-36]) IV. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4678 |
C. elegans |
ceh-30(syb4678[ceh-30::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-30 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX4689 |
C. elegans |
nep-2(syb4689[gfp::h2b::sl2::nep-2]) II. Show Description
SL2::GFP::H2B tags inserted at N-terminus of nep-2 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| PHX4693 |
C. elegans |
che-7(syb4693[che-7::SL2::gfp::H2B]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| PHX4729 |
C. elegans |
rig-6(syb4729[rig-6::SL2::GFP::H2B]) II. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4763 |
C. elegans |
rig-3(syb4763[rig-3::SL2::GFP::H2B]) X. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4799 |
C. elegans |
ceh-38(syb4799[ceh-38::GFP]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-38 locus by CRISPR. Allele generated by SUNY Biotech.
|
|
| PHX4861 |
C. elegans |
gpla-1(syb4861[flr-2::SL2::GFP::H2B]) V. Show Description
CRISPR/Cas9-engineered reporter allele. gpla-1 formerly known as flr-2. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4895 |
C. elegans |
htrl-1(syb4895[htrl-1::SL2::GFP::H2B]) V. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4901 |
C. elegans |
ceh-41(syb4901[ceh-41::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-41 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX4954 |
C. elegans |
sma-1(syb4954[sma-1::GFP]) V. Show Description
GFP tag inserted into endogenous sma-1 locus using CRISPR/Cas9. Tagged inserted at C-terminus immediately preceding the stop codon. Reference: Barker TJ, et al. MicroPubl Biol. 2023 Jun 14:2023:10.17912/micropub.biology.000863. doi: 10.17912/micropub.biology.000863. PMID: 37396793.
|
|
| PHX5073 |
C elegans |
ceh-43(syb5073[ceh-43::SL2::GFP::H2B]) III. Show Description
GFP tag inserted into endogenous ceh-43 locus using CRISPR/Cas9 engineering. GFP expression in IL1, CEP, AIN, AIZ, ASJ, ADE, BDU, SDQ, PDE, PVQ, and possibly glia. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
|
|
| PHX509 |
C. elegans |
nhr-67(syb509[nhr-67::gfp]) IV. Show Description
GFP reporter inserted into C-terminus of endogenous nhr-67 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
|
|
| PHX5218 |
C elegans |
cest-4(syb5218[cest-4::SL2::GFP::H2B]) IV. Show Description
GFP tag inserted into endogenous cest-4 locus by CRISPR/Cas9.
|
|
| PHX5229 |
C. elegans |
degl-2(syb5229[degl-2::SL2::gfp::H2B]) IV. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
|
|
| PHX5321 |
C. elegans |
bli-4(syb5321[bli-4::SfGFP(int)]) I. Show Description
bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
|
|
| PHX5349 |
C. elegans |
tpan-1(syb5349[tpan-1::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous tpan-1 locus by CRISPR. Allele generated by SUNY Biotech.
|
|
| PHX5406 |
C. elegans |
nep-2(syb5406[GFPnovo2::nep-2]) II. Show Description
GFPnovo2 inserted at N-terminus of endogenous nep-2 locus. Expression in muscle, including uterine and vulval muscles, as well as several neurons and other tissues. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
|
|
| PHX5413 |
C. elegans |
flp-7(syb5413[flp-7::SL2::GFP::H2B]) X. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5424 |
C. elegans |
ins-7(syb5424[ins-7::SL2::GFP::his-44]) IV. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous ins-7 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| PHX5437 |
C elegans |
cone-1(syb5437[gfp::cone-1]) III. Show Description
GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. [NOTE: Previously described as ceh-44(syb5437[gfp::ceh-44]) III. ceh-44 and cone-1 are located in the same locus and may share many exons, but are two separate genes with different functions and expression patterns. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5452 |
C. elegans |
ins-1(syb5452[ins-1::SL2::gfp::H2B]) IV. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| PHX5462 |
C. elegans |
ins-18(syb5462[ins-18::SL2::GFP::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous ins-18 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| PHX5500 |
C elegans |
ceh-44(syb5500[ceh-44::oxGFP]) III. Show Description
oxGFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5536 |
C. elegans |
ins-9(syb5536[ins-9::SL2::gfp::H2B]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous ins-9 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX5561 |
C. elegans |
ins-33(syb5561[ins-33::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous ins-33 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| PHX5697 |
C. elegans |
nlp-2(syb5697 [nlp-2::SL2::GFP::H2B]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
|
|
| PHX5704 |
C. elegans |
gbb-1(syb5704[gbb-1::sl2::gfp::h2b]) X. Show Description
SL2::GFP::H2B tags inserted at C-terminus of gbb-1 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| PHX5755 |
C. elegans |
pha-4(ot946 ot1078 syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG]) V. Show Description
Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID* after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5759 |
C. elegans |
gbb-2(syb5759[gbb-2::sl2::gfp::h2b]) IV. Show Description
SL2::GFP::H2B tags inserted at C-terminus of gbb-2 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| PHX5791 |
C. elegans |
pop-1(syb5791[GFP::AID*::GGGGSGSGS linker::pop-1]) I. Show Description
GFP and AID* tags inserted at the N-terminus of the endogenous pop-1 locus by CRISPR. Insertion includes a GGGGSGSGS linker sequence between the tags and POP-1. Generated in N2 background.
|
|
| PHX5792 |
C. elegans |
pll-1(syb5792[pll-1::sl2::gfp::h2b]) III. Show Description
SL2::GFP::H2B tags inserted at C-terminus of pll-1 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| PHX5843 |
C elegans |
ceh-44(syb5843[ceh-44::gfp(exon8)]) III. Show Description
GFP tag inserted at the N-terminus of the endogenous ceh-44 locus by CRISPR. Pan-neuronal nuclear expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5923 |
C elegans |
bas-1(syb5923[bas-1::SL2::GFP::H2B]) III. Show Description
GFP tag inserted into endogenous bas-1 locus by CRISPR/Cas9.
|
|
