Search Strains

sybIs62 [NISH-1::EGFP::3xFLAG + unc-119(+) + myo-2p::mCherry]. Transgene rescues nish-1(syb767) rilemenidine-induced longevity, rilemenidine-induced heat resistance, and rilemenidine-induced healthspan (body bends). Reference: Bennett DF, et al. Aging Cell. 2023 Feb;22(2):e13774. doi: 10.1111/acel.13774. PMID: 36670049.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Slight Egl.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. mgEx499 [unc-54p::age-1 + mec-7p::GFP]. Left-hand rollers. Long and thin. Maintain at 16C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. jIs1 [myo-3::GFP + rol-6(su1006)]. jIs1 likely maps to LGI, LGII, or LGX. Rollers; not all animals roll well.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Arrest as dauers at 25C. Maintain at 15C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function. Progressive paralysis.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. csEx52 [hsp::lin-45AA + sur-5::GFP]. Array is unstable; pick GFP+ to maintain. Severe Unc.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. csEx52 [hsp::lin-45AA + sur-5::GFP]. Array is unstable; pick GFP+ to maintain.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. csEx52 [hsp::lin-45AA + sur-5::GFP]. Unc slow. Array is unstable, pick GFP+ to maintain.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. ccIs55 [unc-54::lacZ + sup-7(st5)] V. GFP expression in nuclei and mitochondria of muscle cells.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function suppressed; not markedly small. Egl-d. Lethal @ 25C; short L1's do not survive. No GFP expression.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted at 3' end of endogenous src-1 locus using CRISPR/Cas9 engineering. gRNA sequence: AGCACAATTTTTTAGGCACT

utsIs4 [nhr-49p::nhr-49::GFP + myo-2p::mCherry]. Strain was back-crossed to N2 following transgene integration (parental strain described in Ratnappan R, et al. PLoS Genet. 2014 Dec 4;10(12):e1004829. doi: 10.1371/journal.pgen.1004829. ). Reference: Watterson A, et al. Nature. 2022 May;605(7911):736-740. doi: 10.1038/s41586-022-04729-7. PMID: 35585236.

sfGFP tag inserted at the N-terminus of the endogenous NHR-49 gene (long isoform c). Derived by out-crossing parental strain PHX9542. Reference: Tatge L & Douglas PM. MicroPubl Biol. 2025 Aug 1. doi: 10.17912/micropub.biology.001655.

alg-1(ap423 [3xflag::gfp::alg-1]) X. ALG-1 tagged at N-terminal with 3xFLAG:GFP at endogenous locus, verified by western blot and fluorescence microscopy. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.

alg-2(ap431[3xflag::mKate2::alg-2]) II. alg-1(ap423[3xflag::gfp::alg-1]) X. Derived from crossing PQ530 and PQ582 strains, verified by fluorescence microscopy. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.

mutEx70 [pmk-1::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. [NOTE: This strain has been incorrectly referred to as RP112 muEx70.] Reference: Mertenskötter A, et al. Cell Stress Chaperones. 2013 May;18(3):293-306.

syIs875 [ins-6p::dYFP + ins-6::mCherry + unc-122p::GFP]. cmk-1(sy2277) is a C-terminal knock-in of mKate2::AID*::FLAG to be used for conditional degradation of CMK-1 protein. sy2277 is a CRISPR-engineered allele generated using the self-excising cassette (SEC) method (Dickinson et al. 2015, Genetics) with the gRNA sequence 5'-AGCGTGAAAAGCGGGTGTAGNGG-3' (note: NGG not included in the gRNA). syIs875 is an integrated transgene that includes a transcriptional and translational reporter for ins-6 and is marked by GFP in the coelomocytes. dYFP signal can be seen in ASI during reproductive growth and in ASJ (strong) and ASI (weaker) during dauer exit. Reference: Zhang MG, et al. (2024). Available at: https://www.biorxiv.org/content/10.1101/2024.03.20.586022v1 [Accessed 13 August 2024].

syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Non-Dpy. Upon heat shock, two intense spots of nuclear fluorescence due to lacO in the chromosome, and a diffuse nuclear fluorescence due to nuclear-localized GFP-lacI. Array derived from Fire Lab vector pPD49-78 and dpy-20 rescuing construct pMH86. Do not distribute this strain; other labs should request it from the CGC.

syIs33 [gpa-1::GFP]. Labels the spicule neurons in males.

syEx234 [let-23::GFP + pBS + (pMH86) dpy-20(+)]. Non-Dpys bear the transgene and express GFP in multiple cells including the pn.ps and uv1. Maintain by picking Non-Dpy. Do not distribute this strain; other labs should request it from the CGC.

syIs46 [dpy-30::S65T::lacI + hsp-16p::GFP::lacI + dpy-20(+)] II. Animals are Ncl, Him and Non-Dpy. Heat shock results in diffuse nuclear GFP expression from Fire Lab vector pPD49.78::LacI in most cells. Also see some consitutive GFP expression in embryos from dpy-30 promoter. Do not distribute this strain; other labs should request it from the CGC.

syIs49 [zmp-1::GFP + (pMH86) dpy-20(+)] IV. Non-Dpy. Expresses GFP in anchor cell at L3 stage. VulA at late L4, and VulE soon thereafter. Do not distribute this strain; other labs should request it from the CGC.

syIs50 [cdh-3::GFP + dpy-20(+)]. Line is a slightly Dpy, but appears healthy. Reference: Pettitt J, et al. Development. 1996 Dec;122(12):4149-57. Do not distribute this strain; other labs should request it from the CGC.

syIs54 [ceh-2::GFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC.

syIs60 [F47B8.6::GFP + unc-119(+)] II. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.

syIs61[F47B8.6::GFP + unc-119(+)] V. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.

syIs63 [cog-1::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC.

syIs65 [pT100.18(B0034.1::pes-10::GFP) + unc-119(+)] IV. unc-119(ed4) may have been crossed out. Do not distribute this strain; other labs should request it from the CGC.

syIs66 [B0034.1::pes-10::GFP + unc-119(+)] II. Expressed in vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.

syIs75 [lin-18::GFP + unc-119(+)].

syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Do not distribute this strain; other labs should request it from the CGC.

syEx429 [ipp-5p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Construct pIP5 contains 2.0 kb promoter fragment upstream of ipp-1 driving GFP expression in distal spermatheca (in adults); pharynx and vulva (all stages). [NOTE: the syEx429 array in this strain was previously incorrectly annotated as carrying ipp-1p::GFP. The array contains an ipp-5p::GFP transgene.]

syEx468 [myo-3p::egl-19::GFP]. C-terminal GFP fusion. Pick GFP+ to maintain.

syEx470 [myo-3::unc-38::GFP]. Pick GFP+ to maintain. unc-38::GFP transgene produced by in vivo recombination between pR29 (myo-3p::unc-38) and pR26 (unc-38::GFP).

syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. GFP expression in developing vulval cells, VCs and uterine pi lineage cells. Received new stock 9/2003. Do not distribute this strain; other labs should request it from the CGC. Received new strain from Bhagwati Gupta on April 7, 2008.

syEx475 [myo-3p::unc-68(see following comments) + myo-2p::GFP + pUC-19]. Pick GFP+ animals to maintain. myo-3p::unc-68 transgene was produced by injecting pEM23 (myo-3 promoter + unc-68 exons 1-8) + 18 kb unc-86 PCR fragment (start codon through nucleotide 18090) + pLM511 (unc-68 position 11989 to the end); fragments were recombined in vivo.

Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile en671 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

kfIs1[plc-1::GFP]. GFP is expressed in the adult hermaphrodite spermatheca.

kfEx2 [plc-1(+) + sur-5::GFP]. Pick GFP+ animals to maintain. plc-1(rx1) homozygotes are semi-Sterile. Animals with the array have normal brood size. Do not distribute this strain; other labs should request it from the CGC.

syIs103[unc-119(+) + pPGF11.13(lin-11::GFP)]. GFP fluoresence is observed in the vulva, uterine pi cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC.

syIs53 [pPGF11.07(lin-11::GFP) + unc-119(+)] V. GFP expression in developing vulval cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC.

syIs105 [egl-30::GFP + dpy-20(+)]. Translational fusion contains all of the presumptive 5'-transcriptional regulatory sequences, introns, and presumptive 3 regulatory sequences for egl-30, in addition to the coding sequences for GFP just 5' of the egl-30 initiating methionine. syIs105 was found to partially rescue egl-30(md186) with respect to egg laying, movement, pharyngeal pumping, and response to neurotransmitters in egg-laying assays.

syIs107 [lin-3(delta pes-10)::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC.

syIs108 [lin-3(delta pes-10)::GFP + unc-119(+)].

syIs129 [hemicentin(delta SP)::GFP + unc-119(+)]. Integrant of hemicentin::GFP reporter where the signal has been deleted. Do not distribute this strain; other labs should request it from the CGC.

syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Not sure if unc-119(ed4) from the parent strain is still present. Do not distribute this strain; other labs should request it from the CGC.

syEx684 [unc-119(+) + fos-1a/b::GFP-TL]. Ex line of functional fos-1 gene tagged with GFP at the C-terminus. Pick WT to maintain. Throws males. Do not distribute this strain; other labs should request it from the CGC.

syIs146 [mom-2::GFP + unc-119(+)]. May contain unc-119(ed4).

Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm1340 homozygotes (sterile).