Search Strains

siss-1(csn20) animals are defective in stress-induced sleep (SIS) with no other obvious defects in development or behavior. csn20 is a Cys-to-Tyr substitution in the third Cys residue of the EGF motif of SISS-1 (a.k.a. IGEG-1). csn20 phenocopies the deletion allele ve532, indicating that the EGF domain of SISS-1 is functional. Reference: Hill AJ, et al. Nat Commun 15, 10886. doi: 10.1038/s41467-024-55252-4. PMID: 39738055.

diac-.

Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-9 is temperature senstive. Amphid axon guidance defects (termination, guidance). This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Amphid axon guidence defect. HSN axon guidence defect. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Chemosensory, mechanosensory, and osmosensory defects. Null allele. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs140 [str-2::GFP + lin-15(+)] I. 2-AWC OFF.

kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV.

ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. cyp-33E1(syb8844) is Cys439 mutated to Ala. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing syb8844 with LIU1 and out-crossing with N2.

ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. cyp-33E1(syb8800) is Cys295 mutated to Ala. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing syb8800 with LIU1 and out-crossing with N2.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juSi94 [rps-18p::GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5375 [col-19p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. Expression of split GFP reporter labels ribosomes in the epidermis. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5377 [myo-3p::GFP1-10 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. Muscle-specific expression of split GFP reporter allows visualization of ribosomes in muscle. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

Homozygous viable Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juSi123 [rpl-29::GFP] II. Strong GFP signal allowing visualization of ribosomes. GFP inserted at C-terminus of RPL-29. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs409 [rgef-1p::GFP1-10 + ttx-3p::RFP] IV. Pan-neuronal-specific expression of split GFP reporter allows visualization of ribosomes in neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juIs438 [mec-4p::GFP1-10 + mec-4p::tagRFP] II. juSi94 [rps-18p::GFP11::rps-18]. Expression of split GFP reporter labels ribosomes in touch neurons. Generated in N2 background. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

Superficially wild-type. No uptake of calcium in mitochondria after wounding. Reference: Xu S, Chisholm AD. Dev Cell. 2014 Oct 13; 31:48-60.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. DD motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in those neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juSi271 [col-19p::mito::Dendra2]. Superficially wild-type with altered mitochondrial morphology. Fluorescent reporter labels hypodermal mitochondria. Reference: Xu S, et al. J Genet Genomics. 2016 Feb 20;43(2):103-6.

bx80 was previously called mab-26(bx80): Extensive ray fusion involving all 9 rays; Larva have Vab phenotype with decreasing expressivity in adult; Hermaphrodites have swollen tail and anus. Vab, embryonic ventral enclosure defects, male ray fusions. Slow growth.

muIs32 [mec-7p::GFP + lin-15(+)]. mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in the pharynx. mIs11 homozygotes are WT with bright GFP in the pharynx. qns-1(ju1563) animals are sterile. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420

Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.

unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.

Heterozygotes are WT and segregate WT, Unc Lins and very slow growing constipated worms. n2559 is a null allele of itr-1.

vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal), and was previously called efn-1. Vab, embryonic ventral enclosure defects, male ray fusions.

juSi364 [unc-17Bp::3xFLAG::eif-3.g::SL2::GFP] IV. GFP expression in cholinergic motor neurons. Convulsing worms. Strain is suitable for neuron-type eCLIP. Reference: Blazie S, et al. Elife. 2021 Jul 29;10:e68336. PMID: 34323215.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP micu-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.

GFP reporter inserted into C-terminus of endogenous micu-1 locus. Diffuse GFP signals throughout the body. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.

jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for the mechanosensory neurons. ju1903 deletion removes N-terminus of EFA-6 and disrupts all known isoforms. No visible GFP::EFA-6 due to ju1903 deletion. Reference: Sandhu A., et al. Cell Reports 2024 Oct 22;43(10):114776. doi: 10.1016/j.celrep.2024.114776. PMID: 39305484.

mNeonGreen tag inserted at C-terminus of endogenous bli-6 locus using Dickinson method. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.

Endogenous efa-6 locus tagged with GFP using CRISPR/Cas9. GFP is visible under compound fluorescence microscope. Reference: Sandhu A., et al. Cell Reports 2024 Oct 22;43(10):114776. doi: 10.1016/j.celrep.2024.114776. PMID: 39305484.

juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. GFP expression in presynaptic terminals of GABAergic DD and VD motor neurons and RME neurons. Maintain under normal conditions. Reference: Hallan SJ and Jin Y. Nature. 1998 Sep 3;395(6697):78-82.

vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal). pka efn-1.

Heterozygotes segregate wild-type heterozygotes, Emb, and Unc Dpy. Maintain by picking wild-type.

juIs14 [acr-2p::GFP + lin-15(+)] IV. GFP expression in cholinergic motor neurons. Reference: Hallam SJ, et al. Development. 2000 Oct;127(19):4239-52.

juEx1434 [rgef-1p::ebax-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. juEx1434 rescues Egl of pqn-55(ju699) mutants. Reference: Wang Z., et al. Neuron. 2013 Sep 4;79(5):903-16.

juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. Transcriptional reporter with ttr-39 promoter driving mCherry expression in DD and VD neurons. Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.

Mild Unc and Egl. Reference: Wang Z., et al. Neuron. 2013 Sep 4;79(5):903-16.

Maintain under normal conditions. Reference: Stawicki TM, et al. Curr Biol. 2011 May 24;21(10):883-8.

Egl. Lon. Sluggish Unc. Eat.

Weak Egl. Weak Eat.

Egl. Weak sluggish Unc.

Impenetrant Vab - mostly tail; not mapped. Strain throws early larval lethals (ad1025 homozygotes) and Bli Uncs.