| MT2426 |
C. elegans |
goa-1(n1134) I. Show Description
Hyperactive. n1134 is a G to A substitution in the initiation codon of goa-1.
|
|
| NK3240 |
C. elegans |
emb-9(qy288[emb-9 (G1173D)::mNG]) III. Show Description
Endogenously tagged temperature sensitive glycine substitution mutant allele (b117) of emb-9. Tagged with mNG at the C-terminus. Temperature sensitive. Semi-dominant. Egg lethal. Not maternal. Will grow at 20C. See also CGC DH117. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3241 |
C. elegans |
let-2(qy289[let-2 (G1287D)::mNG]) X. Show Description
Endogenously tagged temperature sensitive glycine substitution mutant allele (b246) of let-2. Tagged with mNG at the C-terminus. Temperature sensitive embryonic lethal. Grows at 15C, 20C. Lethal at 25C (embryonic). See also CGC DH246. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| OH19215 |
C. elegans |
cone-1(ot1514[cone-1::SL2::GFP::H2B]) III. Show Description
CRISPR reporter, substitution of SL2 for T2A. A broad nuclear expression begins around the Comma stage. Brighter expression with earlier initiation than T2A reporter. Expression becomes restricted to non-neuronal cells as animals mature to larval stages. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| QC158 |
C. elegans |
paqr-1(et52) IV. Show Description
paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056
|
|
| QC162 |
C. elegans |
fat-2(wa17) IV; egl-9(et60) V. Show Description
egl-9(et60) is a 1670G>A (Arg557His) substitution and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC164 |
C. elegans |
fat-2(wa17) IV; egl-9(et62) V. Show Description
egl-9(et62) is a 1669C>T (Arg557Cys) substitution and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC165 |
C. elegans |
fat-2(et63wa17) IV. Show Description
fat-2(et63) is a 73G>A (Val25Met) substitution mutation and intragenic fat-2(wa17) suppressor. This strain still carries the fat-2(wa17) S101F substitution mutation. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC166 |
C. elegans |
fat-2(et64wa17) IV. Show Description
fat-2(et64) is a 296C>T (Ser99Leu) substitution and intragenic fat-2(wa17) suppressor. This allele still carries the fat-2(wa17) S101F substitution mutation. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| SA1057 |
C. elegans |
tbb-2(tj41[tbb-1 substitution]) III. Show Description
The endogenous tbb-2 coding sequence was re-encoded with tbb-1 mimic sequence, expressing TBP-1 from the tbp-2 locus. Reference: Honda Y, et al. J Cell Sci. 2017 May 1;130(9):1652-1661. doi: 10.1242/jcs.200923. PMID: 28302908.
|
|
| SA1108 |
C. elegans |
tbb-1(tj59[tbb-2 substitution]) III. Show Description
The endogenous tbb-1 coding sequence was re-encoded with tbb-2 mimic sequence, expressing TBP-2 from the tbp-1 locus. Reference: Honda Y, et al. J Cell Sci. 2017 May 1;130(9):1652-1661. doi: 10.1242/jcs.200923. PMID: 28302908.
|
|
| SBP67 |
C. elegans |
spat-3(mgw14[R209Q]) X. Show Description
Egl, with defects in HSN migration, and HSN and PVQ axon guidance. Crispr/Cas9 induced mutation in Ring1 domain with epigenetic effects on neurodevelopment. Amino acid substitution that likely disrupts interaction with a specific substrate, resulting in a phenotype comparable to a complete gene deletion. Reference: Pierce SB, et al. Proc Natl Acad Sci U S A. 2018 Feb 13;115(7):1558-1563.
|
|
| SD939 |
C. elegans |
mpk-1(ga111) unc-79(e1068) III. Show Description
Unc. Temperature-sensitive sterile. Maintain at 15C. NOTE: Lackenr & Kim (1998) incorrectly states that the ga111 mutant has a T to C transition. The transition is actually T to G giving rise to a Val148Gly substitution. Reference: Lackner MR & Kim SK. Genetics. 1998 Sep;150(1):103-17.
|
|
| SZ370 |
C. elegans |
snu-66(az160) V. Show Description
SNU-66 H765G substitution. No obvious morphological or growth phenotypes were observed. az160 mutation disrupts SNU-66(H765)/SNRP-27(M141) interaction, affecting alternative 5' splice site usage. Worm SNU-66(H765) and SNRP-27(M141) are homologous to human preB spliceosome components snu66(H734) and snrnp27(M141), respectively. Reference: Sarka K, et al. 2024. In submission.
|
|
| TV24410 |
C. elegans |
wyIs592 III; hpo-30(wy1220) V. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. wy1220 is a CRISPR/Cas9-engineered hpo-30(R186A) substitution mutation in the furin cleavage site. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV25655 |
C. elegans |
wyIs738 I; wyIs592 III; hpo-30(wy1220) V. Show Description
wyIs738 [ser-2(prom3)::dma-1:GFP + odr-1p::GFP] I. wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. wy1220 is a CRISPR/Cas9-engineered hpo-30(R186A) substitution mutation in the furin cleavage site. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV26091 |
C. elegans |
dma-1(wy1437[*wy1246]) I . Show Description
GFP tag inserted into endogenous dma-1 locus with a CRISPR/Cas9-engineered dma-1(C470Y) substitution mutation. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV27863 |
C. elegans |
rab-10(wy1616[mScarlet::rab-10]) dma-1(wy1246[dma-1::GFP]) I; hpo-30(wy1220) V; wyIs910 X. Show Description
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. wy1220 is a CRISPR/Cas9-engineered hpo-30(R186A) substitution mutation in the furin cleavage site. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| UT1306 |
C. elegans |
akt-1(mm200) V. Show Description
Benzaldehyde/starvation learning defective. mm200 is a single base pair change resulting in an L199F substitution. Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.
|
|
| UY104 |
C. elegans |
maIs105 V; alg-1(zen25) X. Show Description
maIs105 [col-19::GFP] V. zen25 is a V254I substitution mimicking human AGO1 V254I mutation. Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| UY84 |
C. elegans |
alg-1(zen18) X. Show Description
Maintain at 20C. zen18 is a H751L substitution mimicking human AGO1 H751L mutation. Adult zen18 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| UY98 |
C. elegans |
alg-1(zen25) X. Show Description
zen25 is a V254I substitution mimicking human AGO1 V254I mutation. Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| UY99 |
C. elegans |
maIs105 V; alg-1(zen18) X. Show Description
Maintain at 20C. maIs105 [col-19::GFP] V. zen18 is a H751L substitution mimicking human AGO1 H751L mutation. Adult zen18 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| VC2633 |
C. elegans |
rpm-1(ju1928) degt-1(ok3307) V. Show Description
F25D1.4. External left primer: TCAAGGAAGCATCCGAAGTT. External right primer: CCACGGATGAATCGAGTTTT. Internal left primer: TCAGATTTTTGGAGTTTCCGA. Internal right primer: TTATTCGATTTTCCCCGTTG. Internal WT amplicon: 1152 bp. Deletion size: 915 bp. Deletion left flank: TTTTGGAGTTTCCGATAATTTCCATGATGT. Deletion right flank: TTCAGTGATAAATTTTCAAATTTCTCGAAA. [NOTE: (05/10/2022) This strain also carries an (A to T) missense mutation in rpm-1 which results in a Q3089H amino acid substitution in RPM-1. See Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VT1997 |
C. elegans |
maIs105 V; alg-1(ma192) X. Show Description
Maintain at 20C. maIs105 [col-19::GFP] V. ma192 is a S750F substitution mimicking human AGO1 S750F mutation. Adult ma192 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| VT3805 |
C. elegans |
maIs105 V; alg-1(ma443) X. Show Description
Maintain at 20C. maIs105 [col-19::GFP] V. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| VT3809 |
C. elegans |
alg-1(ma443) X. Show Description
Maintain at 20C. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| WIN253 |
C. elegans |
glh-4(jog16) glh-2(jog49) glh-1(jog50) I. Show Description
Temperature sensitive: maintain at 15-20C. Reduced number of progeny and mortal germline phenotype at elevated temperatures. Engineered mutations of FG repeats in three Vasa like GLH proteins (GLH-1, GLH-2 and GLH-4). glh-1(jog50) is F to A substitution. glh-4(jog16) is F to A substitution. glh-2(jog49) is a deletion of the FG repeats. This strain exhibits a subtle change in germ granule composition while maintaining their architecture. WAGO-4 is mislocalized to the cytoplasm leading to compromised function.
|
|
| WOP159 |
C.elegans |
ahcy-1(syb784 *syb646[ahcy-1(Y145C)::GFP]) I. Show Description
Engineered Y145C substitution mutation in endogenously GFP-tagged ahcy-1 locus. ahcy-1(Y145C) mutation mimics the pathogenic human mutation AHCY Y143C. ahcy-1(Y145C) mutants have a prolonged lifespan and are larger than control animals. ahcy-1(Y145C) mutants are fertile and produce a brood of laid and hatched eggs similar to control animals. ahcy-1(Y145C) mutants show a slight increase in SAH and a decrease in SAM levels, leading to an increased SAH to SAM ratio. See WOP122 for control strain. Derived by out-crossing parental strain PHX784 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.
|
|
| WS1137 |
C. elegans |
cpb-3(op234) I. Show Description
High physiological germ-line apoptosis. op234 was originally assigned to gla-1, but cloning revealed it to be a point mutation in cpb-3 causing a C520Y substitution at an invariant cysteine within the conserved C/H domain.
|
|
| YY186 |
C. elegans |
nrde-2(gg91) II. Show Description
T to A substitution at position 129 and Y to stop at position 24 in exon 2. Reference: GuangS, et al. Nature. 2010 Jun 24;465(7301):1097-101.
|
|
| ZM6610 |
C. elegans |
nlf-1(hp428) X. Show Description
Fainter. hp428 is a G to A substitution that alters the 3? splice junction of the first intron resulting in a single base pair deletion in the hp428 cDNA causing a frame-shift and premature stop. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. PMID: 23522043.
|
|
| ZM6660 |
C. elegans |
got-1.2(hp731) X. Show Description
got-1.2(hp731) is C184Y substitution mutation. Reference: Chitturi J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. PMID: 29649217.
|
|
| BR5271 |
C. elegans |
byIs162. Show Description
byIs162 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line A). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
|
|
| BR5486 |
C. elegans |
byIs162; bkIs10. Show Description
byIs162 [rab-3p::F3(delta)K280(I277P)(I308P) + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 anti-aggregation Tau fragment (with two I to P substitutions) and full-length Tau in all neurons. Red and green fluorescence in the pharynx due to the co-injection markers. The F3/2P fragment is not able to nucleate aggregation of full length Tau. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
|
|
| BR6516 |
C. elegans |
byIs194. Show Description
byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line B). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
|
|
| JK6550 |
C. elegans |
fbf-2(q1264[*q1011])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H326A, Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| JK6578 |
C. elegans |
fbf-1(ok91) fbf-2(q1261[*q973])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| JK6593 |
C. elegans |
fbf-2(q1262[*q945]) II. Show Description
3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A) substitutions.
|
|
| JK6596 |
C. elegans |
fbf-1(ok91) fbf-2(q1272[*q1023])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| JK6658 |
C. elegans |
fbf-1(ok91) fbf-2(q1285[*q1261])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (N415A Y416A Q419A S453A H454A E457A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| JK6737 |
C. elegans |
fbf-2(q1295[*q1011]) II. Show Description
3xFlag tag inserted into endogenous fbf-2 locus with engineered (S453A H454A E457A Y479A) substitutions.
|
|
| NL2511 |
C. elegans |
msh-6(pk2504) I. Show Description
Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6).
|
|
| PHX3225 |
C elegans |
jkk-1(syb3225) X. Show Description
Putative jkk-1 gain-of-function allele. Reference: Busack I & Bringmann H. (2023). JKK-1(3E), a JKK-1 mutant with predicted phosphomimetic amino acid substitutions. microPublication Biology. 10.17912/micropub.biology.000785.
|
|