| ANR165 |
C. elegans |
eif-2alpha(rog3) I. Show Description
eif-2alpha(rog3) is a (S49A) substitution allele (I:2073439..2073448; WS220) removing P site and PAM site. eif-2alpha (Y37E3.10) encodes the alpha subunit of eukaryotic translation initiation factor 2 (eIF2). Reference: Rollins J, et al. Loss of eif-2alpha phosphorylation on S49 (mammalian S51) associated with the integrated stress response hastens development in C. elegans. MicroPubl Biol. 2017;2017:10.17912/W2BM1S. doi: 10.17912/W2BM1S. Erratum in: MicroPubl Biol. 2020 Feb 27;2020: PMID: 32292896.
|
|
| AUM1535 |
C. elegans |
drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I. Show Description
[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010.
|
|
| BJH728 |
C. elegans |
unc-26(pek288[R216Q]) IV. Show Description
unc-26(pek288) is a CRISPR-engineered R216Q substitution in unc-26/synaptojanin 1 associated with early-onset Parkinsonism (EOP) (Quadri et al., 2013; Krebs et al., 2013). This allele shows abnormal focal accumulation of ATG-9 in presynaptic nerve terminals, defects in activity-induced synaptic autophagy, and defects in sustained neurotransmission and locomotory behaviors in aging animals. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10. PMID: 35065714
|
|
| BU8041 |
C. elegans |
pat-3(kq8041) III. Show Description
Mild motility and gonad migration defects. pat-3(kq8041) is an engineered Y804A substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291
|
|
| BU8042 |
C. elegans |
pat-3(kq8042) III. Show Description
Motility and cell (DTC) migration defects. pat-3(kq8042) is an engineered Y804E substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291
|
|
| BU8043 |
C. elegans |
pat-3(kq8043) III. Show Description
Mild motility and cell migration defects. pat-3(kq8043) is an engineered Y804F substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291
|
|
| CF439 |
C. elegans |
lin-39(mu26) III; dpy-20(e1282) IV; him-5(e1490) V; muIs23. Show Description
muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown. [NOTE: This strain was previously described as carrying lin-39(n1760), but it is actually carrying the g to a substitution of mu26. Strain MT7255 has been confirmed to be carrying the a to t substitution of n1760.]
|
|
| CVB96 |
C. elegans |
siss-1(csn20) IV. Show Description
siss-1(csn20) animals are defective in stress-induced sleep (SIS) with no other obvious defects in development or behavior. csn20 is a Cys-to-Tyr substitution in the third Cys residue of the EGF motif of SISS-1 (a.k.a. IGEG-1). csn20 phenocopies the deletion allele ve532, indicating that the EGF domain of SISS-1 is functional. Reference: Hill AJ, et al. Nat Commun 15, 10886. doi: 10.1038/s41467-024-55252-4. PMID: 39738055.
|
|
| CX2065 |
C. elegans |
odr-1(n1936) X. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]
|
|
| CYA22 |
C. elegans |
ahcy-1(syb748) I. Show Description
ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.
|
|
| CYA23 |
C. elegans |
ahcy-1(syb748) I; sqIs13. Show Description
sqIs13 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. GFP fluorescence in autophagosomes. RFP fluorescence in AWB and AWC. ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.
|
|
| DG1856 |
C. elegans |
goa-1(sa734) I. Show Description
Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotory wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.
|
|
| DPB2312 |
C. elegans |
mir-43(sjm2) II. Show Description
Homozygotes lack obvious gross phenotypes. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain is also homozygous for a G>T point substitution at position 8 of miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.
|
|
| DPB2313 |
C. elegans |
mir-43(sjm3) II. Show Description
Homozygotes lack gross phenotypes. mir-43(sjm3) has positions 9-23 of miR-43 substituted for the 3' region of miR-82. This strain is also homozygous for a G>T point substitution at position 8 of miR-42, and furthermore has 22bp of sequence deleted between miR-42* and miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.
|
|
| DPB2315 |
C. elegans |
mir-43(sjm2) II; ebax-1(tm2321) IV. Show Description
Homozygotes lack gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain also has a G>T point substitution at position 8 of miR-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm2) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.
|
|
| DPB2316 |
C. elegans |
mir-43(sjm3) II; ebax-1(tm2321) IV. Show Description
Homozygotes lack obvious gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm3) has positions 9-23 of miR-43 substituted for the 3' region of miR-82. This strain is also homozygous for a G>T point substitution at position 8 of miR-42, and furthermore has 22bp of sequence deleted between mir-42* and mir-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm3) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.
|
|
| DR1566 |
C. elegans |
daf-2(m579) III. Show Description
Adults Age and Itt and temperature sensitive Unc (class 2 allele). m579 results in an amino acid substitution(R437C) in the extracellular portion of the DAF-2 receptor (specifically, the Cys-rich domain).
|
|
| DR1942 |
C. elegans |
daf-2(e979) III. Show Description
This strain forms 20% dauers at 15C. At 25C there occurs about 25% embryonic arrest and about 75% L1 arrest. The e979 mutation results in an amino acid substitution, C146Y, in the ligand-binding domain of the DAF-2 receptor. [CGC received new stock of DR1942 September 2002. Previous stock was probably m41 and not e979.] [June 2004: Patrice Albert has confirmed the mutation in this stock: Repeat of sequencing for CGC collection strain DR1942 [daf-2(e979)] is complete. The strain does carry a C146Y mutation (coding strand TGC to TAC) [Mutation position is at 143, not 146, based on the amino acid sequence shown in Wormbase for daf-2. It's the C in partial sequence EKRCGPI of Exon 5.].]
|
|
| DR608 |
C. elegans |
daf-2(m212) III. Show Description
Temperature sensitive Daf-c. Maintain at 15C. Adults Age and Itt, but not Unc (severe class 1 allele). m212 results in an amino acid substitution(C883Y) in the extracellular portion of the DAF-2 receptor (specificaly, the FnIII2ID domain).
|
|
| EG199 |
C. elegans |
nas-37(ox199) X. Show Description
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.
|
|
| EU1073 |
C. elegans |
him-8(e1489) IV; act-2(or295) V. Show Description
Weakly semi-dominant, temperature sensitive, embryonic lethal mutant. 38% of embyros produced by homozygous mothers at 15C will hatch; 2% produced at 26C will hatch. Mutation is semi-dominant at 26C: 12% of embryos produced by heterozygous mothers hatched at 26C, and about 25% of the survivors were or295/or295, indicating the lethality is semi-dominant and maternal. Mutant embyros exhibit excess cortical actomyosin contractility (extra furrows and protrusions) in early embryonic cells, during interphase and most of mitosis. Throws males. or295 is a gga to aga substitution (G16R).
|
|
| EU1295 |
C. elegans |
act-2(or621) V. Show Description
Strongly semi-dominant, temperature sensitive, embryonic lethal mutant. 40% of embyros produced by homozygous mothers at 15C will hatch; 0% produced at 26C will hatch. Mutation is semi-dominant at 26C: 85% of embyros produced by heterozygous mothers hatched at 26C. Mutant embryos exhibit excess coritical actomyosin contractility (extra furrows and protrusions) in early embryonic cells; during interphase and most of mitosis. or621 is a tcc to gcc substitution (S15A).
|
|
| EU1296 |
C. elegans |
him-8(e1489) IV; act-2(or621) V. Show Description
Strongly semi-dominant, temperature sensitive, embryonic lethal mutant. 40% of embyros produced by homozygous mothers at 15C will hatch; 0% produced at 26C will hatch. Mutation is semi-dominant at 26C: 85% of embyros produced by heterozygous mothers hatched at 26C. Mutant embryos exhibit excess coritical actomyosin contractility (extra furrows and protrusions) in early embryonic cells; during interphase and most of mitosis. Throws males. or621 is a tcc to gcc substitution (S15A).
|
|
| EU1381 |
C. elegans |
act-2(or295) V. Show Description
Weakly semi-dominant, temperature sensitive, embryonic lethal mutant. 38% of embyros produced by homozygous mothers at 15C will hatch; 2% produced at 26C will hatch. Mutation is semi-dominant at 26C: 12% of embryos produced by heterozygous mothers hatched at 26C, and about 25% of the survivors were or295/or295, indicating the lethality is semi-dominant and maternal. Mutant embyros exhibit excess cortical actomyosin contractility (extra furrows and protrusions) in early embryonic cells, during interphase and most of mitosis. or295 is a gga to aga substitution (G16R).
|
|
| EW15 |
C. elegans |
bar-1(ga80) X. Show Description
[NOTE: (10/22/2020) This strain also carries a (T to A) missense mutation in pry-1 which results in a PRY-1 N354K amino acid substitution.] bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.
|
|
| FAS65 |
C. elegans |
his-69&his-70(uge44) III. Show Description
Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
| GR1318 |
C. elegans |
pdk-1(mg142) X. Show Description
No visible phenotype. Dominant suppressor of daf-c phenotype of age-1. Ala303Val substitution.
|
|
| HP17 |
C. elegans |
sos-1(pd10) V. Show Description
sos-1 gain-of-function allele originally isolated as a suppressor of sem-5(n1619) lethality. pd10 causes a E99K substitution within the N-terminal histone fold domain of SOS-1. Single mutants appear wild-type.
|
|
| HP23 |
C. elegans |
sos-1(pd9) V. Show Description
sos-1(pd9) is a gain-of-function allele causing a C662Y substitution within the Ras exchange motif of SOS-1. Originally isolated as a suppressor of sem-5(n1619) lethality. Single mutants appear wild-type. Reference: Wooller A & Hopper N. (2014) European Worm Meeting. (Anyone using this allele may cite Neil Hopper as a personal communication based on this meeting abstract.)
|
|
| HS304 |
C. elegans |
swsn-1(os22) V. Show Description
Temperature sensitive. At 22.5C, maternal effect embryonic lethal. Temperature shift-up to 22.5C during embryogenesis results in animals with Egl, Pvul and Psa (phasmid socket absent) phenotypes. Shift-up to 25C results in growth arrest at larval stage. The T cell division can be symmetric as in lin-17 mutants. At 15C, nearly WT. Males grown at 15C can mate very well. psa-1 encodes a homolog of yeast SW13, a component of the SWI/SNF complex. Sequence data of this strain revealed the mutation is actually GTC/CCC/TCA to GTC/CTC/TCA causing a P86L substitution (G. Hayes).
|
|
| JH3182 |
C. elegans |
gtbp-1(ax2035[gtbp-1::TetraCys]) IV. Show Description
Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCAC GT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3184 |
C. elegans |
gtbp-1(ax2037([gtbp-1::Myc]) IV. Show Description
Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3186 |
C. elegans |
gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JK6540 |
C. elegans |
gld-1(q1242) I. Show Description
q1242 is an engineered TGT to ACA substitution in FBEa1 of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
|
|
| JK6568 |
C. elegans |
gld-1(q1257) I. Show Description
q1257 is an engineered TGT to ACA substitution in FBEb of the endogenous gld-1 locus. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
|
|
| JK6602 |
C. elegans |
gld-1(q1271[*q1242]) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Engineered TGT to ACA substitutions in FBEa1 and FBEb of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP q1271 homozygotes (sterile Mog). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by modification of gld-1(q1242) homozygotes from parental strain JK6540. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
|
|
| JK6607 |
C. elegans |
fbf-1(ok91) fbf-2(q1263[*q973])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479F substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| JK6678 |
C. elegans |
fbf-1(ok91) fbf-2(q1291[*q973])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479E substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| JK6690 |
C. elegans |
qSi422 [*rajSi50] II. Show Description
qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
|
|
| JK6692 |
C. elegans |
qSi424 [*rajSi50] II. Show Description
qSi424 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter and GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
|
|
| JK6693 |
C. elegans |
qSi425 [*rajSi50] II. Show Description
qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
|
|
| JT193 |
C. elegans |
daf-2(sa193) III. Show Description
Adults Age and Itt, but not Unc (class 1 allele). sa193 results in an amino acid substitution(A580T) in the extracellular portion of the DAF-2 receptor (specifically, the L2 domain).
|
|
| JT513 |
C. elegans |
nrf-5(sa513) V. Show Description
Nrf, Peg, accumulates yolk in pseudo-coelomic space, slow growing, partial embryonic lethality. [NOTE: (3/3/2026) A user has reported that their sequencing of JT513 shows sa513 is a C->A substitution. It has been described on WormBase as C->G.] Reference: Choy RKM, et al. Genetics. 2006 Feb;172(2):885-92. doi: 10.1534/genetics.103.024869. PMID: 16118202.
|
|
| JT734 |
C. elegans |
goa-1(sa734) I. Show Description
Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotort wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.
|
|
| LBV2 |
C. elegans |
nstp-3(ejd2) V. Show Description
DEET-resistant. ejd2 causes a F48V substitution in nstp-3. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123.
|
|
| LBV3 |
C. elegans |
str-217(ejd3) V. Show Description
DEET-resistant. ejd3 causes a P314S substitution in str-217. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123.
|
|
| LE6897 |
C. elegans |
src-1(syb7248)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.
|
|
| LIU104 |
C. elegans |
dhs-28(ldr6) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr6 is G-to-A causing a G158E substitution. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G158E substitution site of the ldr6 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
|
|
| LIU65 |
C.elegans |
dhs-28(ldr5) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr5 is C-to-T substitution causing a premature stop (Q139*). Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The Q139* premature stop in the ldr5 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
|
|
| MCJ288 |
C. elegans |
alg-2(cdb155[D627A]) II. Show Description
cdb155 is an engineered D627A substitution in the short isoform of alg-2, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-2. sgRNA #1: GATGGGTGATGTCGCAACCC. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
|
|