Search Strains

GFP tag inserted at the C-terminus of the endogenous tkr-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.

GFP tag inserted at the C-terminus of the endogenous ins-9 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F44E5.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTAGAAAGACTATATGCCATAGTAGAAGATCCGCTC. Right flanking sequence: AGTGAGTTCGTTGCAGGCGGACTACGTTgtaagtttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CCTGCAACGAACTCACTGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

R07E5.15, R07E5.17. Homozygous. Outer Left Sequence: TCACGGTCATCGATTGGTTA. Outer Right Sequence: TGGCCCGGTATCACAATAAT. Inner Left Sequence: CTTGAAAAGCAACTCGGACC. Inner Right Sequence: CGGAAAATTCGACCAGAGAA. Inner Primer WT PCR Product: 2236. Deletion size: 992 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14E5.4. Homozygous. Outer Left Sequence: CTCGACGAATAGACCGATGC. Outer Right Sequence: TTTGGTCAGTTGGCATTTCA. Inner Left Sequence: CCTTTTTCCATCGAAACCAC. Inner Right Sequence: GCGTGCTTCAGAAAGGTGAT. Inner Primer PCR Length: 2170 bp. Deletion Size: 1766 bp. Deletion left flank: TTTTTCCATCGAAACCACAATTTATACTTG. Deletion right flank: TTTGCAAGATAAGCAGGATCGCTGAGACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08E5.2. Homozygous. Outer Left Sequence: AACAAATGGGTGAGGGATCA. Outer Right Sequence: ATTCCCTCAGAGCCCAATTT. Inner Left Sequence: GGGAACTGTAAAGGGTGATCG. Inner Right Sequence: AAAACTGACGCTTTTCACCG. Inner Primer PCR Length: 3136 bp. Deletion Size: 1560 bp. Deletion left flank: ATTTAAACACTATAGCAGTTTCCAAAACTC. Deletion right flank: GAGAAATCTTTGAATTCTCTGAGAAACTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R04E5.10. Homozygous. Outer Left Sequence: AGAATGCTTGAAAGCCGAGA. Outer Right Sequence: ACTACGGAAGGGCATGTGAC. Inner Left Sequence: CGACCGAAAATGTACCAACA. Inner Right Sequence: TTGCGGTAAACTCTGATCCC. Inner Primer PCR Length: 3151 bp. Deletion Size: 1863 bp. Deletion left flank: AATATCATGGTATAGCACTTTAAAAACTTT. Deletion right flank: ATTTTAAAAAAAGCAAATTAAAAACTAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03E5.1. Homozygous. Outer Left Sequence: TTAGCGAGGGTCGAAGACAT. Outer Right Sequence: AAAATCTGACAAACGTGCCC. Inner Left Sequence: TTTAGCTTTGCACACGATGC. Inner Right Sequence: TTTCCTAACGAGACCCAACG. Inner Primer PCR Length: 2967 bp. Deletion Size: 1739 bp. Deletion left flank: TTGGGTGCGAAATCCGTGGCCTAATTTTCT. Deletion right flank: TAGTTTGATGAATACACCAGATTTGACGTG. Insertion Sequence: CT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ok2552. Homozygous. Outer Left Sequence: CAAAGATTGTGGCGGAAAAT. Outer Right Sequence: CGGTAGCTGATTTTCGTGGT. Inner Left Sequence: GTTACACCTTTTCCTGGCGA. Inner Right Sequence: CTAAAATTCTGCGGAAACCG. Inner Primer PCR Length: 2997 bp. Deletion Size: 2279 bp. Deletion left flank: ATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAA AATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAA AAATAGATTGTTACACGAAAAAATAGATTGTTAC. Deletion right flank: CAAAAAACTGTGAAAATTCACTTCAACTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25E5.3 & F25E5.10. Homozygous. Outer Left Sequence: CGAGGGAACAACTCCAGAAG. Outer Right Sequence: CTTGTTCGCAGTGTTGCAGT. Inner Left Sequence: TGTCCACATATGAGTCTGCCA. Inner Right Sequence: TGAACGACAATCTGGACATGA. Inner Primer PCR Length: 3023 bp. Deletion Size: 1520 bp. Deletion left flank: CAGCTTCAAGCAACATGTGGACGTAACACA. Deletion right flank: CATGGAACTTACTCACGGCGGCACCTCCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27E5.4. Homozygous. Outer Left Sequence: GGTGATTCTCCCGTTGGTAA. Outer Right Sequence: AAACGGAAATGGCAGAGAGA. Inner Left Sequence: GACAGTTACGCTGTGCTTGG. Inner Right Sequence: CTCCCGGGGTATTCTGAAAT. Inner Primer PCR Length: 1222 bp. Deletion Size: 472 bp. Deletion left flank: GCTCAGAACATGCAACTTCCTTCCAGCCGA. Deletion right flank: CACTGATCGAGTTTTCTTTTTTACTTTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22E5.2. Homozygous. Outer Left Sequence: GCCTCATTGGATTCTGGAAC. Outer Right Sequence: TTTTATCGGATTACGGCGAG. Inner Left Sequence: GCAGGAAGATTAGGAATGGTG. Inner Right Sequence: GCCAAAAAGCTCAAAATTGG. Inner Primer PCR Length: 1130 bp. Deletion Size: 343 bp. Deletion left flank: ATCGGATGGGTCATTATGTAATATTGAAAT. Deletion right flank: TTAATCTTGACTCGAATCGAGAATGATAGG. Insertion Sequence: TTAATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25E5.7. Homozygous. Outer Left Sequence: TTCGGCAATATGCCCTTAAC. Outer Right Sequence: CGCGGCTGAAGACTTTAGTT. Inner Left Sequence: CCTTTCCTCCAACGAAGAATC. Inner Right Sequence: TGACATTGCATACCAGGAGAA. Inner Primer PCR Length: 1222 bp. Deletion Size: 631 bp. Deletion left flank: TTTCAGTATTACGTTCAAAAAGATGGGAAA. Deletion right flank: GAACATGAACTGCAATGCGAATCCACAGAA. Insertion Sequence: AAAAAAACATTTTGATTAATTTCAGAATTTTGATAAATTTCAAAACATTTGATTAATTT CAGTATGACTCCGGAGGTAGTGCAATAAGCAACGTTTCCGGACAAAATACCGTTCTTGG AGTGTATGTAACAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E5.4 Homozygous. Outer Left Sequence: acatgttgtgcagcattggt. Outer Right Sequence: gcaaagatatcgtggctggt. Inner Left Sequence: gcgacctacggcaaaattag. Inner Right Sequence: gcaacagaaaccattctagcac. Inner Primer PCR Length: 1264. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27E5.1. Homozygous. Outer Left Sequence: CTGCCAGAGGTAAGTAGCCG. Outer Right Sequence: CAGATGGGAAGATCGGAAAA. Inner Left Sequence: TGAAAGACAACTTGCTCGGA. Inner Right Sequence: TGTCTTTTCAGCAGTCACCG. Inner primer WT PCR product: 3142. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07E5.3, R07E5.14. Homozygous. Outer Left Sequence: ATTATTGTGATACCGGGCCA. Outer Right Sequence: AATTGAGAAGAGCGAGCGAG. Inner Left Sequence: CTACGCGAAACGGATCAAAT. Inner Right Sequence: CGTGGATTGGAGAGGACAAT. Inner primer WT PCR product: 2877. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07E5.8. Homozygous. Outer Left Sequence: CTTGAAAAACGCACGCATTA. Outer Right Sequence: TTCTGACATGCTGACTTCGG. Inner Left Sequence: GTTACAGGAATGCCGCCTAA. Inner Right Sequence: TTGTTGAATGAGGAATGGCA. Inner Primer WT PCR Product: 3314. Deletion size: 1646 bp; includes 315-bp insertion at break. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 2259 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGAGAAAAAGAAAGAGGGAGACAGAGTG ; Right flanking sequence: AATGTTGTTCTAATAAATTTACAAAAATCT. sgRNA #1: TCTAGAAGATGTTACGGGAA; sgRNA #2: AACAGGCATACATTAAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:AATTAATCAACTTCCTCAACAGTAGGTCCT ; Right flanking sequence:AATGTTGTTCTAATAAATTTACAAAAATCT. sgRNA: AATCCTAACAATTATCCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Heterozygotes are WT and segregate WT, Egls which have a protruding vulva, and DpyUncs. Maintain by picking WT. lin-29 suppresses rol-1 phenotype (rol-1 is an adult specific Roller and lin-29 animals never molt to adult cuticle).

Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he5).

ddIs115 [R07E5.3::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

R07E5.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C45E5.6. Superficially wild type. External left primer: TCGTCGTTGTACGGGATGTA. External right primer: CTGTGCGAGAAACCAACAAA. Internal left primer: TCCATCCGAAAGCCATAAAG. Internal right primer: AGGGTATTCGAAGGGCAGAT. Internal WT amplicon: 1710 bp. Deletion size: 789 bp. Deletion left flank: TAAAAAGAAAAAAGATTCTATCTAGTGCAC. Deletion right flank: GATCTGCCCTTCGAATACCCTAAAAGAGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25E5.6. External left primer: TTGAACGCACTTCACCTCAC. External right primer: GCCATTTTTCAAATCCTCCA. Internal left primer: ACCACTCCGGTCAAAGATTG. Internal right primer: GAAACTTCTTGTTCGGCGTC. Internal WT amplicon: 2448 bp. Deletion size: 606 bp. Deletion left flank: GGCGCCTATGAATAAGTAAATTTACTTTGC. Deletion right flank: ATAATTTTGAAAAAAGGAACTTTTTACCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25E5.6. External left primer: TTGAACGCACTTCACCTCAC. External right primer: GCCATTTTTCAAATCCTCCA. Internal left primer: ACCACTCCGGTCAAAGATTG. Internal right primer: GAAACTTCTTGTTCGGCGTC. Internal WT amplicon: 2448 bp. Deletion size: 1181 bp. Deletion left flank: TCCTTGTCTTGAAGAGTTTCTTCTATTAGA. Deletion right flank: CGAAATGTGGCATAAAACCACGTAACGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07E5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2653 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTTTTGGGCCATTTTGAG. External right primer: CCATTTTCACAGCGGCTAAT. Internal left primer: AATTAATTTTTCCAGGCGGC. Internal right primer: CACAAATTTCGAAGCCATCA. Internal WT amplicon: 1186 bp. Deletion size: 399 bp. Deletion left flank: ATTTGCTAAAGTTTGAGTTTACGGGTTTTT. Deletion right flank: CTGTCTGGGAGTGGGAGTGGGAAAAGAAAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E5.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok544 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E5.15. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W01A11.3, Y41D4B.26, F07E5.7. The gk1259 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AGAGTTCGGGGCTGATTTTT. External right primer: AGGAGGGACTTTTTAGGCCA. Internal left primer: AACTGAGCCACTCGGGTAAA. Internal right primer: TGCTGATTGGAAGAAGTGGA. Internal WT amplicon: 2165 bp. Deletion size: 1624 bp. Deletion left flank: CTGAGCCACTCGGGTAAAACTAAATTTTTT. Deletion right flank: ATTTTTTTCTAGAAACTGGACCGGCGAAAA. Insertion Sequence: CCCTTTCCCCCC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03E5.3. External left primer: AAAATGCGTATTTCGCAACC. External right primer: AATTTCGTTCGATGACACCC. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: TGAAGAGGAAAGACTCGGTAAAA. Internal WT amplicon: 1155 bp. Deletion size: 246 bp. Deletion left flank: GAATTAAAATAATTTATTAATTTAAATAAC. Deletion right flank: TTCCAAAAAAAAACATAAATTTCGATTATT. Insertion Sequence: CAAAAAAAAACATAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 655 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CCATATTCTTGAAGCTGAATGTTTCCCCAG. Right flanking sequence: GTAGGAGATTTTTATCTTCTTGTGACACGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 849 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAGTGATCACAAATAAGTAAACGAGGTCCA. Right flanking sequence: GTTTAACACAAACACAACACTGAAAATAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.

qxIs612 [hsp-16.2p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + hsp-16.41p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + unc-76(+)]. Heat-shock inducible NUC-1::sfGFP::mCherry fusion transgene for monitoring lysosomal activity. Array contains p76-16B, a plasmid containing 10.5 kb genomic DNA including unc-76. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5. doi: 10.1016/j.devcel.2019.10.020. PMID: 31735670.

qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5.

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.

hpIs600 [myo-3p::GCaMP6::wCherry + lin-15(+)]. GFP and RFP in body wall muscles. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

Approx. 1.3 kb deletion - does not remove entire coding region, might not be null allele. No overt morphological or behavioral abnormalities. Homozygotes are 2-3X more sensitive to colchicine and chloroquine than are N2 animals.

Homozygous viable, gfp expression in intestine, hypodermis, developing vulva, somatic gonad. Reference: Starich et al. eLife 2020;9:e58619. DOI: https://doi.org/10.7554/eLife.58619

av144 is a CRISPR/Cas9 engineered deletion in the N-terminal region of pezo-1 removing exons 1–13. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.

av149 is a CRISPR/Cas9 engineered deletion in the C-terminal region of pezo-1 removing the last seven exons (27–33) and introns. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.

ddi-1 also known as vsm-1.

sEx10691[rCesY54E5A.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

Heterozygotes are WT and segregate WT, Unc and DpyUncLets. Lethal at L1. Maintain by picking WT.

Heterozygotes are WT and segregate more WT, paralyzed Unc, and DpyUncLet (DpyUnc Larvae are abnormal). Maintain by picking WT.