More Fields
Strain Species Genotype
AFS205 C. elegans zen-4(cle5) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
BC12438 C. elegans dpy-5(e907) I; sEx12438. Show Description
sEx12438 [rCes R07E5.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12442 C. elegans dpy-5(e907) I; sEx12442. Show Description
sEx12442[rCes R07E5.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13145 C. elegans dpy-5(e907) I; sEx13145. Show Description
sEx13145 [rCesF09E5.15::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14910 C. elegans dpy-5(e907) I; sEx14910. Show Description
sEx14910 [rCesF09E5.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15876 C. elegans dpy-5(e907) I; sEx15876. Show Description
sEx15876 [rCes F25E5.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC20063 C. elegans dpy-5(e907) I; sEx20063. Show Description
sEx20063[rCesF44E5.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC5323 C. elegans sEx398. Show Description
sEx398 [R07E5 (III) + pCes1943[rol-6(su1006)]]. A small amount of R07E5 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5544 C. elegans sEx591. Show Description
sEx591 [K03E5 (I) + pCes1943[rol-6(su1006)]]. seg 2. 20 ng/ul K03E5 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5700 C. elegans sEx714. Show Description
sEx714 [F57E5 (X) + pCes1943[rol-6(su1006)]]. 21 ng/ul F57E5 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
CB5 C. elegans unc-7(e5) X. Show Description
Unc. Moves backward better than forward, kinker in forward movement.
DA1917 Escherichia coli E. coli. Show Description
Bacteria. Contains eat-5 rescuing plasmid pRE5-7. Amp-R. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. Biosafety Level: BSL-1.
DM7186 C. elegans pha-1(e2123) III; raEx186. Show Description
raEx186 [M01E5.4::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7188 C. elegans pha-1(e2123) III; raEx188. Show Description
raEx188 [R07E5.7::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
GJ3452 C. elegans gcy-22(gj1976[gcy-22::GFP]) V. Show Description
GFP tag inserted into endogenous gcy-22 locus. GCY-22::GFP expression in the ASER neuron localized at cilium tip and PCMC. Reference: van der Burght SN, et al. Curr Biol. 2020 Nov 2;30(21):4299-4306.e5. PMID: 32916106
HBR764 C. elegans C10C6.7(goe5) IV. Show Description
goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.
JW101 C. elegans unc-73(e936) I; sup-39(je5) II. Show Description
WT movement. Various degrees of embryonic lethality and Egl. About 1% Roll after L4.
JW102 C. elegans sup-39(je5) II. Show Description
je5 is a dominant suppressor of unc-73(e936). WT movement. Various degrees of embryonic lethality and Egl. About 1% Roller after L4.
JW104 C. elegans dpy-10(e128) sup-39(je5) unc-4(e120) II. Show Description
Dpy Unc-4 phenotype. Sick.
JW105 C. elegans dpy-10(e128) sup-39(je5) unc-4(e120)/unc-104(e1265) II. Show Description
Heterozygotes are WT and segregate WT, Dpy Unc-4, and Unc-104s.
JW106 C. elegans sup-39(je5) II; syr-1(je11) ?. Show Description
Synthetic Roller after L4 stage (85% penetrance). je5 is dominant and je11 is recessive. See 1996 East Coast Worm Meeting Abstract #80.
MBA281 C. elegans icbIs4 II. Show Description
icbIs4 [chil-27p::GFP + col-12p::mCherry] II. Reference: Osman GA, et al. Curr Biol. 2018 Feb 19;28(4):640-648.e5.
PS7731 C. elegans K03E5.2(sy1082) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG Reference: Wang H, et al. G3 (Bethesda).
PS7783 C. elegans K03E5.2(sy1086) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8207 C. elegans F44E5.3(sy1224) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F44E5.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTAGAAAGACTATATGCCATAGTAGAAGATCCGCTC. Right flanking sequence: AGTGAGTTCGTTGCAGGCGGACTACGTTgtaagtttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CCTGCAACGAACTCACTGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
RB1060 C. elegans R07E5.15&R07E5.17(ok1009) III. Show Description
R07E5.15, R07E5.17. Homozygous. Outer Left Sequence: TCACGGTCATCGATTGGTTA. Outer Right Sequence: TGGCCCGGTATCACAATAAT. Inner Left Sequence: CTTGAAAAGCAACTCGGACC. Inner Right Sequence: CGGAAAATTCGACCAGAGAA. Inner Primer WT PCR Product: 2236. Deletion size: 992 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1704 C. elegans F14E5.4(ok2129) II. Show Description
F14E5.4. Homozygous. Outer Left Sequence: CTCGACGAATAGACCGATGC. Outer Right Sequence: TTTGGTCAGTTGGCATTTCA. Inner Left Sequence: CCTTTTTCCATCGAAACCAC. Inner Right Sequence: GCGTGCTTCAGAAAGGTGAT. Inner Primer PCR Length: 2170 bp. Deletion Size: 1766 bp. Deletion left flank: TTTTTCCATCGAAACCACAATTTATACTTG. Deletion right flank: TTTGCAAGATAAGCAGGATCGCTGAGACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1770 C. elegans nac-3(ok2274) III. Show Description
K08E5.2. Homozygous. Outer Left Sequence: AACAAATGGGTGAGGGATCA. Outer Right Sequence: ATTCCCTCAGAGCCCAATTT. Inner Left Sequence: GGGAACTGTAAAGGGTGATCG. Inner Right Sequence: AAAACTGACGCTTTTCACCG. Inner Primer PCR Length: 3136 bp. Deletion Size: 1560 bp. Deletion left flank: ATTTAAACACTATAGCAGTTTCCAAAACTC. Deletion right flank: GAGAAATCTTTGAATTCTCTGAGAAACTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1858 C. elegans ifd-1(ok2404) X. Show Description
R04E5.10. Homozygous. Outer Left Sequence: AGAATGCTTGAAAGCCGAGA. Outer Right Sequence: ACTACGGAAGGGCATGTGAC. Inner Left Sequence: CGACCGAAAATGTACCAACA. Inner Right Sequence: TTGCGGTAAACTCTGATCCC. Inner Primer PCR Length: 3151 bp. Deletion Size: 1863 bp. Deletion left flank: AATATCATGGTATAGCACTTTAAAAACTTT. Deletion right flank: ATTTTAAAAAAAGCAAATTAAAAACTAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1907 C. elegans K03E5.1(ok2468) I. Show Description
K03E5.1. Homozygous. Outer Left Sequence: TTAGCGAGGGTCGAAGACAT. Outer Right Sequence: AAAATCTGACAAACGTGCCC. Inner Left Sequence: TTTAGCTTTGCACACGATGC. Inner Right Sequence: TTTCCTAACGAGACCCAACG. Inner Primer PCR Length: 2967 bp. Deletion Size: 1739 bp. Deletion left flank: TTGGGTGCGAAATCCGTGGCCTAATTTTCT. Deletion right flank: TAGTTTGATGAATACACCAGATTTGACGTG. Insertion Sequence: CT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1944 C. elegans M01E5.2(ok2552) I. Show Description
ok2552. Homozygous. Outer Left Sequence: CAAAGATTGTGGCGGAAAAT. Outer Right Sequence: CGGTAGCTGATTTTCGTGGT. Inner Left Sequence: GTTACACCTTTTCCTGGCGA. Inner Right Sequence: CTAAAATTCTGCGGAAACCG. Inner Primer PCR Length: 2997 bp. Deletion Size: 2279 bp. Deletion left flank: ATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAA AATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAA AAATAGATTGTTACACGAAAAAATAGATTGTTAC. Deletion right flank: CAAAAAACTGTGAAAATTCACTTCAACTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1996 C. elegans F25E5.3&try-8(ok2641) V. Show Description
F25E5.3, F25E5.10. Homozygous. Outer Left Sequence: CGAGGGAACAACTCCAGAAG. Outer Right Sequence: CTTGTTCGCAGTGTTGCAGT. Inner Left Sequence: TGTCCACATATGAGTCTGCCA. Inner Right Sequence: TGAACGACAATCTGGACATGA. Inner Primer PCR Length: 3023 bp. Deletion Size: 1520 bp. Deletion left flank: CAGCTTCAAGCAACATGTGGACGTAACACA. Deletion right flank: CATGGAACTTACTCACGGCGGCACCTCCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2075 C. elegans phg-1(ok2741) II. Show Description
F27E5.4. Homozygous. Outer Left Sequence: GGTGATTCTCCCGTTGGTAA. Outer Right Sequence: AAACGGAAATGGCAGAGAGA. Inner Left Sequence: GACAGTTACGCTGTGCTTGG. Inner Right Sequence: CTCCCGGGGTATTCTGAAAT. Inner Primer PCR Length: 1222 bp. Deletion Size: 472 bp. Deletion left flank: GCTCAGAACATGCAACTTCCTTCCAGCCGA. Deletion right flank: CACTGATCGAGTTTTCTTTTTTACTTTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2185 C. elegans glt-4(ok2961) X. Show Description
T22E5.2. Homozygous. Outer Left Sequence: GCCTCATTGGATTCTGGAAC. Outer Right Sequence: TTTTATCGGATTACGGCGAG. Inner Left Sequence: GCAGGAAGATTAGGAATGGTG. Inner Right Sequence: GCCAAAAAGCTCAAAATTGG. Inner Primer PCR Length: 1130 bp. Deletion Size: 343 bp. Deletion left flank: ATCGGATGGGTCATTATGTAATATTGAAAT. Deletion right flank: TTAATCTTGACTCGAATCGAGAATGATAGG. Insertion Sequence: TTAATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2343 C. elegans F25E5.7(ok3179) V. Show Description
F25E5.7. Homozygous. Outer Left Sequence: TTCGGCAATATGCCCTTAAC. Outer Right Sequence: CGCGGCTGAAGACTTTAGTT. Inner Left Sequence: CCTTTCCTCCAACGAAGAATC. Inner Right Sequence: TGACATTGCATACCAGGAGAA. Inner Primer PCR Length: 1222 bp. Deletion Size: 631 bp. Deletion left flank: TTTCAGTATTACGTTCAAAAAGATGGGAAA. Deletion right flank: GAACATGAACTGCAATGCGAATCCACAGAA. Insertion Sequence: AAAAAAACATTTTGATTAATTTCAGAATTTTGATAAATTTCAAAACATTTGATTAATTT CAGTATGACTCCGGAGGTAGTGCAATAAGCAACGTTTCCGGACAAAATACCGTTCTTGG AGTGTATGTAACAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2627 C. elegans srg-69(ok3686) II. Show Description
F09E5.4 Homozygous. Outer Left Sequence: acatgttgtgcagcattggt. Outer Right Sequence: gcaaagatatcgtggctggt. Inner Left Sequence: gcgacctacggcaaaattag. Inner Right Sequence: gcaacagaaaccattctagcac. Inner Primer PCR Length: 1264. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB782 C. elegans F27E5.1(ok564) II. Show Description
F27E5.1. Homozygous. Outer Left Sequence: CTGCCAGAGGTAAGTAGCCG. Outer Right Sequence: CAGATGGGAAGATCGGAAAA. Inner Left Sequence: TGAAAGACAACTTGCTCGGA. Inner Right Sequence: TGTCTTTTCAGCAGTCACCG. Inner primer WT PCR product: 3142. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB810 C. elegans R07E5.3(ok622) III. Show Description
R07E5.3, R07E5.14. Homozygous. Outer Left Sequence: ATTATTGTGATACCGGGCCA. Outer Right Sequence: AATTGAGAAGAGCGAGCGAG. Inner Left Sequence: CTACGCGAAACGGATCAAAT. Inner Right Sequence: CGTGGATTGGAGAGGACAAT. Inner primer WT PCR product: 2877. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB964 C. elegans cku-80(ok861) III. Show Description
R07E5.8. Homozygous. Outer Left Sequence: CTTGAAAAACGCACGCATTA. Outer Right Sequence: TTCTGACATGCTGACTTCGG. Inner Left Sequence: GTTACAGGAATGCCGCCTAA. Inner Right Sequence: TTGTTGAATGAGGAATGGCA. Inner Primer WT PCR Product: 3314. Deletion size: 1646 bp; includes 315-bp insertion at break. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG93 C. elegans lin-29(ve5) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Egls which have a protruding vulva, and DpyUncs. Maintain by picking WT. lin-29 suppresses rol-1 phenotype (rol-1 is an adult specific Roller and lin-29 animals never molt to adult cuticle).
SV93 C. elegans cdk-1(he5)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he5).
TH199 C. elegans unc-119(ed3) III; ddIs115. Show Description
ddIs115 [R07E5.3::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
VC1151 C. elegans prdx-3(gk529) III. Show Description
R07E5.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1405 C. elegans nhr-46(gk654) IV. Show Description
C45E5.6. Superficially wild type. External left primer: TCGTCGTTGTACGGGATGTA. External right primer: CTGTGCGAGAAACCAACAAA. Internal left primer: TCCATCCGAAAGCCATAAAG. Internal right primer: AGGGTATTCGAAGGGCAGAT. Internal WT amplicon: 1710 bp. Deletion size: 789 bp. Deletion left flank: TAAAAAGAAAAAAGATTCTATCTAGTGCAC. Deletion right flank: GATCTGCCCTTCGAATACCCTAAAAGAGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1725 C. elegans nhr-141(gk842) V. Show Description
F25E5.6. External left primer: TTGAACGCACTTCACCTCAC. External right primer: GCCATTTTTCAAATCCTCCA. Internal left primer: ACCACTCCGGTCAAAGATTG. Internal right primer: GAAACTTCTTGTTCGGCGTC. Internal WT amplicon: 2448 bp. Deletion size: 606 bp. Deletion left flank: GGCGCCTATGAATAAGTAAATTTACTTTGC. Deletion right flank: ATAATTTTGAAAAAAGGAACTTTTTACCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1734 C. elegans nhr-141(gk845) V. Show Description
F25E5.6. External left primer: TTGAACGCACTTCACCTCAC. External right primer: GCCATTTTTCAAATCCTCCA. Internal left primer: ACCACTCCGGTCAAAGATTG. Internal right primer: GAAACTTCTTGTTCGGCGTC. Internal WT amplicon: 2448 bp. Deletion size: 1181 bp. Deletion left flank: TCCTTGTCTTGAAGAGTTTCTTCTATTAGA. Deletion right flank: CGAAATGTGGCATAAAACCACGTAACGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2031 C. elegans R07E5.1(ok2653) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R07E5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2653 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTTTTGGGCCATTTTGAG. External right primer: CCATTTTCACAGCGGCTAAT. Internal left primer: AATTAATTTTTCCAGGCGGC. Internal right primer: CACAAATTTCGAAGCCATCA. Internal WT amplicon: 1186 bp. Deletion size: 399 bp. Deletion left flank: ATTTGCTAAAGTTTGAGTTTACGGGTTTTT. Deletion right flank: CTGTCTGGGAGTGGGAGTGGGAAAAGAAAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC277 C. elegans pkc-3(ok544)/mIn1 [dpy-10(e128) mIs14] II. Show Description
F09E5.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok544 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC289 C. elegans prdx-2(gk169) II. Show Description
F09E5.15. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2975 C. elegans bath-5(gk3138) II; Y41D4B.26(gk1259) IV; unc-83(gk3139) V. Show Description
W01A11.3, Y41D4B.26, F07E5.7. The gk1259 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AGAGTTCGGGGCTGATTTTT. External right primer: AGGAGGGACTTTTTAGGCCA. Internal left primer: AACTGAGCCACTCGGGTAAA. Internal right primer: TGCTGATTGGAAGAAGTGGA. Internal WT amplicon: 2165 bp. Deletion size: 1624 bp. Deletion left flank: CTGAGCCACTCGGGTAAAACTAAATTTTTT. Deletion right flank: ATTTTTTTCTAGAAACTGGACCGGCGAAAA. Insertion Sequence: CCCTTTCCCCCC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807