| AFS205 |
C. elegans |
zen-4(cle5) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
|
|
| ARK7 |
C. elegans |
spe-36(nwk1[spe-36::gfp]) IV; him-5(e1490) V. Show Description
GFP tag inserted into endogenous spe-36 (F40F11.4) locus. SPE-36::GFP expression in spermatids and spermatozoa. Reference: Krauchunas AR, et al. Curr Biol. 2023 Jul 24;33(14):3056-3064.e5. doi: 10.1016/j.cub.2023.06.051. PMID: 37453426.
|
|
| BC12438 |
C. elegans |
dpy-5(e907) I; sEx12438. Show Description
sEx12438 [rCes R07E5.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12442 |
C. elegans |
dpy-5(e907) I; sEx12442. Show Description
sEx12442[rCes R07E5.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC13145 |
C. elegans |
dpy-5(e907) I; sEx13145. Show Description
sEx13145 [rCesF09E5.15::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14910 |
C. elegans |
dpy-5(e907) I; sEx14910. Show Description
sEx14910 [rCesF09E5.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC15876 |
C. elegans |
dpy-5(e907) I; sEx15876. Show Description
sEx15876 [rCes F25E5.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC20063 |
C. elegans |
dpy-5(e907) I; sEx20063. Show Description
sEx20063[rCesF44E5.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC5323 |
C. elegans |
sEx398. Show Description
sEx398 [R07E5 (III) + pCes1943[rol-6(su1006)]]. A small amount of R07E5 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
| BC5544 |
C. elegans |
sEx591. Show Description
sEx591 [K03E5 (I) + pCes1943[rol-6(su1006)]]. seg 2. 20 ng/ul K03E5 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
| BC5700 |
C. elegans |
sEx714. Show Description
sEx714 [F57E5 (X) + pCes1943[rol-6(su1006)]]. 21 ng/ul F57E5 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
| CB5 |
C. elegans |
unc-7(e5) X. Show Description
Unc. Moves backward better than forward, kinker in forward movement.
|
|
| CHS1209 |
C. elegans |
f57g9.7(yum2254) r05f9.7(yum2255) c54c6.4(yum2256) r11g10.3(yum2257) f27e5.5(yum2258) f27e5.8(yum2259) t10g3.2(yum2260) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1222 |
C. elegans |
f27e5.8(yum2341) t10g3.4(yum2342) t10g3.2(yum2343) y57g11c.46(yum2344) y57g11c.28(yum2345) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| DA1917 |
Escherichia coli |
E. coli. Show Description
Bacteria. Contains eat-5 rescuing plasmid pRE5-7. Amp-R. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. Biosafety Level: BSL-1.
|
|
| DM7186 |
C. elegans |
pha-1(e2123) III; raEx186. Show Description
raEx186 [T05G5.1p::M01E5.4(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7188 |
C. elegans |
pha-1(e2123) III; raEx188. Show Description
raEx188 [T05G5.1p::R07E5.7(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| ERC82 |
C. elegans |
ieSi57 II; ers54[dpy-27::degron::GFP] III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron::GFP tag inserted into the endogenous dpy-27 locus. Dumpy, Him, X chromosome dosage compensation hypomorph. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
|
|
| ERC83 |
C. elegans |
ieSi57 ers55[top-2::degron::GFP] II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into the endogenous top-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
|
|
| ERC84 |
C. elegans |
top-1(ers56[top-1::degron::GFP]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted at the end of exon five in the endogenous top-1 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
|
|
| FG981 |
C. elegans |
unc-7(e5) X. Show Description
Derived by out-crossing parental strain CB5.
|
|
| GJ3452 |
C. elegans |
gcy-22(gj1976[gcy-22::GFP]) V. Show Description
GFP tag inserted into endogenous gcy-22 locus. GCY-22::GFP expression in the ASER neuron localized at cilium tip and PCMC. Reference: van der Burght SN, et al. Curr Biol. 2020 Nov 2;30(21):4299-4306.e5. PMID: 32916106
|
|
| HBR764 |
C. elegans |
C10C6.7(goe5) IV. Show Description
goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.
|
|
| JK5556 |
C. elegans |
F17E5.2(q864) X. Show Description
350 bp deletion in F17E5.2
|
|
| JW101 |
C. elegans |
unc-73(e936) I; sup-39(je5) II. Show Description
WT movement. Various degrees of embryonic lethality and Egl. About 1% Roll after L4.
|
|
| JW102 |
C. elegans |
sup-39(je5) II. Show Description
je5 is a dominant suppressor of unc-73(e936). WT movement. Various degrees of embryonic lethality and Egl. About 1% Roller after L4.
|
|
| JW104 |
C. elegans |
dpy-10(e128) sup-39(je5) unc-4(e120) II. Show Description
Dpy Unc-4 phenotype. Sick.
|
|
| JW105 |
C. elegans |
dpy-10(e128) sup-39(je5) unc-4(e120)/unc-104(e1265) II. Show Description
Heterozygotes are WT and segregate WT, Dpy Unc-4, and Unc-104s.
|
|
| JW106 |
C. elegans |
sup-39(je5) II; syr-1(je11) ?. Show Description
Synthetic Roller after L4 stage (85% penetrance). je5 is dominant and je11 is recessive. See 1996 East Coast Worm Meeting Abstract #80.
|
|
| MBA281 |
C. elegans |
icbIs4 II. Show Description
icbIs4 [chil-27p::GFP + col-12p::mCherry] II. Reference: Osman GA, et al. Curr Biol. 2018 Feb 19;28(4):640-648.e5.
|
|
| MC805 |
C. elegans |
tars-1(gc52) II. Show Description
gc52 mutants are hypoxia-resistant and have a reduced translation rate. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|
| MC814 |
C. elegans |
rtcb-1(gc50) I. Show Description
gc50 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|
| MC817 |
C. elegans |
ddx-52(gc51) I. Show Description
Temperature-sensitive: can be maintained at 20C, larval arrest (L3) at 25C. gc51 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|
| MC818 |
C. elegans |
xpo-3(gc59) IV. Show Description
gc59 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|
| MC894 |
C. elegans |
ulp-4(gc54) II. Show Description
Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|
| MC895 |
C. elegans |
ulp-4(gc55) II. Show Description
Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|
| MC896 |
C. elegans |
nol-10(gc58) IV. Show Description
Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|
| MC907 |
C. elegans |
aatf-1(gc63 gc64) I. Show Description
Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). gc63 gc64 occurred in the same mutagenesis; unclear which allele (or if both) is causing the gain of function. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
|
|
| PHX3191 |
C. elegans |
nlp-58(syb3191 [nlp-58::T2A::3xNLS::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-58 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX3241 |
C. elegans |
flp-20 (syb3241 [flp-20::T2A::3xNLS::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX4049 |
C. elegans |
flp-20(syb4049[flp-20::SL2::GFP::H2B]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX4433 |
C. elegans |
npr-32 (syb4433 [npr-32::SL2::GFP::H2B] IV. Show Description
GFP tag inserted at the C-terminus of the endogenous npr-32 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX4442 |
C. elegans |
dmsr-6 (syb4442 [dmsr-6::SL2::GFP::H2B]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous dmsr-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX4517 |
C. elegans |
nmur-2(syb4517 [nmur-2::SL2::GFP::H2B)] II. Show Description
GFP tag inserted at the C-terminus of the endogenous nmur-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX4523 |
C. elegans |
frpr-19(syb4523[frpr19::SL2::GFP::H2B]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous frpr-19 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX4595 |
C. elegans |
tkr-1 (syb4595 [tkr-1::SL2::GFP::H2B]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous tkr-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX5536 |
C. elegans |
ins-9(syb5536[ins-9::SL2::gfp::H2B]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous ins-9 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PS7731 |
C. elegans |
K03E5.2(sy1082) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT;
right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG
Reference: Wang H, et al. G3 (Bethesda).
|
|
| PS7783 |
C. elegans |
K03E5.2(sy1086) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG
Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8207 |
C. elegans |
F44E5.3(sy1224) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F44E5.3;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GTTAGAAAGACTATATGCCATAGTAGAAGATCCGCTC.
Right flanking sequence: AGTGAGTTCGTTGCAGGCGGACTACGTTgtaagtttg
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CCTGCAACGAACTCACTGAG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|