R07E5.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2953 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGATTCGACGACAGATGACGAATGGACGG. Right flanking sequence: CACGGATTCAGGTCGAACACATTTTTAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1281 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTTTTTATTCACACGGTATATTGGGAGCAT. Right flanking sequence: TCTTTCAACACATAAACCTCTAGAAGGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGTGTTTTACCATCAGATCAGTTGGCGTG ; Right flanking sequence: GATGGAATATGCTGCCTTCCAAGTTCATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5294 mutation is C->T, flanking sequences CAGAAAAGTACAAATTTGCCTGGATTTTGC and TGAAAATTTTTATCAAAAAACCGGCAAATT. The gk5295 mutation is G->A, flanking sequences GATTAAATCTGATTAGATGAAGCTCAAATC and ATCGAAGTTGTAGAGATACTCCATTGGCAT.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5296 mutation is G->A, flanking sequences ATAGAGGGGTACGCGGGAGTTGCCAATCTG and TAAGTATACTGAAAACCCTAGTTTTCGAGG.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5297 mutation is C->T, flanking sequences TTGTACGACGAGTCATGCTGTGTTGGAGCC and GAGGTCGTGATGTCTATCTAAATTTCGGTC.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5298 mutation is G->A, flanking sequences ATAATTTTAAGGAAAAAATTAAATTTTTCA and AAACTTTTCCGTCACGGAATCGCTAGCTCC.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5299 mutation is G->A, flanking sequences AAAAGTCATATAATGACATATGTAAACCCG and TGAGTGACGGATTGAATGAAGTCCATTATC.