Heterozygotes are WT and segregate more WT, paralyzed Unc, and DpyUncLet (DpyUnc Larvae are abnormal). Maintain by picking WT.

cdIs85 [pcc1::2xFYVE::GFP + myo-2p::GFP + unc-119(+)]. Ballistic transformation. 2xFYVE(Hrs)::GFP expressed in front coelomocyte promoter.

otIs85 [F59B2.13::GFP + rol-6(su1006)]. Rollers. Not constipated.

oyIs85 [ceh-36p::TU#813 + ceh-36p::TU#814 + srtx-1p::GFP + unc-122p::DsRed]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the ceh-36 promoter. AWC ablated in this strain. Defective thermotaxis. Expression of dsRed in coelomocytes. GFP expression in AFD. Reference: Beverly M, Anbil S, Sengupta P. J Neurosci. 2011 Aug 10;31(32):11718-27.

sraIs49 contains [nmr-1p::G-CaMP + unc-119(+)]. sraEx80 contains [sra-6p::chop-2(H134R)::mCherry + osm-10p::G-CaMP + unc-122p::mCherry]. Superficially wild-type. Maintain by picking red fluorescent worms.

arTi145 [ckb-3p::mCherry::his-58::unc-54 3'UTR] II. miniMos insertion with bright expression due to perdurance mediated by the histone; expressed in all cells from Z1/Z4 until somatic gonad blast cells divide, so labels the entire somatic gonad primordium in continuous L2 or dauer larvae. Reference: Attner et al., 2019, Current Biology 29, 1-7.

otIs854 [unc-39p::tagRFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.

syIs632 [15xUAS::myri::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Cell membrane labeling fluorophore cGAL effector.

syIs635 [15xUAS::hChR2(C128s, D156A)::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Stabilized step function Opsins ChR2 variant cGAL effector.

syIs636 [15xUAS::miniSOG-103L::VAMP2::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Reactive oxygen species production cGAL effector.

syIs639 [15xUAS::SwiChR::TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Step-Waveform Inhibitory Channelrhodopsin cGAL effector.

syIs640 [15xUAS::fem-3::mCherry::let-858 3'UTR + ttx-3p:RFP + 1kb DNA ladder (NEB)] cGAL effector to induce masculinization

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-56; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTTTACTATTTCACTTGAACCCTAACCTATT Right flanking sequence: TGTTAATGGATTTCTCGGTGTTGATATgtaagccc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctag. sgRNA : CGAGAAATCCATTAACAAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-57; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGATATCATTTGCATTCAATTTTATTCTTCCATCT Right flanking sequence: AAAGTCTCTTTTAACAGTTTGCTTGCAAGAATATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTTAAAAGAGACTTTAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-58. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGATCTCATTCACATTCTATTCAATTCTCCCACT right flanking sequence: TGAAGTGGCTTTTAACAGTTTATTTGCAAGAATATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTAAAAGCCACTTCAAGT Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatttaataatttaggcATGGTAGTTTACACCGCT right flanking sequence: CTGTGGAACATTGAAGATCAAAATAAGCAATTTAAAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGTAGTTTACACCGCTCTG Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-35. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTTCTAATGTGCATGTTGCTCAAGCGTGCCGAGA right flanking sequence: CCCACCCATTTTTCACGTTGTTATGCACATTTTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGTGAAAAATGGGTGGGTCT Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-17. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTAATTGATGGTACGCCTGTATATTGGCCAGCT right flanking sequence: GCTTGGAACGAGACTCAGCCTGCTCCTCAGCTGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAGTCTCGTTCCAAGCAGC Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of acs-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTCTGGACTCATGTCGTATCCATGCAGCCGCCA right flanking sequence: ATAAGGACGCCATAGTTTTTgtgagtacggatttatc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTATGGCGTCCTTATTGG Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-87. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTTTTGCCTTCTCGTTGCTTTCATCCTTCCTGGG right flanking sequence: CTATTCCTCGTTCATGCAGCTCCGACTTCTTCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCATGAACGAGGAATAGCCC Method Reference: G3 (Bethesda).

syIs654 [15xUAS:VSFP-Butterfly-1-2::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Voltage-sensitive fluorescent protein cGAL effector.

syIs657 [15xUAS::act-2::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. cGAL effector for localiziation of actin filament and cell cortex

syIs659 [15xUAS::miniSOG-103L::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Reactive oxygen species production cGAL effector.

syIs663 [gcy-33p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for BAG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

syIs666 [str-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWB neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: TTGGTATGTGCAGTTACTAACGATATTGAAGACGC right flanking sequence: TAGTGGAGAGACACCTGGAATTGTTTCTCAAATTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGATATTGAAGACGCTAG Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-36. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATGTGCATGTTGCTCAAGCGTGCCGAGACCAAGC right flanking sequence: CATTTTTCACAGTGGTATGCACATTTTACACGAGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCACTGTGAAAAATGGCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-41. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATTTTAATATTAGTACACGTTTTTCTACCGGAT right flanking sequence: TTCCTGTGGCAAAATAATAATAGATACTCTTTCGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTATTTTGCCACAGGAAATC Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-91. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGACCTACATCCTTATCATCGTCCCACTGATCAT right flanking sequence: CATTGGAGGCGGTGTCGTCGCTGACAACACAAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCGTCCCACTGATCATCAT Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-9. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCATCATTGCCTCTTCAGTAAATACACGTTCACC right flanking sequence: CATAGgtgtataattgaacttatgtatatgttttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAAATACACGTTCACCCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs852 [C50F7.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.

wyIs853 [ser-2(prom3)::mCherry::rab-7 + odr-1p::GFP] V. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. GFP tag inserted into endogenous dma-1 locus after DMA-1 transmembrane domain and before cytoplasmic tail. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.