Search Strains

tmIs1240 [myo-2p::Venus, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::Venus. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::Venus. Egl. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Dpy. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: egl-17 X. Covered region (Mb) (0.5) Balancer marked with myo-2p::Venus. Egl. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

pgEx116 [unc-70::TSmod + myo3p::mCherry]. Pick animals with red fluorescence in body wall muscle to maintain array. The tension sensor module (TSMod) was inserted into the coding sequence of unc-70. TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, which acts as an entropic nanospring suitable for estimating biologically relevant forces. Reference: Krieg M, et al. Nat Cell Biol. 2014 Mar;16(3):224-33.

pgIs22 [unc-70::N-TSmod]. oxIs95 [pdi-2p::unc-70 + myo-2p::GFP]. The tension sensor module control (N-TSMod) was inserted at the N-terminus of unc-70. N-TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, but is placed at the N-terminus of UNC-70 where it is not sensitive to force. pgIs22 was a spontaneous insertion of pgEx157. Reference: Kelley M, et al. Elife. 2015 Mar 23;4.

Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.

osEx225 [scm::dsh-2::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99.

osEx233 [scm::mig-5::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99.

osIs5 [scm::wrm-1::Venus + unc-76(+)]. WRM-1::GFP localizes to the anterior cortex in the seam cells prior to or during cell division, and to the posterior daughter's nucleus after cell division.

osEx397 [cwn-1p::cwn-1::Venus + unc-76(+)]. Pick nonUnc to maintain. Transgene is expressed in tail region. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.

osEx393 [cwn-2p::cwn-2::Venus + unc-76(+)]. Pick nonUnc to maintain. Transgene is expressed in the pharynx. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.

njIs9 [glr-3p::snb-1::venus + ofm-1::GFP] IV.

kyIs140 [str-2::GFP + lin-15(+)] I. vyEx1462 (die-1(fosmid)::Venus + odr-1::DsRed + ofm-1::DsRed). Pick animals with DsRed+ coelomocytes to maintain. Animals with vyEx1462 show 2AWC(OFF) phenotype. Extrachromosomal array rescues die-1(w34).

qIs89 [gon-14::gon-14::VENUS + S. cerevisiae DNA]. gon-14::VENUS is broadly expressed in cell nuclei starting at the 50-100 cell stage of embryogenesis and throughout larval development. Partially concentrated in nuclear speckles. qIs89 rescues the 25C Gon and Ste defects of q686. Low penetrance of sterility and lethality in the strain. Do not distribute this strain; other labs should request it from the CGC.

qIs90 [ceh-22b::VENUS (pJK1082) + influenza viral DNA]. qIs90 is an integrated complex array; integration site not mapped. ceh-22b::VENUS can be easily identified by its expression in the pharynx. Do not distribute this strain; other labs should request it directly from the CGC.

qIs95 [(sys-1p::Venus::sys-1 + pttx-3::DsRed]. The DsRed marker is very dim and might be difficult to see it under the dissecting scope. Do not distribute this strain; other labs should request it directly from the CGC.

peIs1095 [gcy-7p::ChR2Y2::Venus + unc-122::mCherry]. ChR2Y2 expression in ASEL. Reference: Wang L, et al. J Neurosci, 2017. 37(8): p. 2097-2111. PMID: 28126744

peIs578 [npr-9p::casp1 + npr-9p::Venus + unc-122p::mCherry]. AIB neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.

peIs579 [ttx-3p::casp1 + ttx-3p::Venus + lin-44p::GFP]. AIY neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.

peIs580 [ins-1p(short)::casp1 + ins-1p(short)::Venus + unc-122p::GFP]. AIA neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.

ceIs56 [unc-129p::ctns-1::mCherry + nlp-21p::Venus + ttx-3p::RFP]; Maps to X: 9.0 +/ 3.0 m.u. Expresses the lysosomal membrane marker CTNS-1 in a subset of 9 DA/DB cholinergic motor neurons in the ventral cord, and NLP-21::Venus in the same neurons as a marker for soluble DCV cargo and to help identify the boundaries of the somas and axons when imaging lysosomes. Reference: Edwards SL, et al. Genetics. 2015 Sep;201(1):91-116. Edwards SL, et al. Genetics. 2015 Sep;201(1):117-41.

ceIs201 [unc-17p::ins-22::Venus + unc-17p::RFP + unc-17p::ssmCherry + myo-2p::RFP]; integration site maps to I:0.77. Expresses INS-22::Venus to mark Dense Core Vesicles in the cholinergic nervous system, including the ventral cord cholinergic motor neurons. Also expresses mCherry in the same neurons to help identify the boundaries of the somas, axons, and dendrites. ssmCherry is mCherry with a secretion signal on its N-terminus, which is constitutively secreted and taken up by coelomoctyes in the pseuodcoelomic space, making it a useful marker for those coelomocytes. The INS-22::Venus also gets secreted by DCVs and taken up by coelomocytes. The myo-2::RFP is a co-tranformation marker that lights up the pharyngeal muscle cells and is useful for crossing the integrant into various mutant backgrounds. Reference: Hoover CM, et al. Genetics. 2014 Mar;196(3):745-65.

ceIs259 [unc-129p::RFP::syn-13 + unc-129p::Venus + ttx-3p::RFP]; Inserted at center of LG IV. Expresses RFP::SYN-13 to mark early endosomes in a set of 9 DA/DB cholinergic motor neurons in the ventral nerve cord. unc-129::Venus fills the neuron and thus is useful for identifying regions and can also be used as a control for effects on expression of the transgene. Reference: Edwards SL, et al. Genetics. 2015 Sep;201(1):91-116. Edwards SL, et al. (manuscript in revision). "Sentryn Acts with a Subset of Active Zone Proteins in the Guided Transport and Capture of Synaptic Vesicles in Caenorhabditis elegans."

ceIs269 [unc-129p::tomm-20::Venus + unc-129p::mCherry + ttx-3p::RFP]; Integration in Chromosome I (near genetic position -3.20 or 1.14). The ttx-3 marker is quite faint in this strain especially in larvae. The tomm-20::Venus construct was injected at 0.5 ng/ ul in the strain used to make this integrant, so virtually all of the visible tomm-20::Venus signal s associated with mitochondria with essentially no background. The unc-129p::mCherry marker is expressed at a very low level that are detectable only with a sensitive camera (and often not by eye at 1000X). In strains lacking mitochondria in the dorsal cord, use the camera to focus on the mCherry in the dorsal cord, then acquire in the YFP channel.

nuIs183 [unc-129p::nlp-21::Venus + myo-2p::GFP]. [NOTE: nuIs183 was previously described as carrying myo-2p::NLS::GFP.] Reference: Sieburth D, et al. Nat Neurosci. 2007 Jan;10(1):49-57.

nuIs190 [unc-129p::ins-22::Venus + myo-2p::NLS::GFP] X. Pick GFP+ to maintain. Not all animals express GFP. Array might be prone to silencing or not homozygous. [NOTE: nuIs190 was previously described as carrying myo-2p::GFP without an NLS.] Reference: Ch'ng Q, Sieburth D, Kaplan JM. PLoS Genet. 2008 Nov;4(11):e1000283.

juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.

juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.

qyEx78 [Venus::unc-6(deltaSP) + unc-119(+)]. Maintain by picking non-Unc.

jsIs1072 [vha-6p::aex-5::Venus + Cbr-unc-119(+)]. Wild type strain that expresses AEX-5::VENUS fusion in intestine under the control of the vha-6 promoter. AEX-5::VENUS is secreted and also detectable in the coelomocytes. Created by ballistic transformation. Plasmid sequence and description of the transgene found in PMID 18852466.

evIs190 [vab-1p::Venus + rol-6(su1006)]. Rollers. Reference: Ikegami et al. Curr Biol. 2012 Jan 10;22(1):1-11.

otEx3091[ref-2::ven + rol-6(su1006)]. ot327 is larval lethal. otEx3091 carries a ref-2::venus translational fusion and rescues the lethality.

otIs274 [FOSMID::die-1::2xFLAG::VENUS]. 2 ASER.

Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus cc2557 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc2557 is an engineered mutation creating an early stop (T8*). Presumptive rps-10 null. Heterozygous rps-10(cc2557)/tmC20 animals are delayed in development. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.

Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by myo-2p::Venus-marked inversion. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus rps-23(cc5994) homozygotes (L1 arrest). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc5994 is an engineered mutation creating an early stop (A67*). Presumptive rps-23 null. Heterozygous rps-23(cc5994)/tmC5 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.

syIs615 [15xUAS::lmp-1::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Lysosomal associated membrane protein cGAL effector.

syIs657 [15xUAS::act-2::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. cGAL effector for localiziation of actin filament and cell cortex

rdIs4 [ehn-3a::Venus + unc-119(+)] X. Expresses Venus (YFP) in Z1/Z4 beginning in embryogenesis and continuing through the L1 larval stage. Reference: Large EE and Mathies LD. G3 (Bethesda). 2014 Mar 20;4(3):471-83.

tmIs1245 Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Larval arrest. Deletion of 879 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ Venus+, and segregate wild-type GFP+Venus+, GFP+ arrested early larvae (ve979 homozygotes), and Venus+ dpy-9 (dpy-9(tm9713) kvs-5(tmIs1245) homozygotes). Pick WT bright GFP and check for correct segregation of progeny to maintain. [NOTE: ve979 deletion also removes K11H12.12 and K11H12.13, each of which encodes a snoRNA.] Left flanking Sequence: GAAAACTTTGGTGTTCTTTCTCTTCCAGTT; Right flanking sequence: TGGACGGCGCTCAACTGTCTGTAGTGCCAG. rpl-15 crRNA A: CTTGGCTTGGGATCCTCCGC; rpl-15 crRNA B: TGGTTGGGCGTGGGACACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

tmIs1245 Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Larval arrest. Deletion of 402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ Venus+, and segregate wild-type GFP+Venus+, GFP+ arrested larvae (ve991 homozygotes),Venus+ dpy-9 (dpy-9(tm9713) kvs-5(tmIs1245) homozygotes). Pick WT bright GFP and check for correct segregation of progeny to maintain . Left flanking Sequence: aattttaaaactacaattcaaatttatttt; Right flanking sequence: AGACTCGTTCGCgtaagttacttttctgaa. rps-24 crRNA A: gcaggtaatattcatcacgA; rps-24 crRNA B: GTACTTCGGCTCAAACTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

heIs9 [myo-3p::cyd-1 + myo-3p::cdk-4::Venus + myo-3p::GFP::H2B] IV. Expression of CYD-1, CDK-4::VENUS, and GFP::H2B in body wall muscles (BWM). Over-expression of tagged CYD-1 and tagged CDK-4 from integrated transgene causes incidental extra BWM nuclei. Expression levels are higher that those from heIs12 in SV860. Reference: Korzelius J, et al. PLoS Genet. 2011 Nov;7(11):e1002362. PMID: 22102824

heIs12 [myo-3p::cyd-1 + myo-3p::cdk-4::Venus + myo-3p::GFP::H2B]. Expression of CYD-1, CDK-4::VENUS, and GFP::H2B in body wall muscles (BWM). Over-expression of tagged CYD-1 and tagged CDK-4 from integrated transgene causes incidental extra BWM nuclei. Expression levels are lower that those from heIs9 in SV857. Reference: Korzelius J, et al. PLoS Genet. 2011 Nov;7(11):e1002362. PMID: 22102824

rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658

Must be maintained at >20 degrees; grows better at 25C. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658

Homozygous lethal rab-5 [Q78R] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78R] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent KpnI site added in Q78R for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658

rab-5 [Q78Q]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78Q] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn15 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [Q78Q] homozygotes from taking over the population and losing the balancer! Silent KpnI site added in Q78Q allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658

Homozygous lethal rab-5 [A29P] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29P] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent DdeI site added in A29P for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658

rab-5 [A29A]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29A] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn47 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [A29A] homozygotes from taking over the population and losing the balancer! Silent DdeI site added in A29A allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658

vbaIs56 [eef-1A.1p::VenusN::nrde-3] I. vbaIs55 [eef-1A.1p::VenusC::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. N-terminal and C-terminal fragments of the fluorescent protein Venus are fused to NRDE-3 to facilitate trimolecular fluorescence complementation. In the cytoplasm or nucleus, local concentration of NRDE-3 molecules does not allow fluorescence complementation, thus reducing background fluorescence; once bound on the target transcript, VenusN::NRDE-3 and VenusC::NRDE-3 are in sufficient proximity to allow for fluorescence complementation, labeling transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.