Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PHX3193 C. elegans flp-18(syb3193[flp-18::T2A::3×NLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3195 C elegans flp-33(syb3195[flp-33::T2A::3xNLS::GFP]) I. Show Description
GFP tag inserted into endogenous flp-33 locus using CRISPR/Cas9 engineering. GFP expression in ADE (in head). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
PHX3203 C. elegans flp-6 (syb3203 [flp-6::T2A::3XNLS::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3208 C. elegans nlp-40(syb3208 [nlp-40::T2A::3XNLS::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-40 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3212 C. elegans flp-21(syb3212 [flp-21::T2A::3×NLS::GFP]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3222 C. elegans nlp-17(syb3222[nlp-17::T2A::3×NLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3225 C elegans jkk-1(syb3225) X. Show Description
Putative jkk-1 gain-of-function allele. Reference: Busack I & Bringmann H. (2023). JKK-1(3E), a JKK-1 mutant with predicted phosphomimetic amino acid substitutions. microPublication Biology. 10.17912/micropub.biology.000785.
PHX3229 C. elegans flp-9(syb3229[flp-9::T2A::3xNLS::GFP]) IV. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
PHX3230 C. elegans flp-15(syb3230[flp-15::T2A::3xNLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3238 C. elegans nlp-42(syb3238[nlp-42::T2A::3XNLS::GFP]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3240 C. elegans nlp-1(syb3240[nlp-1::T2A::3XNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3241 C. elegans flp-20 (syb3241 [flp-20::T2A::3xNLS::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX3242 C. elegans flp-23(syb3242[flp-23::T2A::3xNLS::GFP]) III. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
PHX3250 C. elegans capa-1(syb3250[capa-1::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3251 C. elegans flp-16(syb3251[flp-16::T2A::3XNLS::GFP]) II. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3252 C. elegans unc-10(syb2898 syb3252[unc-10::T2A::3xNLS::GFP]) X. Show Description
T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous unc-10 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX3257 C. elegans flp-34(syb3257[flp-34::T2A::3xNLS::GFP]) V. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3262 C. elegans nlp-47(syb3262[nlp-47::T2A::3XNLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3275 C. elegans pdf-2(syb3275[pdf-2::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. pdf-2 also known as nlp-37. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3277 C. elegans flp-13 (syb3277 [flp-13::T2A::3XNLS::GFP]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-13 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3278 C. elegans flp-19(syb3278 [flp-19::T2A::3xNLS::GFP]) X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
PHX3285 C. elegans nlp-54(syb3285 [nlp-54::T2A::3xNLS::GFP]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-54 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3288 C. elegans nlp-23(syb3288[nlp-23::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3301 C. elegans flp-22(syb3301[flp-22::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3306 C. elegans nlp-62(syb3306[nlp-62::T2A::3XNLS::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-62 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3311 C. elegans casy-1(syb3311[casy-1::gfp11x7]) II. Show Description
syb3311 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous casy-1 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Split-GFP tag inserted into endogenous casy-1 locus using CRISPR/Cas9 with two guide RNAs simultaneously. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
PHX3317 C. elegans flp-11b(syb3317[flp-11b::T2A::3XNLS::GFP]) X Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
PHX3319 C. elegans nlp-22(syb3319[nlp-22::T2A::3×NLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3320 C. elegans nlp-49(syb3320[nlp-49::T2A::3XNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX3321 C. elegans ntc-1(syb3321[ntc-1::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3330 C. elegans pdf-1(syb3330[pdf-1::T2A::3xNLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3334 C. elegans flp-24(syb3334[flp-24::T2A::3×NLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3372 C. elegans rgba-1(syb3372[rgba-1::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3373 C. elegans nlp-70(syb3373[nlp-70::T2A::3xNLS::GFP]) V. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3384 C. elegans nlp-64(syb3384[nlp-64::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3388 C. elegans nlp-38(syb3388[nlp-38::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3426 C. elegans ceh-27(syb2714[loxP] syb3286[loxP] syb3426[ceh27::GFP]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3432 C. elegans eif-2D(syb3432[(delta)SUI1 domain +3xFLAG]) II. Show Description
Endogenous eif-2D locus tagged with 3xFLAG. The SUI1 domain of the endogenous EIF-2D locus has been deleted and replaced with 3xFLAG via CRISPR/Cas9 gene editing. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
PHX3436 C. elegans flp-4(syb3436[flp-4::T2A::3XNLS::GFP]) II. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3596 C. elegans tph-1(mg280) pah-1(syb3596) II. Show Description
Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX3601 C elegans pah-1(syb3601) II. Show Description
Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX3634 C elegans pah-1(syb3634[GFP::H2B::T2A::pah-1]) II. Show Description
Superficially wild-type. GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
PHX3678 C elegans tph-1(mg280) pah-1(syb3678[GFP::H2B::T2A::pah-1]) II. Show Description
GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
PHX3936 C. elegans nlp-51(syb3936[nlp-51::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
PHX4049 C. elegans flp-20(syb4049[flp-20::SL2::GFP::H2B]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX4373 C. elegans nova-1(syb4373[nova-1::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous nova-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX4374 C. elegans flp-32(syb4374[flp-32::SL2::gfp::H2B]) X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
PHX4376 C. elegans rbm-25(syb4376[rbm-25::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous rbm-25 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX4399 C. elegans nlp-82(syb4399[nlp-82::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-82 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX4406 C. elegans nlp-73(syb4406 [nlp-73::SL2::GFP::H2B]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-73 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095