Search Strains

nicTi605 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi612]] III. Broad, nuclear red fluorescence. Unc. Maintain at 20C, somewhat sick at 25C. Unc. nicTi605 is a modified version of oxTi612 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi606 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi391]] IV. Maintain at 20C, somewhat sick at 25C. Unc. nicTiX606 is a modified version of oxTi391 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

qyIs366 [ser-2(prom3)::hpo-30::GFP + unc-119(+)] V. Reporter allows visualization of HPO-30 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.

qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. qyIs550 [zmp-1p::MLS::GFP + unc-119(+)]. Superficially wild-type animals expressing mitochondrial GFP and red F-actin in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. Utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. qyIs10 [lam-1p::lam-1::GFP + unc-119(+)] IV. fdgt-1 formerly known as fgt-1. Reference: Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. fdgt-1(tm3165) null mutant expressing an anchor cell specific F-actin marker. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. qyIs550 [zmp-1p::MLS::GFP + unc-119(+)]. fdgt-1 glucose transporter null mutants (tm3165) expressing anchor cell specific mitochondrial matrix localized GFP and F-actin mCherry. Useful for analyzing mitochondrial localization, morphology and dynamics in the absence of glucose import. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

CRISPR/Cas9 insertion of mNeonGreen into the endogenous unc-52 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

CRISPR/Cas9 insertion of mNeonGreen into the endogenous fbl-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

CRISPR/Cas9 insertion of mNeonGreen into the endogenous him-4 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

CRISPR/Cas9 insertion of mRuby2G into the endogenous emb-9 locus (internal tag) in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.

qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. RNAi sensitized strain with utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.

mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.

qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. Superficially wild type animal expressing a single copy insertion of glucose transporter fdgt-2 in the anchor cell. fdgt-2 formerly known as fgt-2. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.

qyIs555 [cdh-3p::aman-2::GFP]. Anchor cell specific expression of golgi protein aman-2. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.

qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. fdgt-1 glucose transporter null mutant expressing a single copy insertion of the glucose transporter fgt-2 in the anchor cell. fdgt-1 and fdgt-2 formerly known as fgt-1 and fgt-2, respectively. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3' UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3' UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus. L4-specific expression of ZIF-1, ubiquitous GFPbeta1-10 and endogenous rpl-31 tagged with ZF-1+GFP-beta11

CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

qySi229 [cdh-3p::lmp-1::mNG] I. MosSCI single copy insertion. Anchor cell specific expression of lysosomal protein lmp-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.

ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557.

pkIs1600 [dpy-30::GFP(truncated) + rol-6(su1006)] I. ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Rollers.

Suppresses unc-64(e246).

jsTi1492 [LoxP::mex-5p::FLP::SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] II. jsTi1492 is prone to silencing; pick animals with GFP+ germlines to maintain. jsTi1492 is an RMCE landing site inserted using miniMos located on Chr II at at 3,160,571 (WB273 genome; -8.14 m.u.) inserted in a repeat region between sri-34 and fbxc-55. Insertsion site ttttttgcaaaaaagtgcagtcataTAtgtatgtaaaaaattaattgaagac with rpl-28 transcription toward sri-34. Insertion site is ambiguous but likely near the edge of sri-34 side of the repeat region. Reference: Nonet ML. Genetics. 2020.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Gee, K et al. (2017) G3 7: 991.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D) + myo-2p::GFP + unc-119(+)]. A diphtheria toxin A fragment DT-A (E148D) is expressed under a coelomocyte-specific promoter leading to the absence of coelomocytes. Worms are slightly uncoordinated, slightly dumpy and slow growing. References: Fares H & Greenwald I. Genetics. 2001 Sep;159(1):133-45. doi: 10.1093/genetics/159.1.133. PMID: 11560892. Schwartz MS, et al. PLoS One. 2010 Mar 5;5(3):e9564. doi: 10.1371/journal.pone.0009564. PMID: 20221439.

qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. When cultivated at 20 degrees, all animals have red nervous systems. Following heat shock, animals are immobile, do not feed, and show green fluorescence in somatic cells. Reference: Nelson MD, et al. Curr Biol. 2014 Oct 20;24(20):2406-10.

qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. Pumps and moves 2 hours after heat induced flp-13 over-expression. Outcrossed 1x to NQ570. Reference: Iannacone M, et al. eLife 2017.

ltIs104 [(pAA277) pie-1p::GFP::LAP::vps-37 + unc-119(+)].

CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

ltSi912 [myo-3p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Muscle-specific expression of anti-GFP nanobody fused to ZIF-1 mediates body wall muscle-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine body wall muscle-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.

Analog-sensitive allele generated by CRISPR/Cas9 engineering of the endogenous plk-1 locus. Engineered mutations confer sensitivity to 1-NM-PP1 for drug inhibition of plk-1. gRNA sequences: GGACGATTTTTGGGCAAGGG & TCTCAACGTGTATATCACTT Reference: Gomez-Cavazos JS, et al. Curr Biol. 2020 Aug 17;30(16):3101-3115.e11. doi: 10.1016/j.cub.2020.05.090 PMID: 32619481.

mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

oqEx500 [tmem-107::GFP + unc-122p::DsRed]. Pick DsRed+ animals to maintain. TMEM-107::GFP accumulates in the ciliary transition zones of ciliated neurons. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31.

F39B2.9/TMEM-107 has been shown to control the localization of 4 peripheral ciliary transition zone proteins. tmem-107(oq100); nphp-4(tm925) double mutants display ultra-structural malformations in ciliary transition zones, and exhibit sensory abnormalities including roaming, chemoattractant, and dye-filling defects. TRAM-1::tdTomato leaks into cilia in oq100 mutants. Genotyping primers: Forward cgcggttcttcttgtttctt, Reverse wildtype gagatcgagacggcgacg, Reverse oq100 gaaaaacaacgtggaagtcca. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx471 [myo-3p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Muscle-specific expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx472 [rab-3p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Neuronal expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

otIs314 [rab-3p(prom1)::2xNLS::TagRFP] III. otEx4560 tbb-5(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx4560. Broad neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx4553 [unc-64A(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx5924. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

otIs314 [rab-3p(prom1)::2xNLS::TagRFP] III. otEx4681 [snn-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx4681. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. Pan-neuronal nuclear RFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. Pan-neuronal nuclear RFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

otEx4539 [unc-3p(SL2 fosmid)::mCherry + myo-2::GFP]. Fosmid-based reporter. Maintain by picking GFP(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.

otIs264 [ceh-36p::tagRFP] III. ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. Maintain at 15-20C. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.

otIs379 [cho-1(-3006/-2642)::GFP + rol-6(su1006)]. otIs317 [mgl-1::mCherry + pha-1(+)]. otIs379 appears to be linked to otIs317. Rollers.

otEx5012 [lsy-6p::YFP::unc-54 3'UTR + ttx-3p::mCherry + pha-1(+)]. Maintain at 25C; pick mCherry(+).

otEx5014 [lsy-6p::YFP::lsy-6 3' sequence + ttx-3p::mCherry + pha-1(+)]. Maintain at 25C; pick mCherry(+).