More Fields
Strain Species Genotype
AMH36 C. elegans juIs76 II; daf-2(e1370) III; unc-33(mn407) IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Maintain at 15C. Synthetic Lethality at 25C.
AMH46 C. elegans juIs76 II; daf-2(e1370) III; unc-33(e1193) IV. Show Description
Maintain at 15C. Synthetic Lethality at 25C. Unc; almost paralyzed. Growth slow.
AMH67 C. elegans unc-33(e204) IV; daf-2(e1370) III. Show Description
Maintain at 15C. Synthetic Lethality at 25C.
AMH69 C. elegans unc-33(mn407) IV; daf-2(e1370) III. Show Description
Maintain at 15C. Synthetic Lethality at 25C.
AMH71 C. elegans unc-33(e1193) IV; daf-2(e1370) III. Show Description
Maintain at 15C. Synthetic Lethality at 25C.
CB502 C. elegans sma-2(e502) III. Show Description
Small. Recessive. Male spicules abnormal. M-MATING-NO SUCCESS. Synthetic lethal common.
DLM16 C. elegans ubc-18(tm5426) sup-35(e2215) pha-1(e2123) III. Show Description
sup-35 rescues synthetic lethality of ubc-18 and pha-1.
DLM18 C. elegans ubc-18(tm5426) III; sup-36(e2217) IV. Show Description
sup-36 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.
DLM19 C. elegans ubc-18(tm5426) III; sup-37(e2215) V. Show Description
DLM 19: sup-37 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.
IC361 C. elegans vab-1(e2)/mIn1 [dpy-10(e128) mIs14] II; sax-3(ky123) X. Show Description
Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. vab-1; sax-3 homozygotes are synthetic lethal.
JC1225 C. elegans mrp-1(ut153) X. Show Description
Synthetic Daf at 15C when in an unc-31(e169) background.
JC1970 C. elegans tbx-2(ut180) III. Show Description
Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.
JC1971 C. elegans tbx-2(ut192) III. Show Description
Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.
JH1270 C. elegans nos-1(gv5) II. Show Description
No visible phenotype except for reduced brood size. Synthetic sterile with nos-2(RNAi). 1176 bp deletion starting at aa 58 in nos-1 ORF and ending 414 bp past the end of the nos-1 ORF.
JIM220 C. elegans ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JM311 C. elegans lem-2(ca19) II. Show Description
Overall healthy but reduced brood size and pharyngeal pumping rate. Synthetic lethal with emr-1(-). ca19 is a Leu to Arg mutation at position 16 of LEM-2, reconstituting a mutation in the American Hutterite Population that causes juvenile cataracts and premature cardiomyopathy.
JW106 C. elegans sup-39(je5) II; syr-1(je11) ?. Show Description
Synthetic Roller after L4 stage (85% penetrance). je5 is dominant and je11 is recessive. See 1996 East Coast Worm Meeting Abstract #80.
LP316 C. elegans hmp-2(cp78[GFP::hmp-2a + LoxP]) III. Show Description
cp78[gfp::hmp-2 + LoxP] III. GFP inserted at the N terminus of endogenous hmp-2 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar in the second synthetic intron of GFP. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
MH1829 C. elegans fzr-1(ku298) unc-4(e120) II. Show Description
Animals are healthy and Unc. Synthetic lethal/hyperproliferation with lin-35.
MH2354 C. elegans swsn-1(ku355) V. Show Description
Synthetic lethal with lin-35(n745). Temperature sensitive.
MT111 C. elegans lin-8(n111) II. Show Description
WT phenotype. Synthetic Muv.
MT112 C. elegans lin-9(n112) III. Show Description
WT. Synthetic Muv with lin-8 or lin-38.
MT14761 C. elegans lin-53(n833) I. Show Description
Superficially wild-type. Synthetic Muv with lin-15A(n767).
MT1624 C. elegans lin-35(n745) I; lin-8(n111) II. Show Description
Double mutant is Muv. lin-35 alone is non-Muv. lin-35 is a class B synthetic Muv.
MT1628 C. elegans lin-9(n112) III; lin-15A(n749) X. Show Description
Synthetic Muv. n749 is lin-15 Class A allele.
MT1630 C. elegans lin-38(n751) II; lin-9(n112) III. Show Description
Double mutant is Multivulva. lin-38 alone is non-Muv. lin-38 is a class A synthetic Muv.
MT1806 C. elegans lin-15A(n767) X. Show Description
WT phenotype. Synthetic Muv.
MT6034 C. elegans lin-36(n766) III. Show Description
WT. Synthetic Muv with lin-8, lin-38 or lin-15(n767).
MT664 C. elegans lin-8(n111) II; lin-15B(n374) X. Show Description
Synthetic Muv.
MT8840 C. elegans dpy-5(e61) lin-53(n833) I. Show Description
Dpy. n833 is a synthetic Muv with lin-15A(n767).
MT8879 C. elegans dpl-1(n2994) II. Show Description
Synthetic Muv B.
MT990 C. elegans lin-9(n112) III; lin-15A(n433) X. Show Description
Synthetic Muv. n433 is lin-15 Class A allele.
NK2583 C. elegans unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
PS2366 C. elegans itr-1(sy328) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2368 C. elegans itr-1(sy327) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2512 C. elegans itr-1(sy331) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2516 C. elegans itr-1(sy291) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2582 C. elegans itr-1(sy290) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PX696 C. elegans fxIs10 II. Show Description
fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG?) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924
QP1208 C. elegans sws-1(ea12) V. Show Description
Increased lethality and male frequency. Synthetic lethal with helq-1(tm2134). Sensitive to camptothecin. Interacts with rip-1 and rfs-1. Reference: McClendon TB, et al. Genetics. 2016 May;203(1):133-45.
RM2576 C. elegans cho-1(tm373) IV. Show Description
Canonical allele. Superficially wild-type. Frequency of spontaneous reversals approximately twice that of wild type. Initial L4 swimming rate approximately half that of wild type, and decreases steadily for 30 min, until the animals are immobile. Synthetic lethal with pmt-2 RNAi.
RM3218 C. elegans pha-1(e2123) III; cho-1(tm373) IV; mdEx790. Show Description
mdEx790 [cho-1p(7.6kb)::cho-1::GFP + pha-1(+) + pBluescript]. CHO-1 translational fusion driven by 7.6 kb cho-1 promoter rescues cho-1 mutant behaviors, including reduced initial thrashing rate, fatigue, and synthetic interactions with pmt-2. Strong fluorescence in nerve ring, and ventral and dorsal nerve cords. Structure of the transgene is shown in Figure 1 of Mullen et al., 2007.
UP148 C. elegans sem-5(cs15) X. Show Description
Truncation allele of sem-5 with complex behavior. About 15% larval lethal, about 75% Egl/Vul. Synthetic Muv in gap-1 background.
WY114 C. elegans pha-1(fd1) III. Show Description
Wt. Synthetic lethal with lin-35/Rb. High % Pun in lin-35 background.
WY184 C. elegans xnp-1(fd2) I. Show Description
WT. Synthetic lethal with lin-35/Rb. Lower brood size than WT. High % gonad morphogenesis in lin-35 background.
WY34 C. elegans ubc-18(ku354) III. Show Description
Synthetic with lin-35. Slightly reduced growth rate. Reduced brood size. Otherwise appears wild-type.
SP2230 C. elegans sym-2(mn617) II. Show Description
Wild type. Synthetically lethal with mec-8.
SP2231 C. elegans sym-3(mn618) X. Show Description
Wild type. Synthetically lethal with mec-8.
SP2232 C. elegans sym-4(mn619) X. Show Description
Wild type. Synthetically lethal with mec-8.