Search Strains

Superficially WT. mir-84 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395.

Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, Sterile Muv, and males. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. The male phenotype similarly is heat sensitive; only males that are the progeny of lin-13 hermaphrodites and are grown at 20C or 25C have ventral protrusions. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.

Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Egl. Unc.

Egg-laying defective. Retains late stage eggs. Semi-dominant. Unc-slow moving.

Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C.

Deletion breakpoints are: TGTTTTATAGAAAGCTGAGGGTGTGTGTGTGTG / CCAGATGG_GTAAGTGAATT / GTTTTGTGTAGATGGTGGAAATGAGCAGGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

nEx1187 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

nEx1188 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

nEx1189 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

Deletion breakpoints are:ACGTGCTGTAAAAATTTGCGG / ATACCAAGCCTACAGTTGATTT...GGGACTTTGGGCGGCTTA / AAGTGTCACTGGTCTGGACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Egg laying defective. Retains late stage eggs. Forms bags of worms. Temperature sensitive: non or weak Egl at 15C.

Temperature sensitive Vul. 12% Vul at 15C and 45% Vul at 25C. VC's die. Variably Egl. Variably abnormal vulval divisions. See also WBPaper00001768

Egl-forms bags of worms. Semidominant. Paralysed. Grows best at 15C.

Egg laying defective. Makes bags of worms. Dominant.

Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C. Sluggish; weak coiler. Previously called egl-39.

Egg laying defective. Retains late stage eggs. Temperature sensitive.

Class B SynMuv. Reduced fertility. Maintain at 20C or cooler. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Egg laying defective. Retains late stage eggs. Forms bags of worms. Partially temperature sensitive. Males mate.

Heterozygotes are Muv and GFP+ and segregate SteUncMuv GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.

nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. Extra GFP+ M4 observed in nIs175. Reference: Takashi H, et al. PNAS 2010 Aug 31;107(35):15479-84.

Double mutant is Muv. lin-35 alone is non-Muv. lin-35 is a class B synthetic Muv.

Double mutant is Multivulva. lin-38 alone is non-Muv. lin-38 is a class A synthetic Muv.

Deletion breakpoints are:TGTGTCTATGAAATTAATTC / TTATATCAACTCTAATTAT...TTTTGGGAAAATGAAC / GATTAAACATTTTTTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Double mutant is Muv. n758 alone is not Muv.

Double mutant is Muv. lin-36 alone is non-Muv.

Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

Egg laying defective. Retains late stage eggs.

n490sd: curly Unc, Sma. n821: WT revertant of n490; extragenic; pka sup-20. See Science 273: 361-364 1996.

Dpy. Unc.

Unc.

Unc. Muv.

Long. Muv.

Deletion covering bases 34070-36042 on T24D8. This is a complete deletion of mir-75, which is on T24D8 (34374-34395).

Heterozygotes are Dpy and segregate Dpy, DpyUncs and dead eggs.

Heterozygotes are Dpy and segregate Dpy, DpyUnc and dead eggs. e1259 has a ts maternal effect.

Heterozygotes are WT and segregate WT, Muv or Steriles (homozygous n941), Unc-36 (homozygous eT1), and dead eggs. Pick wild-type and check for correct segregation of progeny to maintain. n941 is a lin-12 null allele. lin-12(n941) homozygotes are Muv or Ste. e1467 is also carried on eT1.

nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62.

Heterozygotes are Unc and segregate Unc, DpyUnc (Dpy is ts) and dead eggs. Maintain by picking Uncs.

Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.

nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT. Segregates Dpy Sterile and Dpy Unc.

Heterozygotes are WT GFP+. Segregates GFP+ Dpy Sterile and non-GFP Dpy Unc. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.

nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.

nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. nIs454 [mab-10p::mab-10::GFP + ttx-3p::GFP] II. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62.

Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.

Vul.

Non-lethal let-60 allele, multivulva phenotype (93% penetrance). Semi-Dominant (17% of hets are Muv). Amber suppressible. Non-null. PKA lin-34. See WBPaper00006902: strain probably carries a side mutation(s) that impairs chemotaxis to the odorant isoamyl alcohol.

Muv.