Strain Information

Name NK2657   View On Wormbase
Species C. elegans
Genotypenuo-1(qy143[nuo-1::mNG]) II; unc-119(ed4) III; qyIs50 V.
DescriptionqyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.
MutagenCrispr/Cas9& gamma irradiation
Outcrossedx3
Made byIsabel Kenny-Ganzert, Qiuyi Chi
Laboratory NK
Sign in or register an account if you want to order this strain.