Strain Information
| Name | NK2657 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | nuo-1(qy143[nuo-1::mNG]) II; unc-119(ed4) III; qyIs50 V. |
| Description | qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'. |
| Mutagen | Crispr/Cas9& gamma irradiation |
| Outcrossed | x3 |
| Made by | Isabel Kenny-Ganzert, Qiuyi Chi |
| Laboratory | NK |
Sign in
or
register an account if you want to order this strain.