| NK2645 |
C. elegans |
lin-35(n745) I; him-4(qy33[him-4::mNG+loxP]) X. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous him-4 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2651 |
C. elegans |
lin-35(n745) I; emb-9(qy83[emb-9::mRuby2 + LoxP]) III. Show Description
CRISPR/Cas9 insertion of mRuby2G into the endogenous emb-9 locus (internal tag) in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2657 |
C. elegans |
nuo-1(qy143[nuo-1::mNG]) II; unc-119(ed4) III; qyIs50 V. Show Description
qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.
|
|
| NK2694 |
C. elegans |
bmdSi15 rpl-31(qy110[rpl-31::gfp11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.
|
|
| NK2721 |
C. elegans |
qySi569 I. Show Description
qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. Superficially wild type animal expressing a single copy insertion of glucose transporter fdgt-2 in the anchor cell. fdgt-2 formerly known as fgt-2. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2730 |
C. elegans |
rpl-4(qy128[rpl-4::gfp11]) bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-41 locus.
|
|
| NK2738 |
C. elegans |
cox-5A(qy136[cox-5A::mNG]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-5A locus. Slightly delayed growth. Insertion verified by PCR. Left flanking sequence: 5' GGTAACATGGCCTCGTTGACC 3' ; Right flanking sequence: 5' ATATTAGGAGGTCTCAGAGGAG 3'. sgRNA: 5' AAGAAGTGGTACAAGGACTA 3'.
|
|
| NK2739 |
C. elegans |
cox-5B(qy137[cox-5B::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-5B locus. Insertion verified by PCR. Left flanking sequence: 5' TACAGCATGTGTAGACAACGAG 3' ; Right flanking sequence: 5' AAAGATGCGCACACAGACACA 3'. sgRNA: 5' TGTTTAGATGGATTCTGGGT 3'. Superficially wild-type.
|
|
| NK2743 |
C. elegans |
cox-10(qy141[cox-10::mNG]) II. Show Description
mNeonGreen tag inserted into C-terminus of endogenous mNeonGreen tag inserted into C-terminus of endogenous cox-10 locus. Insertion verified by PCR. Left flanking sequence: 5' GGCACTCACATTTTCGCGTTA 3' ; Right flanking sequence: 5' TGAAGCGCGTCTAACACGTT 3'. sgRNA: 5' GAACGGCTACAACAAAATGG 3'. Superficially wild-type.
|
|
| NK2746 |
C. elegans |
sdhb-1(qy144[sdhb-1::mNG]) II. Show Description
mNeonGreen tag inserted into C-terminus of endogenous sdhb-1 locus. Animals are slow growing with reduced brood size. Insertion verified by PCR. Left flanking sequence: 5' AACTGATGATGTAGCCGCCAAG 3' ; Right flanking sequence: 5' CAGTGAAAGTGCGTGTAGGA 3'. sgRNA: 5' ATCTCTCCGATGGCCTTAGC 3'.
|
|
| NK2752 |
C. elegans |
qyIs555. Show Description
qyIs555 [cdh-3p::aman-2::GFP]. Anchor cell specific expression of golgi protein aman-2. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2756 |
C. elegans |
qyIs562. Show Description
qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. Anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2765 |
C. elegans |
qySi120[eef-1A.1p::iATpSnFR1.0::unc-54 3'UTR] I. Show Description
Superfically wild-type strain with ubiquitous somatic expression of ATP biosensor iATPSnFR1.0 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal iATPSnFR1.0 reverse primer: 5' CTTCATCTCGGCGACGGAGAGACGGTT 3'
|
|
| NK2777 |
C. elegans |
nuo-1(qy157[nuo-1::mKate2]) II. Show Description
mKate2 tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.
|
|
| NK2780 |
C. elegans |
qySi564 I. Show Description
qySi564 [lin-29p::pfk-1.1::mNG +loxP] I. Single-copy insertion. Anchor cell-specific expression of the mNG-tagged glycolytic enzyme PFK-1.1 forms localized puncta at the site of invasion. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2781 |
C. elegans |
qySi565 I. Show Description
qySi565 [lin-29p::pyk-1a::mNG + loxP] I. Single-copy insertion. Anchor cell-specific expression of the mNG-tagged glycolytic enzyme PYK-1A forms puncta at the site of invasion. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2782 |
C.elegans |
qySi566 I. Show Description
qySi566 [lin-29p::enol-1a::mNG + loxP] I. Single-copy insertion. Anchor cell specific expression of glycolytic enzyme enol-1a which forms puncta at the invasive side and is also expressed in the nucleus. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2785 |
C.elegans |
qySi569 I; fdgt-1(tm3165) II. Show Description
qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. fdgt-1 glucose transporter null mutant expressing a single copy insertion of the glucose transporter fgt-2 in the anchor cell. fdgt-1 and fdgt-2 formerly known as fgt-1 and fgt-2, respectively. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2789 |
C. elegans |
bmdSi15 I; shy61(sec-61.B::GFP11x2) IV. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). 2x split GFP tag (GFP11) inserted into the C-terminus of the endogenous sec-61.B locus.
|
|
| NK2799 |
C. elegans |
unc-119(ed4) III; qyIs570 X. Show Description
qyIs570 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)] X. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP.
|
|
| NK2800 |
C. elegans |
tct-1(qy161[tct-1::mNG]) I. Show Description
mNG tag inserted into the C-terminus of the endogenous tct-1 locus.
|
|
| NK2827 |
C. elegans |
snb-1(qy164[snb-1::mNG]) V. Show Description
mNG tag inserted into the C-terminus of the endogenous snb-1 locus.
|
|
| NK2840 |
C. elegans |
mev-1(qy169[mev-1::mNG]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous mev-1 locus. Animals are slow growing with reduced brood size. Insertion verified by PCR. Left flanking sequence: 5' TATCCAGACAAACCATAGGACT 3' ; Right flanking sequence: 5' GCCGAACGAGATTAGACCTAT 3'. sgRNA: 5' CAAGAGCAACAAGACTGCCT 3'.
|
|
| NK2841 |
C. elegans |
nduf-7(qy170[nduf-7::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nduf-7 locus. Insertion verified by PCR. Left flanking sequence: 5' GCCGATTTGATTTTCGTTGCCG 3' ; Right flanking sequence: 5' GGCGAATTTGAATGGTCCAGT 3'. sgRNA: 5' GTAAGCGAGAAGCTCAACTT 3'.
|
|
| NK2844 |
C. elegans |
cox-6A(qy173[cox-6A::mNG]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-6A locus. Insertion verified by PCR. Left flanking sequence: 5' AAGGTATCCGACATGAACCGT 3' ; Right flanking sequence: 5' CCATTCAAGCTTTACAGGGTTC 3'. sgRNA: 5' TCAGCCTCGAATCCAACTCC 3'.
|
|
| NK2845 |
C. elegans |
nduv-2(qy174[nduv-2::mNG]) V. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. Insertion verified by PCR. Left flanking sequence: 5' AGATGTCGTTGGCATCGAACGT 3' ; Right flanking sequence: 5' CTTGATCGGTGGTGATAGCTGA 3'. sgRNA: 5' GCTGCTCTTAAATAAACGCT 3'.
|
|
| NK2864 |
C. elegans |
qySi180 I. Show Description
qySi180 [lin-29p::GFP::CAAX] I. MosSCI single copy insertion. Anchor cell specific expression of CAAX motif. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2902 |
C. elegans |
bmdSi15 I; rpl-31(qy189[rpl-31::ZF1::GFP11]) I; zif-1(gk117) III; qyIs463. Show Description
qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3' UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3' UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus. L4-specific expression of ZIF-1, ubiquitous GFPbeta1-10 and endogenous rpl-31 tagged with ZF-1+GFP-beta11
|
|
| NK2920 |
C. elegans |
emb-9(qy83[emb-9::mRuby2 + LoxP]) III; gon-1(qy45[gon-1::mNG+LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus and mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2922 |
C. elegans |
lin-35(n745) I; gon-1(qy45[gon-1::mNG+loxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2949 |
C. elegans |
qySi205 I. Show Description
qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion. Anchor cell specific expression of prenylation enzyme icmt-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2962 |
C. elegans |
rrf-3(pk1426) II; zmp-1(qy17[zmp-1::mNG::GPI]) III. Show Description
mNG and GPI tags inserted into the C-terminus of the endogenous zmp-1 locus.
|
|
| NK2964 |
C. elegans |
nifk-1(qy126[nifk-1::mNG]) zmp-1(cg115) III. Show Description
mNG tag inserted into the C-terminus of the endogenous nifk-1 locus.
|
|
| NK2987 |
C. elegans |
let-60(qy220[mNG::let-60 + LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen tag into endogenous let-60 locus. Fairly high penetrance of L1 rod-like lethality. Reference: Jayadev et al. 2023. Post-embryonic endogenous expression and localization of LET-60/Ras in C. elegans. microPublication Biology. 10.17912/micropub.biology.000931.
|
|
| NK2990 |
C. elegans |
qySi205; qyIs562. Show Description
qySi205 [lin-29p::icmt-1::mscarlet] I. qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3018 |
C. elegans |
mtx-1(qy217[mtx-1::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous mtx-1 locus. Insertion verified by PCR. Left flanking sequence: 5' ATGGAATTACACATTTGGCCG 3' ; Right flanking sequence: 5' TGTTGAGGATCTTTCTTCCT 3'. sgRNA: 5' GACTGACACTTGAATCAGACA 3'.
|
|
| NK3019 |
C. elegans |
qySi218[rpl-28p::tomm-20::mKate2::3xHA::unc-54 3'UTR] I. Show Description
Superfically wild-type strain with ubiquitous expression of red mitochondria outermembrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3027 |
C. elegans |
qySi148 I; lam-2(qy20[lam-2::mNG]) IV. Show Description
qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. mNeonGreen tag inserted into C-terminus of endogenous lam-2 locus. Superfically wild-type strain with AC-specific plasma membrane marker and BM marker. BM visualized with endogenously tagged laminin. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3030 |
C. elegans |
qySi229 I. Show Description
qySi229 [cdh-3p::lmp-1::mNG] I. MosSCI single copy insertion. Anchor cell specific expression of lysosomal protein lmp-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3047 |
C. elegans |
immt-1(qy230[immt-1::mNG]) X Show Description
mNeonGreen tag inserted into C-terminus of endogenous immt-1 locus. Insertion verified by PCR. Left flanking sequence: 5' GTCAATCCAGAAGACGAGTT 3' ; Right flanking sequence: 5' ATCGATGAGAACGGAGGAAC 3'. sgRNA: 5' CTAATAAGTTGAGCGAATCG 3'.
|
|
| NK3055 |
C. elegans |
qySi147 I; sec-16A.1(qy234[mNG::sec16A.1]) III. Show Description
qySi147 [lin-29p::mKate2::PLC(delta)PH] I. qy234 [mNG::sec16A.1] III. sec16A.1 locus endogenously tagged with mNG at the N-terminus and MosSCI single copy insertion for anchor cell specific expression of membrane marker PLC?PH. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3065 |
C. elegans |
qySi205 I; sec-16A.1(qy234[mNG::sec16A.1]) III. Show Description
qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and sec-16A.1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3084 |
C. elegans |
mtx-2(qy248[mNG::mtx-2]) III. Show Description
mNeonGreen tag inserted into N-terminus of endogenous mtx-2 locus. Insertion verified by PCR. Left flanking sequence: 5' CTACAATTTGCCTGCCGATGA 3' ; Right flanking sequence: 5' TACCTCGACAGTGGTAAGAA 3'. sgRNA: 5' GACCAATTGGGTTATCACCC 3'.
|
|
| NK3085 |
C. elegans |
cpIs91 II; immt-1(qy230[immt-1::mNG]) X. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous immt-1 locus. lag-2 driven red plasma membrane marker.
|
|
| NK3086 |
C. elegans |
cpIs91 II; ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous ucr-2.1 locus. lag-2 driven red plasma membrane marker.
|
|
| NK3087 |
C. elegans |
cpIs91 II; nduv-2(qy174[nduv-2::mNG]) V. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. lag-2 driven red plasma membrane marker.
|
|
| NK3114 |
C. elegans |
crls-1(qy255[crls-1::mNG]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous crls-1 locus. Insertion verified by PCR. Left flanking sequence: 5' AGTCACTACCACCGGAAGAACG 3' ; Right flanking sequence: 5' CTTGGTTTCGGCACTGGTGTTTC 3'. sgRNA: 5' CGGGACTACAGTATGCCAGTAA 3'.
|
|
| NK3210 |
C. elegans |
nuo-1(qy145[nuo-1::mNG]) II; emb-9(qy244[emb-9::mRuby2]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus.
|
|
| NK3211 |
C. elegans |
nuo-1(qy145[nuo-1::mNG]) II; emb-9(qy244[emb-9::mRuby2]) III; unc-6(ev400) X. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus. Unc-6 netrin mutation causes reduced movement and protruding vulva (Pvl) phenotype.
|
|
| NK3212 |
C. elegans |
cox-4(qy134[cox-4::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-4 locus. Insertion verified by PCR. Left flanking sequence: 5' CACGAAGAGAGAACGGTTTTTGA 3' ; Right flanking sequence: 5' TCGACTGGAAACTCTCGAAGGT 3'. sgRNA: 5' TTCTCGTAATCGTAGTGTGT 3'. Superficially wild-type.
|
|
