Strain Information

Name NK3212   View On Wormbase
Species C. elegans
Genotypecox-4(qy134[cox-4::mNG]) I.
DescriptionmNeonGreen tag inserted into C-terminus of endogenous cox-4 locus. Insertion verified by PCR. Left flanking sequence: 5' CACGAAGAGAGAACGGTTTTTGA 3' ; Right flanking sequence: 5' TCGACTGGAAACTCTCGAAGGT 3'. sgRNA: 5' TTCTCGTAATCGTAGTGTGT 3'. Superficially wild-type.
MutagenCrispr/Cas9
Outcrossedx0
Made byIsabel Kenny-Ganzert, Qiuyi Chi
Laboratory NK
Sign in or register an account if you want to order this strain.