More Fields
Strain Species Genotype
BC16163 C. elegans dpy-5(e907) I; sEx16163. Show Description
sEx16163 [rCes T04A8.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
VC4237 C. elegans nifk-1(gk5029[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous lethal or sterile deletion balanced by qC1. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous qC1 is non-GFP sterile TS Dpy. Left flanking sequence: CAGATCTCAGACACAATGGTTGCCCAGAAT; Right flanking sequence: CCCGTCCAGCTGCTGTCGAAAAGAAAACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.