Strain Information
| Name | NK2739 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | cox-5B(qy137[cox-5B::mNG]) I. |
| Description | mNeonGreen tag inserted into C-terminus of endogenous cox-5B locus. Insertion verified by PCR. Left flanking sequence: 5' TACAGCATGTGTAGACAACGAG 3' ; Right flanking sequence: 5' AAAGATGCGCACACAGACACA 3'. sgRNA: 5' TGTTTAGATGGATTCTGGGT 3'. Superficially wild-type. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Isabel Kenny-Ganzert, Qiuyi Chi |
| Laboratory | NK |
Sign in
or
register an account if you want to order this strain.