Search Strains

Superficially wild-type. wd114 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous oig-1 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.

wd116 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous lev-10 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.

wdEx1034 [rab-3p::GFP1-10 + myo-2p::mCherry]. Pick mCherry+ to maintain. wd114 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous oig-1 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.

wdEx1086 [myo-3p::GFP1-10 + myo-2p::mCherry]. Pick mCherry+ to maintain. wd116 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous lev-10 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.

wdEx1087 [ttr-39p::GFP1-10 + myo-2p::mCherry]. Pick mCherry+ to maintain. wd116 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous lev-10 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.

unc-37(wd17) is a dominat suppressor of unc-4(e2322ts). unc-37(wd17) has no phenotype alone.

wdIs132 [gcy-35::GFP]. uIs152 [mec-3::RFP]. AVM neurons are labeled with GFP and RFP. Can be used to isolate AVM by FACS. wdIs132 arose from spontaneous integration of kyEx1162 [gcy-35::GFP]. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. otIs846 [egas-1p::GFP + unc-122p::GFP]. Pan-neuronal nuclear RFP expression. Co-expression of GFP and RFP in IL2 neuron can be used to isolate IL2 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

No obvious phenotype. 2.4 kb deletion of acr-5 produced by Moulder/Barstead at OMRF.

wdEx353 [Y34D9B.1a::GFP + unc-119(+)]. mig-1::GFP construct made by Marc Vidal's group at Harvard as part of the promoterome project; unc-37 target gene. GFP expression observed in all classes of VNC motor neurons, head & tail neurons, body wall muscle, and intestine. [The strain is described as unc-119 and unc-119(+) as the co-injection marker, but looks to actually be lin-15 (Muv).]

wdEx445 [T27E9.9::GFP + rol-6(su1006))]. Pick rollers to maintain. GFP expression in DA and DB neurons during L1 stage, low levels of expression in VA neurons in later stages.

Long lifespan and healthspan. mig-22(k185) is a gain-of-function allele that increase endogenous chondroitin and suppress the gonad migration defect of mig-17(k174). Reference: Shibata Y, et al. Sci Rep. 2024 Feb 27;14(1):4813. doi: 10.1038/s41598-024-55417-7. PMID: 38413743.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tk158 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Shibata Y, et al. Biol Open. 2019 Jan 17;8(1):bio038448. doi: 10.1242/bio.038448. PMID: 30635266.

Short lifespan. vha-7(tk181) is a point mutation isolated as a suppressor of sqv-5(k175). tk181 represses the formation of tubular lysosome. Reference: Shibata Y, et al. Scientific Reports. In press.

Isolated as a dominant suppressor of DTC migration defects of mig-17(k174). The fbl-1(k201) single mutant has weak DTC migration defects.

Isolated as a dominant suppressor of DTC migration defects of mig-17(k174). The fbl-1(k206) single mutant has weak DTC migration defects.

Heterozygotes are WT and GFP+. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. fbl-1(tk45) homozygotes are Dpy, Sterile and are Distal Tip migration defective.

vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

wgIs652 [fkh-8::TY1::EGFP::3xFLAG + unc-119(+)]. CRISPR-engineered allele of daf-19 affects only isoforms a and b. De-repression of fkh-8 expression in neurons. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480.

zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

SL2::GFP::H2B tag inserted at the C-terminus of the endogenous osm-5 locus by CRISPR. GFP expression labels ciliated sensory neurons. Him. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480.

zdIs13 [tph-1p::GFP] IV. vlcEx284 [hsp-16.2p::hlh-3 + ttx-3::mCherry + rol-6(su1006)]. Rollers. Extrachromosomal array containing the heat shock responsive hsp-16.2 promoter for time controlled expression of hlh-3 transcription factor cDNA. Transcriptional tph-1 GFP reporter labels the serotonergic system. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.

Recessive. Maternal rescue Dpy. Slightly Unc. Small broods. CAN migration nearly normal in absence of kyIs5.

Unc. Recessive. CAN migration nearly normal in absence of kyIs5.

Weak loopy Unc. CAN migration mostly normal in absence of kyIs5 reporter.

Unc. Recessive allele for most phenotypes. Appears to be a gain of function mutation (see Zipkin et al. 1997).

Withered tail. Unc. Small broods. Recessive. Hypomorphic allele of vab-8.

kyIs5 [ceh-23p::unc-76::GFP + lin-15(+)] IV. kyIs5 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons.

Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. Derived from strain TY1353. Grows fairly slowly but seems more stable than TY1353, which gives lots of steriles.

mIs14 [myo-2p::GFP + pes-10p::GFP]. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP or302 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. or302 homozygotes are GFP- and are Emb, ABar and have EMS spindle misalignment. or302 is a deletion starting at 503 and ending at 1578 of C27A2.6.

Heterozygotes are WT and segregate WT, Sterile Dpys and Clear lethals (die as L1-L2s). Differentiation of AIY, CAN defective.

Vulvaless. About 91% of the animals die as L1 or early L2. n1619 suppresses clr-1.

Heterozygotes are WT and segregate WT, Lon Males, early L1 larval arrested animals (n1456 homozygotes) and dead eggs. n1456 is an early nonsense mutation in the extracellular domain of EGL-15/FGFR (Q268 STOP).

No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3.

Do not keep below 20C. Male-Female strain. Reference isolate for Caenorhabditis sp. 43 genome sequence. Inbred derivative of NIC1070 (25 generations of inbreeding).

Do not keep below 20°C.  Male-female.  Caenorhabditis sp. 39 wild isolate. Gonochoristic species; isofemale line. Isolated from rotting Clusia fruits on the island of Dominica (2014). Previously known as Caenorhabditis sp. 39.

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. 100% penetrant.

Abnormal body shape. Unc. Severity of phenotype: rh326 > rh80 > rh148.

Unc. Loss-of-function or null allele.

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip.

Abnormal body shape. Unc. Severity of phenotype: rh326 > rh80 > rh148.

Excretory canal defect. Large fluid-filled cysts appear randomly along the excretory canal, especially at the tips: 100% penetrant. Cysts often visible as clear spots by low-power microscopy. Shortened canals. Smaller cysts in amphid sheath. Stop mutation in 2nd Ras-like IRGP domain. Encodes homologue of human IRGC. [NOTE (08/2025): The correct genotype of this strain is exc-1(rh26), not exc-3(rh26) as previously described.]

Delayed hatching from egg shell. QL and descendant cells migrate forward instead of backward (incomplete penetrance). QR and descendant cells migrate backward instead of forward (weak penetrance). Semidominant with respect to cell migration.

Excretory canal defect. Canal is invariably short with multiple cysts of varying size clustered along length, especially at the tips. Visible only by Nomarski microscopy. Tail spike is often slightly malformed. Animal is somewhat pale.

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the canal tips. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. Impenetrant distal tip cell migration defects (Mig).

Abnormal body shape. Unc. Severity of phenotype: rh326 > rh80 > rh148.

Bacteria. NJF01 originates from E. coli ET505 (F-, lambda- lysA0::Tn10 IN(rrnD-rrnE)1), modified with DE3 and (delta)rnc-38. The E. coli is lysine auxotroph and resistant to kanamycin and tetracycline. IPTG induces expression of the T7 polymerase. Grow at 37 °C on LA plates or in LB liquid medium. Reference: Fredens J, et al. Nat Methods. 2011 Aug 28;8(10):845-7.

Isoform-specific activation of SKN-1C. Heterozygotes are GFP+ and non-Unc. Segregates GFP+ non-Unc (heterozygotes), GFP+ Unc (tmC25 homozygotes), and GFP- non-Unc (skn-1 homozygotes). Eggs produced by skn-1(nic952) homozygotes do not hatch. Maintain by picking GFP+ non-Unc heterozygotes and checking for correct segregation of progeny. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.

nicTi600 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi556]] I. Maintain at 20C, somewhat sick at 25C. Unc. nicTi600 is a modified version of oxTi556 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).