| NK3234 |
C. elegans |
cpIs91 II; crls-1(qy255[crls-1::mNG]) III. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous crls-1 locus. lag-2 driven red plasma membrane marker.
|
|
| NK3271 |
C. elegans |
qySi296 I. Show Description
qySi296 [eef-1A.1p::SL2::HYlight::tbb-2 3'UTR] I. Ubiquitous somatic expression of glycolysis ratiometric biosensor HYlight inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3299 |
C. elegans |
qySi312 I. Show Description
qySi312 [eef-1A.1p::SL2::HYlight-RA::tbb-2 3'UTR] I. Ubiquitous somatic expression of glycolysis ratiometric biosensor Hylight-reduced affinity (RA) control inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3304 |
C. elegans |
qySi313 I; unc-119(ed4) III; qyIs629. Show Description
qySi313 [lin-29p::ucp-4::SL2::mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR] I. qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR. Anchor cell specific overexpression of mitochondrial uncoupling protein, UCP-4, (expression confirmed by presence of red anchor cell membrane). qySi313 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NM5879 |
C. elegans |
jsSi1900 II. Show Description
jsSi1900 [loxP::cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
| NM5945 |
C. elegans |
jsSi1988 IV. Show Description
jsSi1988 [loxP + cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
| NM5953 |
C. elegans |
jsSi1949 II; him-8(e1489) IV. Show Description
jsSi1949 [loxP + myo-2p::FRT::nls::mNG myo-2 3' + <{rps-0p HygR unc-54 3'} ori <{Amp} <{mex-5p nls-Cre tbb-2 3'} + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
| NM5970 |
C. elegans |
jsSi1973 I; him-8(e1489) IV. Show Description
jsSi1973 [mosL + loxP + myo-2p::FRT::nls::mNG::myo-2 3' + <{rps-0p::HygR::unc-54 3'} + ori <{Amp} <{mex-5p::nls::Cre::tbb-2 3'} + FRT3 + mosR] I. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
| NM6024 |
C. elegans |
jsSi2029 IV. Show Description
jsSi2029 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + mex-5p::nls::Cre::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
| NM6037 |
C. elegans |
jsSi2049 V. Show Description
jsSi2049 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} mex-5p::nls::Cre::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
| NM6168 |
C. elegans |
jsSi2027 II; him-8(e1489) IV. Show Description
jsSi2027 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} + mex-5p::nls::Cre::glh-2 3' + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
| OCF69 |
C. elegans |
ocfSi1 I; unc-119(ed3) III. Show Description
ocfSi1 [mex-5p::Dendra2::his-58/66::tbb-2 3'UTR + unc-119(+)] I. Dendra2::histone H2B expression in the germline and embryos. The H2B coding sequence is identical to genes his-58 and his-66. Made by MosSCI insertion into ttTi4348 on LG I. Reference: Rosu S & Cohen-Fix O. Dev Biol. 2017 Mar 15;423(2):93-100.
|
|
| OD1854 |
C. elegans |
ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. Show Description
ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3UTR + cnd-1p::mCherry::his-72::unc-54 3UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3UTR + hlh-1p::mCherry::his-72::tbb-2 3UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.
|
|
| OD2768 |
C. elegans |
ltSi910 II; unc-119(ed3) III. Show Description
ltSi910 [elt-2p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Intestinal-specific expression of anti-GFP nanobody fused to ZIF-1 mediates intestine-specific degradation of GFP-tagged proteins (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine intestine-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
|
|
| OD2770 |
C. elegans |
ltSi912 II; unc-119(ed3) III. Show Description
ltSi912 [myo-3p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Muscle-specific expression of anti-GFP nanobody fused to ZIF-1 mediates body wall muscle-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine body wall muscle-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
|
|
| OD2772 |
C. elegans |
ltSi914 II; unc-119(ed3) III. Show Description
ltSi914 [osm-6p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Sensory neuron-specific expression of anti-GFP nanobody fused to ZIF-1 mediates sensory neuron-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine sensory neuron-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
|
|
| OD2773 |
C. elegans |
ltSi915 II; unc-119(ed3) III. Show Description
ltSi915 [osm-6p::zif-1::operon-linker::mCherry::histone::tbb-2 3'UTR + Cbr-unc-119(+)] II. This strain provides a sensory neuron-specific source of ZIF-1 alone and serves as a control strain for OD2772, which mediates ciliated sensory neuron-specific degradation of GFP-tagged proteins. It can also be used as source of sensory-specific ZIF-1 for other applications. Superficially wild type. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
|
|
| OD2984 |
C. elegans |
ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::zif-1::operon-linker::mKate::tbb-2 3'UTR + Cbr-unc-119(+)] II. Touch response neuron (TRN)-specific expression of anti-GFP nanobody fused to ZIF-1 mediates TRN-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine TRN neuron-specific functions of target genes. Reference: Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398
|
|
| OD4235 |
C elegans |
ltSi220 I; ltSi1129 II; unc-119(ed3) III. Show Description
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1129 [spd-2p::spd-5(re-encoded) + Cbr-unc-119(+)] II.
Re-encoded spd-5 is siRNA-resistant. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
|
|
| OD4313 |
C elegans |
ltSi220 I; ltSi1219 II; unc-119(ed3) III. Show Description
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1219 [spd-2p::spd-5(S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. Small centrosomes. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
|
|
| OD4467 |
C elegans |
ltSi220 I; ltSi1232 II; unc-119(ed3) III. Show Description
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1232 [spd-2p::spd-5(S170A T178A T198A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
|
|
| OD4833 |
C elegans |
ltSi220 I; ltSi1561 II; unc-119(ed3) III. Show Description
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1561 [spd-2p::spd-5(S170A T178A T198A S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
|
|
| OH17918 |
C. elegans |
lep-5(ot1215[lep-5p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the lep-5 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. Males exhibit typical leptoderan tails.
|
|
| OH17921 |
C. elegans |
linc-3(ot1217[linc-3p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) V. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-3 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.
|
|
| OH17923 |
C. elegans |
linc-19(ot1219[linc-19p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) III. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-19 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.
|
|
| OH17929 |
C. elegans |
linc-23(ot1225[linc-23p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.
|
|
| OH17932 |
C. elegans |
linc-26(ot1227[linc-26p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad and extremely dim expression in hermaphrodite spermatheca.
|
|
| OH17935 |
C. elegans |
linc-36(ot1229[linc-36p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-36 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the sperm of both hermaphrodites and males.
|
|
| OH17938 |
C. elegans |
linc-41(ot1231[linc-41p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-41 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad, spermatheca of hermaphrodites, as well as several other tissues in the head.
|
|
| OH17942 |
C. elegans |
tts-1(ot1234[tts-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the tts-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in several tissues including the pharynx but is significantly upregulated in a stress-dependent manner in a variety of tissues.
|
|
| OH18019 |
C. elegans |
linc-1(ot1249[linc-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.
|
|
| OH18707 |
C. elegans |
otIs904 V. Show Description
otIs904 [ges-1p::ins-1::tagRFP-T::SL2::GFP::his-44::tbb-2 3 UTR + inx-6p18::tagRFP::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of INS-1 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19078 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; otIs908 V. Show Description
otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. TIR1(F79G) expression in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19118 |
C. elegans |
otIs913 V. Show Description
otIs913 [pha-4(prom2)::daf-2(DN)::eBFP2::tbb-2 3 UTR + unc-122p::mCherry::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. pha-4(prom2) drives expression of daf-2(DN) in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19575 |
C. elegans |
otIs927 V. Show Description
otIs927 [ges-1p::nlp-40::tagRFP-T::SL2::GFP::his-44::tbb-2 3 UTR + inx-6(prom18)::tagRFP-T::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of NLP-40 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19735 |
C. elegans |
otIs937 V. Show Description
otIs937 [ceh-19(prom2)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. ceh-19(prom2) drives expression of daf-2(DN) specifically in the MC neurons in the pharyngeal nervous system. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19767 |
C. elegans |
otIs942 V. Show Description
otIs942 [tph-1(prom5)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. tph-1(prom5) drives expression of daf-2(DN) specifically in the NSM neurons. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| ONA18 |
C.elegans |
yokSi3 II; unc-119(ed3) III. Show Description
yokSi3 [spe-11p::trp-3A::TagRFP-T::tbb-2 3'UTR + Cbr-unc-119(+)] II. Reference: Takayama J & Onami S. Cell Rep. 2016 Apr 19;15(3):625-637.
|
|
| ONA20 |
C.elegans |
yokSi3 II; spe-41(sy693) unc-119(ed3) III. Show Description
yokSi3 [spe-11p::trp-3A::TagRFP-T::tbb-2 3'UTR + Cbr-unc-119(+)] II. Reference: Takayama J & Onami S. Cell Rep. 2016 Apr 19;15(3):625-637.
|
|
| PX631 |
C. elegans |
fxSi3 I; fxSi4 II; fog-2(q71) V. Show Description
fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
|
|
| PX658 |
C. elegans |
fxSi1 I; fxSi4 II; fxSi6 III; spe-44(fx123[spe-44::AID*]) IV; fog-2(fx111) V. Show Description
fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
|
|
| RJP5296 |
C. elegans |
reSi7 I; unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| SA1057 |
C. elegans |
tbb-2(tj41[tbb-1 substitution]) III. Show Description
The endogenous tbb-2 coding sequence was re-encoded with tbb-1 mimic sequence, expressing TBP-1 from the tbp-2 locus. Reference: Honda Y, et al. J Cell Sci. 2017 May 1;130(9):1652-1661. doi: 10.1242/jcs.200923. PMID: 28302908.
|
|
| SA1108 |
C. elegans |
tbb-1(tj59[tbb-2 substitution]) III. Show Description
The endogenous tbb-1 coding sequence was re-encoded with tbb-2 mimic sequence, expressing TBP-2 from the tbp-1 locus. Reference: Honda Y, et al. J Cell Sci. 2017 May 1;130(9):1652-1661. doi: 10.1242/jcs.200923. PMID: 28302908.
|
|
| SA250 |
C. elegans |
tjIs54; tjIs57. Show Description
tjIs54 [pie-1p::GFP::tbb-2 + pie-1p::2xmCherry::tbg-1 + unc-119(+)]. tjIs57 [pie-1p::mCherry::his-48 + unc-119(+)]. Maintain at 25C to avoid transgene silencing. Reference: Toya M, et al. Methods Cell Biol. 2010;97:359-72.
|
|
| SA854 |
C. elegans |
tbb-2(tj26[gfp::tbb-2]) III. Show Description
GFP tag inserted into the endogenous tbb-2 locus. GFP signals are detected at the epidermis, germline, intestine, muscle, and neurons. Reference: Honda Y, et al. J. Cell. Sci. 2017 May 1;130(9):1652-1661. PMID: 28302908.
|
|
| SHG1941 |
C. elegans |
ustSi268 I. Show Description
ustSi268 [mex-5p::tagrfp::elli-1::tbb-2 3'UTR] I. Inserted into LG I (-5.51 cM) locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
|
|
| SJZ106 |
C elegans |
foxSi27 I. Show Description
foxSi27 [pie-1p::tomm-20(gDNA)::mKate2::HA::tbb-2 3'UTR ] I. Single-copy MosSCI insertion into oxti185. Germline-specific expression of TOMM-20::mKate2::HA can be used for fluorescent identification of germline mitochondrial morphology and tissue-specific isolation of mitochondria. Reference: Ahier A, et al. Nature Cell Biol. 2018 Mar;20(3):352-360. doi: 10.1038/s41556-017-0023-x. PMID: 29358705.
|
|
| SJZ204 |
C. elegans |
foxSi37 I. Show Description
foxSi37 [ges-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Gut-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SJZ206 |
C. elegans |
foxSi39 I. Show Description
foxSi39 [gcy-6p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. ASE-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|