Search Strains

Egg laying defective. Retains late stage eggs. Forms bags of worms. Temperature sensitive: non or weak Egl at 15C.

Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.

Egl-forms bags of worms. Semidominant. Paralysed. Grows best at 15C.

Egg laying defective. Makes bags of worms. Dominant.

Backcrossed tph-1(mg280) allele. cam-1 mutation was removed by crossing left and right of tph-1(mg280) using bli-2 and unc-4. Strain does not have withered tail defect and moves well.

Egg laying defective. Retains late stage eggs. Forms bags of worms. Partially temperature sensitive. Males mate.

Wild type vulva; semi-sterile. Suppressor of lin-53(n833) and lin-15(n767).

n4872 is a 722 bp deletion that removes part of exon 2 and all of exons 3 and 4. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.

vps-50 mutants are abnormal in locomotion and egg laying. n4022 is a strong loss-of-function allele; unknown if null. Reference: Paquin N, et al. Curr Biol. 2016 Apr 4;26(7):862-71. doi: 10.1016/j.cub.2016.01.049. PMID: 26948874.

Weak suppressor of egl-6(n592). 945 bp deletion. Reference: Ringstad N, Horvitz HR. Nat Neurosci. 2008, 11(10):1168-76.

Egl-c. Suppresses egg-laying defect of egl-6(gf). Reference: Emtage L, et al. J Neurosci. 2012 Nov 14;32(46):16285-95. doi: 10.1523/JNEUROSCI.2667-12.2012. PMID: 23152612.

Wild-type vulva. Semi-sterile. Suppressor of lin-53(n833); lin-15(n767).

mir-253 and part of F44E7.5 are deleted in nDf64. Deletion breakpoints are:GATATCCTCACACTTTGGCAAAGAGTGCTT / GTTGAAGACGGTGAAAACATCCGAATTTTCAGGGAAGTT...TGAGATAAGAACACAAA GAATTCGATTTTC / GTGAATTCTGAACGAAACTTTACGTTTTGGACAGTAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Suppressor of unc-93(e1500). Weak maternal effect sterile and dumpy. Reference: Ma L, Horvitz HR. PLoS Genet. 2009 Nov;5(11):e1000708.

Complete deletion allele of mir-256 from bases 5826-6853 on T07H8. This mutation likely has a polar effect on mec-1, which starts at 6924 on T07H8 (the deletion covers putative promoter elements).

Deletion of C43E11.3 splice donor for the 4th exon through exon 7.

n490sd: curly Unc, Sma. n821: WT revertant of n490; extragenic; pka sup-20. See Science 273: 361-364 1996.

Dpy. Egg laying defective. Makes bags of worms. Abnormal vulva. Previously called egl-29(n482).

n718 is a strong allele of ced-3.

mir-44, mir-61, and mir-247 are members of the mir-44 family. mir-45 is also part of this family, but is not deleted in thsi strain; it is closely linked to mir-44. Reference: Curr Bio (2010) 20:367-73.

993 bp deletion covering bases 11371-12364 of T07C5. Deletion covers mir-62 (11867-11890) and part of the predicted gene T07C5.6.

mir-2 family and most of mir-44 family are removed in this strain (mir-45 is present). Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

Deletion covering bases 34070-36042 on T24D8. This is a complete deletion of mir-75, which is on T24D8 (34374-34395).

Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.

nIs348 [ceh-28p::4XNLS::mCherry + lin-15(+)] IV. Reporter construct contains 2.4 kb of ceh-28 promoter. Reference: Hirose T, et al. Proc Natl Acad Sci. 2010 Aug 31;107(35):15479-84. PMID: 20713707

Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.

Heterozygotes are WT and segregate WT, Muv or Steriles (homozygous n941), Unc-36 (homozygous eT1), and dead eggs. Pick wild-type and check for correct segregation of progeny to maintain. n941 is a lin-12 null allele. lin-12(n941) homozygotes are Muv or Ste. e1467 is also carried on eT1.

nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.

nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.

nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.

Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ and segregate WT green-glowing heterozygotes and non-glowing rba-1 homozygotes. rba-1(n5418) homozygotes are sterile or produce eggs that fail to hatch. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Nakano S, Stillman B, Horvitz HR. Cell. 2011 December 23; 147(7): 1525-1536.

Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.

n996 is a semi-dominant allele of egl-42. Reference: Genetics (1989) 121:703-21.

Non-lethal let-60 allele, multivulva phenotype (93% penetrance). Semi-Dominant (17% of hets are Muv). Amber suppressible. Non-null. PKA lin-34. See WBPaper00006902: strain probably carries a side mutation(s) that impairs chemotaxis to the odorant isoamyl alcohol.

nSi3 [set-17p::set-17(+)::GFP::set-17 3’UTR + unc-119(+)] IV. nSi3 expresses a translational fusion of genomic set-17 and GFP. nSi3 rescues the brood size defect of n5017 in this strain. nSi3 is a single copy MOS-mediated transposition into the cxTi10882 site; GFP detectable in the nuclei of the hypoderm, sperm and proximal germline, as well as some other cells. Reference: Engert CG, et al. PLoS Genet. 2018 Apr 27;14(4):e1007295.

Egl. Mate with about 50% of WT efficiency.

n4827 is a null allele of gcn-1 and that loss of gcn-1 function causes a defect in M4 sister cell death. Reference: Hirose T & Horvitz HR. PLoS Genet. 2014 Aug 7;10(8):e1004512.

Slightly Unc. Abnormal Q lineage. Males mate with about 50% efficiency of WT. Egl.

kyIs511 [gcy-36p::GCaMP + unc-122p::GFP]. nEx2316 [gcy-36p::gur-3 + ges-1p::GFP]. Pick animals with GFP expression in gut to maintain. Expression of gcy-36p::gur-3 causes URX to respond to light 30% of the time. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. doi: 10.1016/j.neuron.2014.12.061. PMID: 25640076.

nIs686 [gpa-16p::GCaMP3::unc-54 3' UTR + lin-15(+)] III. Expression of GCaMP in RIP, pharyngeal muscle (pm2, pm3, and dimly/occasionally in pm1), mc1 marginal cells, and other unidentified cells. Derived by gamma-irradiation of nEx2309 in parental strain MT23222 and out-crossed five times to MT8189 lin-15B&lin-15A(n765). Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341

Heterozygotes are Muv and Egl (n137 is semi-dominant) and segregate DpyMuv and Unc lethals (most arrest as L1-L3, the few survivors are sterile, scrawny, Unc and have a large ventral blip at hte position of the vulva). Maintain by picking non-Dpy non-Unc.

Hyperactive. n1134 is a G to A substitution in the initiation codon of goa-1.

Sister cells of NSM and I2 neurons fail to undergo programmed cell death. Other cell deaths unaffected. Semi-dominant.

nEx3045 [C32F10.8p::GCaMP3::unc-54 3' UTR + lin-15(+)]. Pick non-Muv animals to maintain array. Line is quite stable, ~80% transmission. Expression of GCaMP3 in pm3, mc1, and in other pharyngeal cells posterior to pm3. Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341

Revertant of dominant Unc. WT.

sup-17(n1258) is a recessive suppressor of lin-12(n302sd).

Temperature sensitive. Sup Vul. Egl of n302.

ts. Dpy. Egl. sup of lin-12(d).

Suppressor of lin-12(d).

Suppressor of lin-12(d).