Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CX6448 C. elegans gcy-35(ok769) I. Show Description
668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'.
CYA22 C. elegans ahcy-1(syb748) I. Show Description
ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.
CYA23 C. elegans ahcy-1(syb748) I; sqIs13. Show Description
sqIs13 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. GFP fluorescence in autophagosomes. RFP fluorescence in AWB and AWC. ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.
CZ13896 C. elegans juIs319. Show Description
juIs319 [col-19p::GCaMP3 + col-19p::tdTomato]. col-19p::GCaMP3 expression is induced by either laser or needle wounding. col-19 is an adult-specific collagen and is not expressed until the end of the L4 larval stage. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7.
CZ16143 C. elegans juEx4586. Show Description
juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. RFP expression in AIY neuron. Weak light green signals were observed in the neurons using compound scope although this is only the former half of the split GFP. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
CZ17515 C. elegans juSi94 II; rps-18(ok3353) IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18018 C. elegans juSi94 II; rps-18(ok3353) IV; juEx5375. Show Description
juSi94 [rps-18p::GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5375 [col-19p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. Expression of split GFP reporter labels ribosomes in the epidermis. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
CZ18020 C. elegans juSi94 II; rps-18(ok3353) IV; juEx5377. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5377 [myo-3p::GFP1-10 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. Muscle-specific expression of split GFP reporter allows visualization of ribosomes in muscle. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18412 C. elegans juSi94 II; rps-18(ok3353) IV; glo-4(ok623) V; juEx5515. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ19297 C. elegans juSi94 II; rps-18(ok3353) juIs409 IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs409 [rgef-1p::GFP1-10 + ttx-3p::RFP] IV. Pan-neuronal-specific expression of split GFP reporter allows visualization of ribosomes in neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ19299 C. elegans juSi94 juIs438 II; rps-18(ok3353) IV. Show Description
juIs438 [mec-4p::GFP1-10 + mec-4p::tagRFP] II. juSi94 [rps-18p::GFP11::rps-18]. Expression of split GFP reporter labels ribosomes in touch neurons. Generated in N2 background. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ20132 C. elegans juSi94 II; rps-18(ok3353) IV; juIs463. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. DD motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in those neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ24092 C. elegans gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
CZ24274 C. elegans dhc-1(lt45[dhc-1::GFP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
CZ24969 C. elegans sphk-1(ju831) II. Show Description
Aldicarb resistant. Reference: McCulloch KA, et al. G3 (Bethesda). 2017 Jul 5;7(7):2055-2063.
CZ24990 C. elegans unc-44(ju1412[unc-44::GFP]) IV. Show Description
Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
CZ25013 C. elegans unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
CZ25708 C. elegans prg-1(ju1574) I. Show Description
Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.
CZ25941 C. elegans dlk-1(ju1579[gfp::dlk-1]) I. Show Description
Endogenous dlk-1 locus tagged with GFP using CRISPR/Cas9. GFP is not visible under compound fluorescence microscope. Reference: Sun Y, et al. Proc Natl Acad Sci U S A. 2023 Sep 26;120(39):e2302801120. doi: 10.1073/pnas.2302801120. PMID: 37722038.
CZ26389 C. elegans esyt-2(ju1408) III. Show Description
CRISPR-engineered deletion of esyt-2 from middle of 5'UTR to middle of 3'UTR using guide RNAs crCP01 (GGTTTCAGTAATTGTGGGCT) and crCP02 (GTGCACTTACGGGTTGTAGG). Superficially wild-type. Reference: Piggott CA, et al. Genetics. 2021 Apr 19;iyab063. doi: 10.1093/genetics/iyab063. PMID: 33871019.
CZ31328 C. elegans efa-6(ju1658[GFP::efa-6]) IV. Show Description
Endogenous efa-6 locus tagged with GFP using CRISPR/Cas9. GFP is visible under compound fluorescence microscope. Reference: Sandhu A., et al. Cell Reports 2024 Oct 22;43(10):114776. doi: 10.1016/j.celrep.2024.114776. PMID: 39305484.
CZ3391 C. elegans vab-3(ju468) X. Show Description
Vab. Notched Head. Distal tip cell Mig. Male tail ray and spicule defects. Males do not mate. About 50% larval lethality. H and B cell lineage defects. Received new stock Jan. 2006.
CZ3714 C. elegans gcy-31(ok296) X. Show Description
2505bp deletion in cosmid T07D1. Break points are 6562 and 9069 with respect to T07D1. Sequence at the break point is: GGAAAAAAAAACTTCGCG / TTTGGCTAGTCGTAT. Primers: ok296u1: CTGAAACCATCTGACAGA; ok296d1: CATCGGAATAGGATTGTTG; ok296d2: CATTAGGTTTACAGGCTTAG. ok296d1u1 = 290bp product with WT allele. ok296d2u1 = 352 bp product with ok296 allele.
CZ3715 C. elegans gcy-33(ok232) V. Show Description
1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele.
CZ4733 C. elegans spon-1(ju430) II. Show Description
Temperature-sensitive. Maintain at 15C. Vab. Lethal at 25C. 2-fold Lpy. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56.
CZ4734 C. elegans spon-1(e2623) II. Show Description
Maintain under normal conditions. Weak bent head. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56.
CZ5847 C. elegans spon-1(ju402) II; juEx1111. Show Description
juEx1111 [spon-1::vGFP + ttx-3p::RFP]; rescues ju402 lethality. Vab. 2-fold Lpy. ju402 is lethal. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56.
CZ8332 C. elegans juIs223 IV. Show Description
juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. Transcriptional reporter with ttr-39 promoter driving mCherry expression in DD and VD neurons. Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.
CZ9676 C. elegans acr-2(n2595 n2420) X. Show Description
Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.
DA1051 C. elegans avr-15(ad1051) V. Show Description
Starved. Lacks M3 spikes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be used for any commercial purpose or for work on human subjects.
DA1370 C. elegans avr-15(vu227) glc-1(pk54) V. Show Description
Lacks M3 spikes. glc-1(pk54::Tc1). This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC. Received new stock 5/21/08. [NOTE: The correct genotype of this strain is avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.]
DA1426 C. elegans exp-2(sa26ad1426) V. Show Description
Reversion of sa26. Severely reduced R spikes, long pumps, short hold-backs.
DA1880 Bacillus megaterium Bacillus megaterium. Show Description
Bacteria. Str-R. L10 papilla 2; sporulation-defective mutant. This is a low-quality food that is difficult for the worms to eat, and is useful for studies of the effect of food on behavior, physiology, etc. [NOTE: This strain grows better on NGM than on LB media in CGC.] Described in J Exp Biol 206: 2441-2457. Biosafety Level: BSL-1.
DA2249 C. elegans spg-7(ad2249) I. Show Description
Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69.
DA2250 C. elegans mgl-2(tm355) I; mgl-1(tm1811) X. Show Description
Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.
DA472 C. elegans pha-2(ad472) X. Show Description
Misshapen pharynx; worms hatch with pharynx of correct gross shape, but disorganized, with nuclei misplaced. Most homozygotes arrest in L1, escapers grow up to become very starved adults with deformed pharynges with abnormally small terminal bulb, thick nucleated isthmus. Weakly cold sensitive. Makes dauers that don't recover; doesn't survive freezing well.
DA538 C. elegans adDf538 I. Show Description
Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. PKA phm-2(ad538).
DA572 C. elegans eat-4(ad572) III. Show Description
Starved appearance. Reverts spontaneously-Do not passage! Clone starved-looking progeny with abnormal fast pharyngeal pumping to maintain.
DA591 C. elegans unc-10(ad591) X. Show Description
Mild Unc-tends to form abnormally deep bends, especially when backing. Mild Eat.
DA612 C. elegans bli-4(e937) adDf538 I. Show Description
Blistered. Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. adDf538 previously called phm-2(ad538).
DA702 C. elegans eat-16(ad702) I. Show Description
Note: ad702 was isolated in an RC301 background. DA702 was not tested for the presence of npr-1(g320) following three rounds of outcrossing to N2 Bristol. DA702 does not display clumping behavior, so it's likely that DA702 has the Bristol npr-1. New stock rec'd 10/13/99.
DA707 C. elegans eat-17(ad707) X. Show Description
Eat mutant. Stuffs corpus and isthmus. Abnormality in m6 and m7 contraction timing. Displays clumping behavior; isolated in an RC301 background, so it's likely to have the RC301 bor-1 mutation.
DA734 C. elegans adDf538 unc-101(m1) I. Show Description
Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. Unc. adDf538 previously called phm-2(ad538).
DA810 C. elegans egl-30(ad810) gpb-2(ad541)/gpb-2(ad541) I. Show Description
ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2. gpb-2 phenotype is rather subtle: they are slightly starved, slightly longer than normal, and tend to be loopy in their movements (they make abnormally deep bends). Hets should be Egl and non-Eat. On most E. coli strains gpb-2 grows rather poorly, especially if the plates are older so that there is a thick and tough lawn. On such plates there will be a lot of gpb-2 larval arrest, and those that don't arrest will grow slowly. The hets should easily outgrow the gpb-2 homozygotes. [gpb-2 is also hypersensitive to the drug arecoline: they won't grow on 5 mM. The hets will grow even better than WT on 5 mM arecoline.] gpb-2(ad541) previously called eat-11(ad541).
DAG355 C. elegans lite‐1(ce314) X; domIs355. Show Description
domIs355 [mec‐3p::QF + mec‐4p::QS + QUAS::CoChR::GFP + unc122p::RFP]. High sensitivity blue-light optogenetic line for FLP neurons. Transgenic animals expressing the high-sensitivity blue light-activated channelrhodopsin CoChR into FLP using the Q-system combining mec-3p and mec-4p promoters. In animals grown on all trans-retinal-containing medium, low intensity blue light stimuli trigger reversal responses. Animals have red coelomocytes. The transgene was integrated with UV, and outcrossed 2x to parental ce314 mutant strain KG1180. Reference: Schild LC & Glauser DA. Genetics. 2015 Aug;200(4):1029-34. doi: 10.1534/genetics.115.177956. PMID: 26022242.
DCL569 C. elegans mkcSi13 II; rde-1(mkc36) V. Show Description
mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans."
DCR1337 C. elegans nsIs105 I; cima-1(wy84) IV; wyIs45 X; olaEx805. Show Description
nsIs105 [hlh-17p::GFP] I. wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx805 [hlh-17p::caspase12 + hlh-17p::caspase17 + ttx-3p::mCherry + glr-3p::mCherry + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Ablation of CEPsh glia partially suppresses AIY presynaptic maintenance defects in cima-1(wy84) mutants. nsIs105 (hlh-17::GFP) expression labels CEPsh glia. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR4521 C. elegans atg-9(ola274[atg-9::gfp]) V. Show Description
This endogenous tag on ATG-9 was made from a CRISPR event that used a method described by Dickinson et al. 2015 to efficiently insert GFP in replace of the stop codon of atg-9. Reference: Stavoe AK, et al. Dev Cell. 2016 Jul 25;38(2):171-85.
DCR8881 C elegans olaEx5329. Show Description
olaEx5329 [rab-3p::HYlight + elt-7p::mCherry]. Pick mCherry+ animals to maintain. Pan-neuronal expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527.
DCR8892 C elegans olaEx5331. Show Description
olaEx5331 [rab-3p::HYlight-RA + elt-7p::mCherry]. Pick mCherry+ animals to maintain. Pan-neuronal expression of HYlight-RA, a reduced affinity version of the FBP biosensor that does not respond to changes in concentration of the FBP metabolite during hypoxia in vivo. Can be used as a negative control for HYlight sensor in strain DCR8881. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527.