Strain Information
| Name | CX6448 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | gcy-35(ok769) I. |
| Description | 668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'. |
| Mutagen | UV/TMP |
| Outcrossed | x6 |
| Made by | Jesse Gray |
| Laboratory | CX |
Sign in
or
register an account if you want to order this strain.