Strain Information
| Name | EJ1167 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | gem-1(bc364) X. |
| Description | bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. |
| Mutagen | EMS |
| Outcrossed | x4 |
| Made by | Eric Lambie |
| Laboratory | EJ |
Sign in
or
register an account if you want to order this strain.