Unc-kinky backing. Slow moving.

Unc. Recessive. M-MATING++ 1-10%WT.

T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu

sIs10341 [rCes T04D1.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

DpyUnc. ad592 is Eat. Dpy is semi-dominant.

otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx5886 [unc-57(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

oxIs565 [dpy-30p::frt::mCherry::frt::GFP::H2B + Cbr-unc-119(+)] II. Ubiquitous mCherry expression. Green nuclei after FLP activity. Integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Combined fluorescent balancer strain for LG II, LG III and LG IV.

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Him. Combined fluorescent balancer strain for LG II, LG IV and LG V. Strain contains him-5(e1490) to generate males for crosses.

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG II, LG III and LG IV. Strain contains him-5(e1490) to generate males for crosses.

oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG I, LG II and LG IV. Strain contains him-5(e1490) to generate males for crosses.