| TV30179 |
C. elegans |
unk-1(wy2110[unk-1::mNeonGreen::AID*::3xFLAG]) X. Show Description
mNeonGreen::AID*::3xFLAG tag inserted at C-terminus of endogenous unk-1 locus. Reference: Gitler L, et al. MicroPubl Biol. 2025 Jun 11;2025:10.17912/micropub.biology.001659. doi: 10.17912/micropub.biology.001659. PMID: 40575442.
|
|
| TWH211 |
C.elegans |
hrpr-1(yyz8) I; sid-1(pk3321) uIs69 V; egIs1. Show Description
uIs69 [(pCFJ90) myo-2p::mCherry + unc-119p::sid-1]. egIs1 [dat-1p::GFP]. hrpr-1 also known as hrp-2. Derived from parental strain TU3401, which has been reported as showing RNAi response in non-neuronal tissues.
|
|
| TY1077 |
C. elegans |
C25D7.12(y128) unc-76(e911)/sdc-3(y52) unc-76(e911) V; xol-1(y9) X. Show Description
Heterozygotes are Unc and segregate Uncs, Dpy Uncs [C25D7.12(y128) unc-76(e911) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| TY1313 |
C. elegans |
yDf11 V/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. yDf11 homozygotes arrest as dead eggs.
|
|
| TY1388 |
C. elegans |
C25D7.12(y128)/sdc-3(y52) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Dpys [C25D7.12(y128) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| TY1911 |
C. elegans |
yDp6 (X;A); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodites. yDp6 is homozygous viable. yDp6/+ XO animals are fertile males.
|
|
| TY1916 |
C. elegans |
yDp11 (X;IV); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodite strain. yDp11 is homozygous viable. yDp11/+ XO animals are fertile males.
|
|
| TY4236 |
C. elegans |
him-8(e1489) IV; mIs10 V. Show Description
mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Him. mIs10 suppresses recombination between unc-60 and dpy-11.
|
|
| TY4949 |
C. elegans |
spo-11(me44) rec-8(ok978)/nT1 IV; +/nT1[qIs51] V. Show Description
Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF, et al. Genes Dev. 2009 Aug 1;23(15):1763-78.
|
|
| TY5124 |
C. elegans |
spo-11(me44) rec-8(ok978)/nT1 IV; coh-4(tm1857) coh-3(gk112)/nT1[qIs51] V. Show Description
Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.
|
|
| TY5425 |
C. elegans |
spo-11(me44)/nT1 IV; coh-4(tm1857) coh-3(gk112)/nT1[qIs51] V. Show Description
Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.
|
|
| TY832 |
C. elegans |
yDf4/dpy-11(e224) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
|
|
| TY873 |
C. elegans |
yDf6/unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Unc, and dead eggs. Maintain by picking WT.
|
|
| TY903 |
C. elegans |
yDf7/unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Unc and dead eggs. Maintain by picking WT.
|
|
| TY956 |
C. elegans |
sdc-3(y132)/unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Unc and Dpy (sdc-3/sdc-3). sdc-3 homozygotes exhibit a strong maternal effect lethality->most progeny from homozygotes arrest as L1 larvae--about 14% escape the lethality and develop into Dpy, Egl hermaphrodites.
|
|
| UDN100022 |
C. elegans |
rab-5(udn11)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658
|
|
| UDN100138 |
C. elegans |
rab-5(udn11) I; udnSi38 II. Show Description
udnSi38 [rab5p::rab-5] II. rab-5[D135D]. rab-5 Control edit #1 with a single
copy of wild-type rab-5 integrated into chromosome II at ttTi5605 site (II: 0.77). Maintain at 20 degrees. Wild-type looking.
|
|
| UE103 |
C. elegans |
oaSi10 II; par-2(or640) unc-119(ed3) III. Show Description
oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. Maintain at 15C. Temperature-sensitive embryonic lethal. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE50 |
C. elegans |
oaSi10 II; unc-119(ed3) III. Show Description
oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE51 |
C. elegans |
oaSi13 II; unc-119(ed3) III. Show Description
oaSi13 [par-5p::GFP::par-5::par-5 3' UTR(splice bias) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE52 |
C. elegans |
oaSi11 II; unc-119(ed3) III. Show Description
oaSi11 [par-5p::par-5::par-5 3' UTR.2(prespliced) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE56 |
C. elegans |
oaSi10 II; unc-119(ed3) III; ddIs26. Show Description
ddIs26 [pie-1p::mCherry::par-6 + unc-119(+)]. oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE58 |
C. elegans |
oaSi10 II; unc-119(ed3) III; ltIs37 IV. Show Description
oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE59 |
C. elegans |
oaSi10 II; unc-119(ed3) III; axIs1929. Show Description
oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. axIs1929 [nmy-2::GFP + mCherry::par-2]. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE69 |
C. elegans |
oaSi16 II; unc-119(ed3) III. Show Description
oaSi16 [par-5p::par-5::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE72 |
C. elegans |
oaSi17 II; unc-119(ed3) III. Show Description
oaSi17 [par-5p::GFP::par-5::par-5 3' UTR(mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the long PAR-5 3'UTR isoforms (utr.1 and utr.2). Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE75 |
C. elegans |
oaSi20 II; unc-119(ed3) III. Show Description
oaSi20 [par-5p::GFP::par-5::par-5 3' UTR(mutated splice sites, mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.1 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE77 |
C. elegans |
oaSi22 II; unc-119(ed3) III. Show Description
oaSi22 [par-5p::par-5::par-5 3' UTR(splice bias) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE79 |
C. elegans |
oaSi24 II; unc-119(ed3) III. Show Description
oaSi24 [par-5p::GFP::par-5::par-5 3' UTR(truncated) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.3 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE84 |
C. elegans |
oaSi26 II; unc-119(ed3) III. Show Description
oaSi26 [par-5p::par-5(partially recoded)::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of partially recoded par-5 under its endogenous regulatory sequences to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE88 |
C. elegans |
oaSi30 II; unc-119(ed3) III. Show Description
oaSi30 [par-5p::par-5(partially recoded)::par-5 3' UTR(splice bias) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE89 |
C. elegans |
oaSi31 II; unc-119(ed3) III. Show Description
oaSi31 [par-5p::par-5(partially recoded)::par-5 3' UTR(truncated) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.3 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE92 |
C. elegans |
oaSi34 II; unc-119(ed3) III. Show Description
oaSi34 [par-5p::par-5(partially recoded)::par-5 3' UTR(mutated splice sites, mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.1 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE95 |
C. elegans |
oaSi37 II; unc-119(ed3) III. Show Description
oaSi37 [par-5p::par-5(partially recoded)::par-5 3' UTR(mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the long PAR-5 3'UTR isoforms (utr.1 and utr.2) to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UE98 |
C. elegans |
oaSi40 II; unc-119(ed3) III. Show Description
oaSi40 [par-5p::par-5(partially recoded)::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of partially recoded par-5 fused to GFP under its endogenous regulatory sequences to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| UJ1300 |
C. elegans |
unc-9(miz81[unc-9::7xGFP11]) X; juIs463. Show Description
juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. 7xGFP11 tag inserted into endogenous unc-9 locus. unc-9(miz81) is Unc, possibly due to increased channel activity. Reference: Hendi A, et al. Elife. 2022 Nov 15;11:e80555. doi: 10.7554/eLife.80555. PMID: 36378164.
|
|
| UJ1940 |
C. elegans |
syd-2(miz231[7xGFP11::syd-2]) X. Show Description
7xGFP11 tag inserted at 5' end of endogenous syd-2 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
|
|
| UJ2015 |
C. elegans |
rab-3(miz237[4xwrmScarlet11::rab-3b]) II. Show Description
4xwrmScarlet11 tag inserted inserted at 5' end of rab-3b locus using CRISPR/Cas9. Insertion confirmed by sequencing. wrmScarlet11::RAB-3B shows smaller RAB-3 puncta compared to over-expression reporters. The fusion protein is likely non-functional as the strain shows strong aldicarb resistance; however, the localization pattern of 4×wrmScarlet::RAB-3 is similar to that of transgenically expressed RAB-3. 4×wrmScarlet11::rab-3b strain also labels rab-3a; it is possible that 4×wrmScarlet11 inserted in the middle of rab-3a isoform disrupts the functions of RAB-3 in neurotransmission. Reference: Kurashina M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
|
|
| UJ2587 |
C. elegans |
elks-1(miz365[elks-1::7xGFP11]) IV. Show Description
7xGFP11 tag inserted into endogenous elks-1 locus. ELKS-1::7xGFP localizes to tip of synapses similar to CLA-1. miz365 genotyping primers: F: TACCGGCTCCAGTGATTCC / R: tgtgtgccattggatgtgag (wt = 203bp, mutant = 676bp). Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
|
|
| UJ2719 |
C. elegans |
unc-10(miz404[unc-10::7xGFP11]) X. Show Description
7xGFP11 tag inserted into endogenous unc-10 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
|
|
| UJ2820 |
C. elegans |
cla-1(miz321[cla-1::7xGFP11]) IV. Show Description
7xGFP11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
|
|
| UJ3045 |
C. elegans |
rimb-1(miz458[7xGFP11::rimb-1]) III. Show Description
7xGFP11 tag inserted into 5' end of endogenous rimb-1 locus using CRISPR/Cas9. Reference: Kurashina M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
|
|
| UJ3103 |
C. elegans |
sng-1(miz488[sng-1::4xmScarlet11]) X; mizIs41. Show Description
mizIs41 [mig-13p::mScarlet1-10::SL2::GFP1-10 + odr-1p::GFP]. 4xmScarlet11 tag inserted into endogenous sng-1 locus. miz488 genotyping primers: F: CGCACCTCCACCTCAATCC / R: AACACAACAAGACGGAAATACG. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
|
|
| UJ3233 |
C. elegans |
cla-1(miz378[cla-1::8xwrmScarlet11]) IV. Show Description
8xmScarlet11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
|
|
| UJ3321 |
C. elegans |
syd-2(miz329 [8xwrmScarlet11::syd-2]) X. Show Description
8xwrmScarlet11 tag inserted at 5' end of endogenous syd-2 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
|
|
| UL1 |
C. elegans |
leIs1 V. Show Description
leIs1 [pes-1::lacZ + rol-6(su1006)] V. Rollers. B-galactosidase expression begins in a subset of cells of the AB lineage which go on to produce muscle, nerve and hypodermal cells. B-galactosidase is also present within the D lineage until the cells move anteriorly to become body wall cells. Expression is also apparent in Z1 and Z4 which go on to form part of the somatic gonad. plasmid name: pUL#24C7. Plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.
|
|
| UL2992 |
C. elegans |
leEx2992. Show Description
leEx2992 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
| UL2994 |
C. elegans |
leEx2994. Show Description
leEx2994 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
| UL2996 |
C. elegans |
leEx2996. Show Description
leEx2996 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
| UL3294 |
C. elegans |
leEx3294. Show Description
leEx3294 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|