Strain Information
| Name | UJ2587 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | elks-1(miz365[elks-1::7xGFP11]) IV. |
| Description | 7xGFP11 tag inserted into endogenous elks-1 locus. ELKS-1::7xGFP localizes to tip of synapses similar to CLA-1. miz365 genotyping primers: F: TACCGGCTCCAGTGATTCC / R: tgtgtgccattggatgtgag (wt = 203bp, mutant = 676bp). Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Mizuki Kurashina |
| Laboratory | UJ |
| Reference | A modular system to label endogenous presynaptic proteins using split fluorophores in Caenorhabditis elegans. Kurashina M, Snow AW, Mizumoto K. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832 |
Sign in
or
register an account if you want to order this strain.