Search Strains

E01H11.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14C11.3. Superficially wild type. External left primer: GAATTTCGAGGAGAGCATCG. External right primer: TTTCTTGATTGGGAAATGCC. Internal left primer: ACGTGGAGTCAGAATGTCCC. Internal right primer: GGGGACGCAGAAAAATATCA. Internal WT amplicon: 3017 bp. Deletion size: 1894 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10H4.12. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1788 homozygotes (mildly Unc, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAACAAATCCACCCTGCATC. External right primer: TCGATTCACCACTGTTTTGC. Internal left primer: CATTGCTCGTCATGTTGGTT. Internal right primer: CCTCAACGCTTTGATAAGCC. Internal WT amplicon: 2200 bp. Deletion size: 1225 bp. Deletion left flank: CACTGCGGATCTGGGATTCAGGTACGCTGT. Deletion right flank: GTGTCACCGAATCAAGAAATCAATTATCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44C8.11. Superficially wild type. External left primer: ATGTTATCCTTCGGCCTGTG. External right primer: GCTAAATTTTGGGTGGCTGA. Internal left primer: GAGCCGAAGGTTTCCTGAAT. Internal right primer: ATTGTGGGCCGCTAAATATG. Internal WT amplicon: 1693 bp. Deletion size: 339 bp. Deletion left flank: TTACTCTTATATTTGGGCCTGCGCATTCCA. Deletion right flank: AAGTTTTTTGAGGGCTGCAGAGTGGTTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05D11.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y49A10A.1. [NOTE (10/28/11): Possible deletion/duplication event; genotype being confirmed by Moerman and DeStasio Labs] Superficially wild type. External left primer: GAAATTCATATCGCCCAGGA. External right primer: ACAGAAACGTAGCTGAGGGC. Internal left primer: ACCTTTCCATGTAACCCACG. Internal right primer: GGGTGATCAAAACGTTCCAT. Internal WT amplicon: 2286 bp. Deletion size: 1188 bp. Deletion left flank: ATTCCAAAAATGTCGTTTAGAAGTTTTGAA. Deletion right flank: GCTATTTTTGAAGAGGATCGCTCTTCCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52B9.11. Superficially wild type. External left primer: CCAAACGCACAGCAATTAAA. External right primer: ATTGTGCACTGCTGGTGAAG. Internal left primer: TCGTAAACTATGCAGCGCAC. Internal right primer: CCGCATTTAAACATGGAAGG. Internal WT amplicon: 2173 bp. Deletion size: 1435 bp. Deletion left flank: ATGCAAACACAAACTTTTTGTTTAGCATAT. Deletion right flank: TCGCTACTTTTTTGCTGTCTGTTCAACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48D6.1. External left primer: AACCCAGTTTGGCTTTTGTG. External right primer: ACTAAACTGCGCCGACATCT. Internal left primer: TAATGCAAATGGGAATGCAA. Internal right primer: CGGCAAATTGTTGATCACTG. Internal WT amplicon: 2477 bp. Deletion size: 583 bp. Deletion left flank: GAAGAAGCGTAAGATTTTATAGAAGAAGTA. Deletion right flank: GTGACATAAATGAGGAAGAAGCTAGCAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C53D5.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1795 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGGGGGAACAATGAGGACT. External right primer: AACCTCATCGACGATTCTGG. Internal left primer: GGGAGAAGTGGTGGAACAAA. Internal right primer: TGTTATCGCTTTCGCTGTTG. Internal WT amplicon: 3104 bp. Deletion size: 1411 bp. Deletion left flank: AGATTCTCGGAAGATTCTGATTTTCTGGTC. Deletion right flank: TTCATTCCGTCTCCGAGAAGGTTCAGGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48D6.1. External left primer: AACCCAGTTTGGCTTTTGTG. External right primer: ACTAAACTGCGCCGACATCT. Internal left primer: TAATGCAAATGGGAATGCAA. Internal right primer: CGGCAAATTGTTGATCACTG. Internal WT amplicon: 2477 bp. Deletion size: 794 bp. Deletion left flank: TACCAAGCATTGATTCAACAACATCAGCCG. Deletion right flank: ATATAATCAGATTCTAATGAAAAAAAGTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01B7.3, T01B7.4. Superficially wild type. External left primer: TTGCGGAATATCTGCCTTTC. External right primer: ACCCGCGCACTTTATTATTG. Internal left primer: TCTGAGAACGCGTATTGTGC. Internal right primer: GGAATGCTTTCGATGGCTAA. Internal WT amplicon: 2155 bp. Deletion size: 1096 bp. Deletion left flank: TTTTTATTTCGAGAACCCAGTTCTTAACCT. Deletion right flank: GAGAACTAATGACGTTGGAGACATTTATCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25D7.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T16G1.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M02H5.6. Superficially wild type. External left primer: AGATCTCCAACCAACCAACG. External right primer: GACCCGCAATTTTCACAGTT. Internal left primer: TGCCAATTATGCTTCCATCA. Internal right primer: CATGACCATGTCATCCTTGC. Internal WT amplicon: 2395 bp. Deletion size: 1560 bp. Deletion left flank: ATCCCGGCACATTTTTGAATGCTTAAAGTA. Deletion right flank: AATAAGACTAATGAAATAGGTTCACTTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1911 homozygotes (mid- to late-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATGTTTCAACAAGCAGCGA. External right primer: AGTGGCACGGATAAGGATTG. Internal left primer: CACAACCGCAACAAATGAAC. Internal right primer: GATGAGTGATTCCAGGCGTT. Internal WT amplicon: 3035 bp. Deletion size: 918 bp. Deletion left flank: ATGAAGTACGTACACAATTCTCAAAGTATT. Deletion right flank: AATTAATTGCAACAATGTATCAAACTGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03G5.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1908 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACGAAGGCAAACTGGTGAC. External right primer: CTACGAGCGGTTCATTTGGT. Internal left primer: AATAGGAGCGGACCTTTGGT. Internal right primer: GCAATTCCGCACGTTTATCT. Internal WT amplicon: 2954 bp. Deletion size: 1211 bp. Deletion left flank: GACGAAGCTCGGCAGTTGAGATGTCTCCCT. Deletion right flank: GCATTACAATTAAAATATTCTGATTAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09H11.3. Superficially wild type. External left primer: TTTAAGATTCGCCAGCCTGT. External right primer: GACCTCAGCGCATTTGTGTA. Internal left primer: GTCGTTACATCCTCGTCGGT. Internal right primer: TTCCTCGATGCTCTTCGTTT. Internal WT amplicon: 3077 bp. Deletion size: 1648 bp. Deletion left flank: TACGACTGGACACACTGCCGAGCCATCCAA. Deletion right flank: TGCCAAAGAAAATGAACCGATCGGGAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 1602 bp. Deletion left flank: CGTTTCCGATCCATCGGATGGATTCAGGAG. Deletion right flank: AACTGGGAAATTGGATTTAAAAATTGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59E11.11. External left primer: CGGAATATCCAAAAGGCTGA. External right primer: GGAAAAATCATTCAAGGCGA. Internal left primer: CGAAACCACAAATTGCTGAA. Internal right primer: CCATATGCATTGCGACTGAG. Internal WT amplicon: 2168 bp. Deletion size: 672 bp. Deletion left flank: CTTTTTTTCGAAACAAAATTAGATGAGGAA. Deletion right flank: AGAATAATGAACAAAACACAAAATTCTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33D11.11. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1411 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCCGAGATAATACGGCGA. External right primer: ACGCTTGCCTCTAGGCACTA. Internal left primer: TTGGGGGAACGGGGAACCAT. Internal right primer: TAGGCACTAAGCACTGGCCA. Internal WT amplicon: 1799 bp. Deletion size: 657 bp. Deletion left flank: CCTCGTTCCTAACCGCAAAGGTTTTTGTAT. Deletion right flank: TGTTTTTTTTCTATTGGTATTTACGTACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK856.9, ZK856.13. mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs10 homozygotes), and non-GFP sterile Uncs with a vulval blip (gk144 homozygotes). mIs10 suppresses recombination from unc-60 to about dpy-11 on LG V, and does not balance gk144 perfectly, but this strain is not difficult to keep. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10D3.3. External left primer: GTCAACTGATATGAGCGGCA. External right primer: CGCGTAATCTTTTTCTTCGC. Internal left primer: GAACATGGCCCTGAAATGAT. Internal right primer: GGCGCTATTCAGCTTTCAAT. Internal WT amplicon: 2230 bp. Deletion size: 1887 bp. Deletion left flank: TGACTGATAATTTTTTAAAAACCCGAATAA. Deletion right flank: GAGAAATCGTTGACGGACAGGGAACTAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1967 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAACTAACGGCTTTGC. External right primer: TTGCTCGATTCACACGAAAC. Internal left primer: TGGAGGAATTGTTGCAGTGA. Internal right primer: CCGGAAGGTTGTAGTCGTTG. Internal WT amplicon: 4083 bp. Deletion size: 1709. Deletion left flank: TTAGCTGGAGCGAATAACGATCGGAAAGTT. Deletion right flank: AAATATAACATTTTACAGTTTTCGTTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07A11.3. Superficially wild type. External left primer: TCACGTGAAACCCACAGAAA. External right primer: CTTCCAACTCCTTCGACGAC. Internal left primer: TGTCTGTGAAAGATCGACCG. Internal right primer: CGATATTCCTCAAGGGCAAA. Internal WT amplicon: 2771 bp. Deletion size: 1291 bp. Deletion left flank: AGCCCAAGTTTCAGAGCAATAGTGATCATG. Deletion right flank: TGTCATCTGGTAGTACTTTGCGCGTCGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32H5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2017 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTGACAGAGACTTCGG. External right primer: GAGTTCGCGGAAATTTATGG. Internal left primer: CTAGACGGCGATACCTGGAA. Internal right primer: TTTCCAACATCCCTGGAGAG. Internal WT amplicon: 2266 bp. Deletion size: 1489 bp. Deletion left flank: ATCGTAAGAAATCATACCATTCTCTCCAAA. Deletion right flank: GTTTCCGCTTTCCATAGTTTCTGTTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07C5.4. External left primer: TTGCTCAAAAGAAGCGGAAT. External right primer: TGGTTATGCGTCCAGTGAGA. Internal left primer: ACAAGCCTAATCTGCATGGG. Internal right primer: TGTGACGTCTGCAACAATCC. Internal WT amplicon: 2331 bp. Deletion size: 1279 bp. Deletion left flank: GATAAAATCATACTAAGCTGTCTGAAGACA. Deletion right flank: AAACAATCAACGAAAAATTAGAGTTCGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 307 bp. Deletion left flank: TGCAAAGTATTTCACTACAGTTTTACTGTA. Deletion right flank: GCTTAATCCTGCTAGACTTCTACCACAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52E4.6. Superficially wild type. External left primer: GAAGAGGATGGGGAGAGGTC. External right primer: GCAATTTTCGCCTGTCAAAT. Internal left primer: CCCCAAAATGACACAAATCC. Internal right primer: GAAGCGCCTCTTCTGAATTG. Internal WT amplicon: 3228 bp. Deletion size: 1511 bp. Deletion left flank: TTCTTCTTTCGGAGTTGATCATCTGAAAAT. Deletion right flank: ATTTTGTTCTTTTGGCTAAAAATACATAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33E11.1. External left primer: GGACACACGTTCATAATGCG. External right primer: ACTTGACGGGAATGTTTTCG. Internal left primer: GGGCTCCACATCTTTGCTTA. Internal right primer: ATGTTATGAAGGTGGCCGAG. Internal WT amplicon: 2369 bp. Deletion size: 2143 bp. Deletion left flank: CGTTTGTCCCGTTGTCCCGTTTTTTGAGTG. Deletion right flank: GTGAAATTTGATGCAGATAAAATTTTGTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M142.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk709 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTTCCCCTCTTCTATTGGC. External right primer: CGACACGCAACACCAATTAC. Internal left primer: AATCCACCGTAGTCACCGAG. Internal right primer: TCAGAGCATGTTTCCCAGTG. Internal WT amplicon: 2427 bp. Deletion size: 1019 bp. Deletion left flank: TAAATTTTTGTAGTTTTTTAGGGATTTTTT. Deletion right flank: TCACTTGTGGAGATGGTCGCCGCATCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20H11.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2058 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAATCGTATTGCTGCTTCCA. External right primer: CGGAGCTGGTGTAGGAAAAG. Internal left primer: GTCCATTCGAATCTTTCCGA. Internal right primer: TGCTGAACGTGATCTTCGAG. Internal WT amplicon: 3229 bp. Deletion size: 1540 bp. Deletion left flank: CACAGATTCTAGATGAAGTGATAAAATCCG. Deletion right flank: TTTTGAAGTTCTAAGACCATTCGTCCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38A5.13. External left primer: ATCCAACTCGGCATCATCTC. External right primer: AATGCAAATCCGCTCAATTC. Internal left primer: TGAAGTCGAATCTGCGAGTG. Internal right primer: GCGAGTTTCTTCAGACGCTT. Internal WT amplicon: 2118 bp. Deletion size: 563 bp. Deletion left flank: ATGGTCCAATATCAAGCCAGTGCCAGAACT. Deletion right flank: GCGTAAGCGTCTGAAGAAACTCGCTGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43E11.3. External left primer: TGGTGAGCCAGATCACACAT. External right primer: CGGAAAACGAAAAATCGAAA. Internal left primer: CACTGCATGCTTTTGCACTT. Internal right primer: TTCATCCATTTTCGCATTGA. Internal WT amplicon: 3224 bp. Deletion size: 1271 bp. Deletion left flank: TGCTGCTCATTTTTCATCGATTTTTCTTAG. Deletion right flank: AAATATATTTAATTGACTCCAATTTTTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13H10.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2135 homozygotes (sterile, oftein with abnormal vulva). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGCATGGACTTGAGGATTGG. External right primer: AATGGTGCCATCTATCAGGC. Internal left primer: TGAGCATCATTGGGAACAAA. Internal right primer: ATAACTCAAAAAGCGCCGAA. Internal WT amplicon: 3344 bp. Deletion size: 1311 bp. Deletion left flank: TTGTATCTGTAATAAAATCGAAAAAGTAAT. Deletion right flank: GAGCATTACAGAATGAGAAGTTTGAAGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42E11. External left primer: CACGCGTCTCTGAAAAATGA. External right primer: AAGAGCCAGCCTATCGTTCA. Internal left primer: GGCTTCAAACACCTCACCTC. Internal right primer: ATCAAGGGTCACCCAACAGA. Internal WT amplicon: 1609 bp. Deletion size: 419 bp. Deletion left flank: TCTTCTTCATGCATATTGTCTTCTTGCGCA. Deletion right flank: AAAAACTTGTTATAAATTTAAATTTTATGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47H4.7. External left primer: TCAGAGTGAACATTGCGGAG. External right primer: CCGACAATTTCAAATACGCC. Internal left primer: AAACTATCGCGGATGAATGG. Internal right primer: AATTGTTCCAGACGTGCCTC. Internal WT amplicon: 2940 bp. Deletion size: 638 bp. Deletion left flank: TTCAAAAACTGAAAGATAAACAAACCCCCG. Deletion right flank: TTTCCAGAGTTAAATCAAGCCTTCTTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk840) in F41G4.1, detectable by PCR using the following primers. External left primer: TCGTTCTTTCGTAAAACCCG. External right primer: TTCTGGCTTAAGCTGCCAAT. Internal left primer: GAAGGCAAATTGCTCAGCTC. Internal right primer: TTCAATGTGATCGTCTTCGC. Internal WT amplicon: 1889 bp. Deletion size: 925 bp. Deletion left flank: TGCAGTGTAGAGTCGGGTCAAAAAGACAAG. Deletion right flank: AAGATCAACTACACCAGTCCAATTTTCAAT. Insertion Sequence: ATCAACAAA. Validation: No CGH probes for gk840. Other deletions (gk3131, gk3132, gk3133) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2143 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1196 bp. Deletion left flank: TCTCCAAACTCACTTATTGGAAAAAGCGTC. Deletion right flank: ATAAGTGAGATATCGGCCAAGCAATAGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk828) in ZK185.2, detectable by PCR using the following primers. External left primer: AACCAAACGATGTCCCTGAC. External right primer: TCGGAAATGAAAACCCCATA. Internal left primer: TATTAGAGGCATATCGGCGG. Internal right primer: ATCACACCGGCGAGAATTAG. Internal WT amplicon: 1842 bp. Deletion size: 1014 bp. Deletion left flank: TTAAAGAATAAATATTTCATTTGGAAGCTC. Deletion right flank: AGGGGCGCGTTAAGAAATCTTGGGTCTTTA. Validation: No CGH probes for gk828. Other deletion (gk3130) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01B11.3, T01B11.4. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs11 homozygotes), and non-GFP sterile ok372 homozygotes. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13A2.8, Y47D7A.3. External left primer: ACTTCATCTGAATCGCCACC. External right primer: AATGGTTTTGACACCGCTTC. Internal left primer: TTATCAGATGCTGGTCCACG. Internal right primer: TGGTTGAAAGTTGGTGTCCA. Internal WT amplicon: 2061 bp. Deletion size: 1042 bp. Deletion left flank: AGTCGATTTATTCCTGACCCAAGTGGTATA. Deletion right flank: GCATCCCTTGTTCCATCTCCAAAATTGTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk843) in F21D12.1, detectable by PCR using the following primers. External left primer: CTCTTCTCAGCTCCACCCAC. External right primer: ACCGAGATGCACTTTTTGCT. Internal left primer: ACGCTCTCCGTCTAATCCAA. Internal right primer: ATCACGTGCCTCATTGAGAA. Internal WT amplicon: 2296 bp. Deletion size: 1088 bp. Deletion left flank: AAATTCATATAGTTGAAAAGTTTGTTTCAT. Deletion right flank: AGAGGCGTAACAGAATTATCCGTTGAAACT. Validation: gk843 passed by CGH. Other deletion (gkDf28) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44E2.8, F44E2.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2134 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCTGGTTGGTTTCACCAT. External right primer: ATATGTGGAACTTGCCGGAG. Internal left primer: CATTGGAGAGAGCTTAGGCG. Internal right primer: TCGTTTTTAAATTTCCGCCA. Internal WT amplicon: 2111 bp. Deletion size: 1195 bp. Deletion left flank: TTTTTGTCGAACTTCATTCTTTACTTTACT. Deletion right flank: GGAAATAAAATCGATAAAAACTTTAAAATT. Insertion Sequence: CACGACTTCCTGTTTCTTCAGAAAAACTCTGAATGGCCGTTTCCCATTTTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12C11.2. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous ok359 hermaphrodites (sterile with one or more vulval blips). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C11.9. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2464 homozygotes (sterile Dpy). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCTCGCCAACAAGACTGT. External right primer: TCCGAAAAGAATCATGGAGG. Internal left primer: ATTTCAGACCCCAGCATTTG. Internal right primer: TACAGCTCATGAAGGCGAGA. Internal WT amplicon: 1152 bp. Deletion size: 357 bp. Deletion left flank: AACGTTTTTCATGGGACTGAGAGTTGGAAA. Deletion right flank: ACCAAGGCTATCCCACACTTCTGGGAGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39H11.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2247 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACTTCGTCGTGAGCATTCA. External right primer: ATTCTTAACCGTGCGACACC. Internal left primer: CATCATAAAGCATGTGCGCT. Internal right primer: TGTCGCTGCTCAGAAGAAGA. Internal WT amplicon: 2222 bp. Deletion size: approximately 400 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2213 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1051 bp. Deletion left flank: TGGGATGAATTTATGTGCAACATGCTCGTA. Deletion right flank: ACATTTTTATCATTATAACGAATATTCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E11.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2235 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGAGCCGCTCAACACAGTT. External right primer: CGTCGGGCAATAGTAGAGGA. Internal left primer: CGTACAAACATATTGCCCCC. Internal right primer: ACTCACACAAACTGGGGAGG. Internal WT amplicon: 3315 bp. Deletion size: 2275 bp. Deletion left flank: TAGTAATTTTTTTAAGCCAAAAGCTCCTTC. Deletion right flank: TCAAGACCGGATACAGTAATTTTGACGCAA. Insertion Sequence: AGCTCCTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01B12.2. External left primer: AGACGCCATGATTTTCAACC. External right primer: AACCGTAATGGGACAGCTTG. Internal left primer: GAACCTGCGGTTCAAACAAT. Internal right primer: AGGGAGTGAGCGAGAAACAA. Internal WT amplicon: 2259 bp. Deletion size: 561 bp. Deletion left flank: AAACGTGGTTTTGCCCGAGTTCTCTGAAAC. Deletion right flank: AAGCAATTTACTCAAATTATTTCAGTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T04A11.6. Him. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807