| RM2710 |
C. elegans |
snf-11(ok156) V. Show Description
Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
|
|
| RM2711 |
C. elegans |
unc-25(e156) III; snf-11(ok156) V. Show Description
Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
|
|
| RM2717 |
C. elegans |
snf-3(ok293) II; unc-25(e156) III; snf-11(ok156) V. Show Description
Superficially the same as unc-25 mutants (Shrinker, Exp, etc.). Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 and unc-25; snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
|
|
| RM2718 |
C. elegans |
snf-3(ok293) II; snf-11(ok156) V. Show Description
Superficially wild-type. Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
|
|
| RP2682 |
C. elegans |
mev-1(tr395) III. Show Description
Homozygous viable. mev-1(tr395) is a G398A (G133E) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2696 |
C. elegans |
sdhb-1(tr405) II. Show Description
Homozygous viable. sdhb-1(tr405) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2697 |
C. elegans |
sdhb-1(tr406) II. Show Description
Homozygous viable. sdhb-1(tr406) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2698 |
C. elegans |
mev-1(tr407) III. Show Description
Homozygous viable. mev-1(tr407) is a G221A (R74K) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2699 |
C. elegans |
mev-1(tr408) III. Show Description
Homozygous viable. mev-1(tr408) is a G230A (G77D) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2700 |
C. elegans |
sdhd-1(tr409) II. Show Description
Homozygous viable. sdhd-1(tr409) is a T252A (H84Q) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2702 |
C. elegans |
mev-1(tr410) III. Show Description
Homozygous viable. mev-1(tr410) is a T407C (F136S) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2703 |
C. elegans |
sdhb-1(tr411) II. Show Description
Homozygous viable. sdhb-1(tr411) is a T779A (I260N) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2706 |
C. elegans |
sdhb-1(tr414) II. Show Description
Homozygous viable. sdhb-1(tr414) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP3439 |
C elegans |
tris113. Show Description
trIs113 [abu-14p::abu-14::GFP + rol-6(su1006)]. Rollers. Integrated line generated from an extrachromosomal array provided by David Raizen. References: George-Raizen JB, et al. Biol Open. 2014 Oct 31;3(11):1139-49. PMID: 25361578. Kamal M, et al. bioRxiv 2022.04.11.487937; doi: https://doi.org/10.1101/2022.04.11.487937.
|
|
| RP3497 |
C elegans |
idpc-1(knu1089[Y47D3B.6::mGreenLantern]) III. Show Description
mGreenLantern tag inserted at the C-terminus of the endogenous idpc-1/Y47D3B.6 locus. mGreenLantern expression in the pharyngeal cuticle. Reference: Kamal M, et al. "A Spatiotemporal Reconstruction of the C. elegans Pharyngeal Cuticle Reveals a Structure Rich in Phase-Separating Proteins." https://www.biorxiv.org/content/10.1101/2022.03.11.483951v1
|
|
| RP3498 |
C elegans |
trEx1001. Show Description
trEx1001 [idpb-3p::idpb-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
|
|
| RP3510 |
C elegans |
trEx1010. Show Description
trEx1010 [pgp-14p::sms-5B(genomic)::Flag::mCherry + pgp-14p::YFP::pgp-14]. Pick animals with mCherry+ pharynx to maintain. Fluorescence is more apparent in older animals (late stage larvae to young adults). Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
|
|
| RP3513 |
C elegans |
trEx1006. Show Description
trEx1006 [fipr-4p::fipr-4::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
|
|
| RP3515 |
C elegans |
trEx1008. Show Description
trEx1008 [idpa-3p::idpa-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
|
|
| RSL11 |
C. elegans |
unc-94(ftw3[GFP::unc-94]) I. Show Description
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. Green fluorescence is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. Not visible on fluorescent dissection microscopes. Outcrossed parental strain RSL3 with N2. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RSL111 |
C. elegans |
rab-3(ftw74[rab-3::SL2::LoxP::GFP::dpy-10::LoxP(inv)]) II. Show Description
rab-3(ftw74[rab-3::SL2::LoxP::GFP::dpy-10::LoxP(inv)]) II. Endogenous locus co-expresses GFP by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. dpy-10 CRISPR/Cas9 entry site is located downstream of the GFP coding region. Inverted LoxP sites flank the GFP::dpy-10 insert. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RSL123 |
C. elegans |
dpy-10(cn64) rab-3(ftw79) II. Show Description
rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RSL94 |
C. elegans |
unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. Show Description
Severing and tagging of endogenous locus with trans-splicing ICR and GFP using CRISPR/Cas9. Pharynx and body muscles are green fluorescent and visible by dissection fluorescence microscopy. Severing is located upstream of kinase domain. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RSL98 |
C. elegans |
muIs252 II; unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. Show Description
Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Pharynx and body muscles are green and red fluorescent and visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RSL99 |
C. elegans |
muIs257 I; unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. Show Description
Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Pharynx and body muscles are green; red fluorescence only in body wall muscles. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RT311 |
C. elegans |
unc-119(ed3) III; pwIs69. Show Description
pwIs69 [vha-6p::GFP::rab-11 + unc-119(+)]. Likely integrated into LG X (based on user observations).
|
|
| RW10238 |
C. elegans |
unc-119(ed3) III; zuIs178; stIs10190. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10190 [C08B11.3::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
|
|
| RW10249 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10218. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10218 [tbx-11::H1-wCherry + unc-119(+)].
|
|
| RW10349 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10311. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10311 [lin-39::TGF(3D3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10429 |
C. elegans |
unc-119(ed3) III; gaIs269. Show Description
gaIs269 [nhr-23::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in fosmid P000006_G11.
|
|
| RW10493 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10472. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10472 [lin-11::TGF(7H3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10611 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10692. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10692 [dve-1::H1-wCherry + unc-119(+)].
|
|
| RW10711 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10637. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10637 [lin-32::H1-wCherry + unc-119(+)].
|
|
| RW11085 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10934. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10934 [hmg-11::H1-wCherry + unc-119(+)].
|
|
| RW11141 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10915. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10915 [F17C11.1::H1-wCherry + unc-119(+)].
|
|
| RW11363 |
C. elegans |
unc-119(ed3) III; stIs11363. Show Description
stIs11363 [T01B11.2::H1-wCherry + unc-119(+)].
|
|
| RW11366 |
C. elegans |
unc-119(ed3) III; stIs11366. Show Description
stIs11366 [T01B11.2::H1-wCherry + unc-119(+)].
|
|
| RW11582 |
C. elegans |
unc-119(tm4063) III; stIs11582. Show Description
stIs11582 [F13D11.1::H1-wCherry + unc-119(+)].
|
|
| RW11616 |
C. elegans |
unc-119(tm4063) III; stIs11616. Show Description
stIs11616 [K09A11.1::H1-wCherry + unc-119(+)].
|
|
| RW11777 |
C. elegans |
unc-119(tm4063) III; stIs11777. Show Description
stIs11777 [F13D11.2a::H1-wCherry + unc-119(+)].
|
|
| RW11811 |
C. elegans |
unc-119(tm4063) III; stIs11811. Show Description
stIs11811 [ceh-22::H1-wCherry + unc-119(+)].
|
|
| RW11851 |
C. elegans |
unc-119(tm4063) III; stIs11851. Show Description
stIs11851 [R05D11.1::H1-wCherry + unc-119(+)].
|
|
| RW11911 |
C. elegans |
unc-119(tm4063) III; stIs11911. Show Description
stIs11911 [F11A1.3a::H1-wCherry + unc-119(+)].
|
|
| RW11952 |
C. elegans |
unc-119(tm4063) III; stIs11952. Show Description
stIs11952 [F29F11.5a::H1-wCherry + unc-119(+)].
|
|
| RW12011 |
C. elegans |
unc-119(tm4063) III; stIs12011. Show Description
stIs12011 [Y59A8B.13a::H1-wCherry + unc-119(+)].
|
|
| RW12211 |
C. elegans |
ceh-20(st12211[ceh-20::TY1::EGFP::3xFLAG]) III. Show Description
ceh-20(st12211[ceh-20::TY1::EGFP::3xFLAG]) III.
|
|
| RW12291 |
C. elegans |
Y48G9A.11(st12291[Y48G9A.11::TY1::EGFP::3xFLAG]) III. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
|
|
| RW12311 |
C. elegans |
hmg-1.1(st12311[TY1::EGFP::3xFLAG::hmg-1.1]) II. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
|
|
| RW12337 |
C. elegans |
dnj-11(st12337[TY1::EGFP::3xFLAG::dnj-11]) IV. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
|
|
| RW20032 |
C. briggsae |
Cbr-unc-119(st20000) III; stIs20032 V. Show Description
stIs20032 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0.14 and 4.32 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
