Search Strains

C-terminal tag of F13E6.1 via CRISPR/Cas9 knock-in of mNeonGreen at F13E6.1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AAATCGTGCTCTCCCAAGCA 3’; rev – 5’ CTTGTCACCTGACGGGATGT 3’. Left flank: 5' CCAGTTGCGGAGGAGGCGAAGCCAATCTCT 3' (1 silent mutation); Right flank: 5' TAAattcattcatttcacataccaatatgt 3'; sgRNA: atgaatTTAAGAGATTGGCT; Cas9/sgRNA plasmid: pGLOW26; mNG^SEC^3xFlag plasmid: pGLOW104; SEC insertion allele strain: GLW94.

dvIs100 [unc-54p::A-beta-1-42::unc-54 3'-UTR + mtl-2p::GFP]. mtl-2p::GFP produces constitutive expression of GFP in intestinal cells. unc-54p::A-beta-1-42 expresses full-length human A-beta-1-42 peptide in bodywall muscle cells that aggregates in vivo. Shifting L4 or young adult animals from 20C to 25C causes paralysis. Reference: McColl G, et al. Mol Neurodegener. 2012 Nov 21;7:57.

pgIs2 [gcy-8p::TU#813 + gcy-8p::TU#814 + unc-122p::GFP + gcy-8p::mCherry + gcy-8p::GFP + ttx-3p::GFP]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the gcy-8 promoter. Expression of GFP in coelomocytes and AIY neuron, and mCherry in AFD neuron when caspase activity is lost. Reference: Glauser DA, et al. Genetics. 2011 May;188(1):91-103.

pgEx116 [unc-70::TSmod + myo3p::mCherry]. Pick animals with red fluorescence in body wall muscle to maintain array. The tension sensor module (TSMod) was inserted into the coding sequence of unc-70. TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, which acts as an entropic nanospring suitable for estimating biologically relevant forces. Reference: Krieg M, et al. Nat Cell Biol. 2014 Mar;16(3):224-33.

pgIs22 [unc-70::N-TSmod]. oxIs95 [pdi-2p::unc-70 + myo-2p::GFP]. The tension sensor module control (N-TSMod) was inserted at the N-terminus of unc-70. N-TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, but is placed at the N-terminus of UNC-70 where it is not sensitive to force. pgIs22 was a spontaneous insertion of pgEx157. Reference: Kelley M, et al. Elife. 2015 Mar 23;4.

Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous che-3 locus at the N-terminus and tagRFP::3xFlag inserted into the endogenous xbx-1 locus at the C-terminus by Cas9-triggered homologous recombination. Fluorescence enriched in most if not all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous klp-20 gene at its C-terminus, tagRFP::3xFlag inserted into the endogenous xbx-1 gene at its C-terminus and tagBFP inserted into the endogenous ift-81 gene at its C-terminus by Cas9-triggered homologous recombination. GFP enriched at the proximal region (middle segment) of amphid or phasmid sensory cilia while red and blue fluorescence enriched along the whole cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

GFP inserted into the endogenous ift-74 locus at the C-terminus by Cas9-triggered homologous recombination. Green fluorescence enriched in most, if not, all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

GFP inserted at the N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

unc-70(cas1050) removes nine amino acids (H590-L598) in the SCA5-associated deletion in ?-spectrin and inserts GFP at N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

Mutation resulted from the imprecise loss of pk37::Tc1. Incompletely penetrant sterile and lethal. Defects in oocyte cell cycle arrest, gonad migration, and hypodermal differentiation. See also WBPaper00002965.

age-1(mg44) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive); can be rescued zygotically. age-1(mg44) homozygous animals that are maternally rescued for dauer formation are long-lived. mg44 is a Trp405 Amber mutation. Heterozygotes are WT and segregate WT (1/3 of which throw only dauers) and DpyUncs.

mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers.

mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.

No visible phenotype. Dominant suppressor of daf-c phenotype of age-1.

No visible phenotype. Dominant suppressor of daf-c phenotype of age-1. Ala303Val substitution.

Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.

mgEx470 [pdk-1(+) + ttx-3::GFP]. Pick GFP+ to maintain. 9.2-kb PCR product of genomic DNA from the pdk-1(+) genomic region containing 2.7 kb of 5' upstream regulatory sequence, 6.1 kb of coding sequencing containing introns and exons, and 0.4 kb of pdk-1 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.

yzIs71 [tph-1p::GFP + rol-6(su1006)] V. Rollers. tph-1 transcriptional reporter containing 3.1kb of tph-1 5’ regulatory sequence through the beginning of exon 4. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Sze JY, et al. Nature. 2000 Feb 3;403(6769):560-4.

Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366).

Enhances retarded differentiation of the hypodermis and exit from the molting cycle caused by mutations in let-7 or its paralogs. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.

Weakly retarded differentiation of the hypodermis and exit from the molting cycle. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.

Retarded differentiation of the hypodermis and supernumerary molt that results in adult lethality. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.

veIs13 [col-19::GFP + rol-6(su1006)] V. mgEx725 [lin-4::let-7 + ttx-3::RFP]. Pick RFP+ to maintain. mgEx725 rescues lethality of let-7(mn112). Precocious expression of col-19::GFP at the L4 stage. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.

Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.

Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.

mgIs45 [mir-84(over-expressing) + tub-1::GFP] I. wIs54 [scm::GFP] V. Maintain by picking animals with good expression of tub-1::GFP in amphid neurons to maintain. somi-1 mutation suppresses precocious development of the vulva and hypodermal cells caused by over-expression of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.

mgEx340 [akt-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-1::GFP translational fusion containing 6.7 kb akt-1 genomic DNA including 3.2 kb of 5' upstream regulatory region and 3.5 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.

mgEx341 [akt-2::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-2::GFP translational fusion containing 5.2 kb akt-1 genomic DNA including 2.1 kb of 5' upstream regulatory region and 3.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.

mgEx481 [pdk-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. PDK-1::GFP translational fusion containing 9 kb akt-1 genomic DNA including 2.9 kb of 5' upstream regulatory region and 6.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.

mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.

Loss-of-function allele; stronger than eri-7(mg411). Reference: Fischer SE, et al. Nature. 2008 Sep 25;455(7212):491-6.

mgEx579 [ins-18p::GFP + rol-6(su1006)]. Pick Rollers to maintain. ins-18::GFP promoter fusion containing 4.9 kb upstream regulatory sequence and 2.1 kb of coding region (including exons and introns) driving GFP expression with 0.8 kb downstream sequence. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.

mgIs35 [ins-1(genomic) + mec-7p::GFP]. Temperature-sensitive. Maintain at 15C. Daf-c. High penetrance of dauer formation at 20C. Integration of mgEx557. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.

mgIs72 [rpt-3p::GFP + dpy-5(+)] II. Reporter of proteasome subunit expression can be used to assay skn-1a-dependent regulation of proteasome subunit genes. mgIs72 [rpt-3::gfp] integrated transgene was generated from sEx15003.

Superficially wild-type.  Mutation in active site of ddi-1 protease.

Gain of function allele of mdt-15. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.

arSi159 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 (II). The first intron of GFP was replaced with a Flexon containing two loxP sites. High level GFP::H2B expression requires Cre expression from a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.

DpyUnc. At 25C ar22 recessively suppresses the Egl defect of n676n930. At 15C ar22 dominantly suppresses the 2 AC-Egl phenotype of n676n930. Suppresses the vulval lineage defects and proximal mitosis defects of lin-12. Do not distribute this strain; other labs should request it from the CGC.

Pick non-Uncs to maintain. arDp2 is derived from mnC1, hence carries dpy-10(e128) and possibly unc-52(e444). arDp2 is a free duplication but does not pass at a high frequency. arDp2 is not stable as a balancer. It is prone to recombination; pick non-Unc and check for segregation of unc-4 and WT in progeny. Do not distribute this strain; other labs should request it from the CGC.

Animals with the duplication are WT and segregate WT and dead eggs. 3-fold muscle dettachment and arrest in 90% of mup-4(ar60) homozygotes; 10% arrest earlier. Do not distribute this strain; other labs should request it from the CGC.

WT. Suppresses the egg-laying defect of lin-12(n302). Do not distribute this strain; other labs should request it from the CGC.

ar200 does not display any apparent phenotype. It suppresses the Egl defect of both sel-12(ar171) and sel-12(ar131), and displays genetic interactions with various lin-12 and glp-1 alleles. Do not distribute this strain; other labs should request it from the CGC.

ar205 does not display any apparent phenotype. It suppresses the Egl defect of both sel-12(ar171) and sel-12(ar131). Do not distribute this strain; other labs should request it from the CGC.

Unc. Temperature sensitive hypomorphic lin-12 allele. At restrictive temperature of 25C: 100% Egl in unc-32 background (95% Egl without unc-32); 30% have 2 anchor cells, some proximal mitosis, abnormal vulval lineages but has opening; leaks some eggs; mates with males. At permissive temperature of 15C: 93% Egl(+) and 7% Egl(-) [lin-12(d)-like: no anchor cell and no vulval opening]. Do not distribute this strain; other labs should request it from the CGC.

Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter.

Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals.

Unc. At 25C ar39 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. ar39 recessively suppresses vulval lineage defects and proximal mitosis. Do not distribute this strain; other labs should request it from the CGC.

Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals. Strain is quite sick even at the permissive temperature.

RollerUnc. At 25C e1948 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. e1948 recessively suppresses vulval lineage defects and proximal mitosis. sc8 previously called rol-4(sc8). See also WBPaper00002448. Do not distribute this strain; other labs should request it from the CGC.