Laboratory Information

NameJK View on WormBase
Allele designationq
HeadJudith Kimble
InstitutionUniversity of Wisconsin, Madison, WI
Address 433 Babcock Drive
Madison 53706-1544
United States
Website http://www.biochem.wisc.edu/kimble/index.html
Gene classes bcc  ehn  fbf  glp  gnd  hnd  lag  larp  lpl  man  mep  mog  puf  spf 
sygl  sys 

Strains contributed by this laboratory

Strain Genotype Species Description
CB3616 tra-3(e1107) dpy-4(e1166)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Dpy, Vul, and dead eggs. The Dpys throw Dpy males. Maintain by picking WT.
CB3779 tra-2(e2021) II. C. elegans tra-2 gain-of-function. Male-female strain. Maintain by mating. References: EMBO J. 2001 Mar 15; 20(6): 1363–1372. Proc Natl Acad Sci U S A. 2004 Aug 24; 101(34): 12549–12554.
CB4037 glp-1(e2141) III. C. elegans Temperature sensitive. Sterile at 25C. Maintain at 15C. [2/98: Craig Mello noticed a different embryonic phenotype in this strain as compared to the e2141 stock that Jim Priess obtained from England: the ABp fate appears WT.] [NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2144) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in Worm Breeders Gazette December 2010; 18(3), e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.]
DH245 fem-2(b245) III. C. elegans Temperature sensitive. XX animals make no sperm. Temperature sensitive period in L1. Maternal effect. XO animals are intersexual males. Temperature sensitive period in soma is L1-L3. Temperature sensitive period in germline is L2-adult.
JK1009 fog-1(q180)/sup-11(n403) unc-11(e47) I. C. elegans Heterozygotes are WT and segregate WT, small scrawny slow-growing Uncs, and females. Do not distribute this strain; other labs should request it from the CGC.
JK1019 dpy-19(e1259) glp-1(q158) III; qDp3 (III;f). C. elegans Animals with the Duplication are WT. Animals which have lost the Duplication are Dpy and Sterile. Do not distribute this strain; other labs should request it from the CGC.
JK1058 gld-1(q343)/unc-11(e47) dpy-5(e61) I C. elegans Heterozygotes are WT and segregate WT, Dpy Uncs, and homozygous q343 (make small abnormal oocytes. Pick WT and check for correct segregation of progeny to maintain. Reference: Francis R, et al. Genetics. 1995 Feb; 139(2): 579–606. doi: 10.1093/genetics/139.2.579 PMID: 7713419.
JK1075 spe-4(q347)/unc-11(e47) dpy-5(e61) I. C. elegans Heterozygotes are WT. Segregates Dpy Uncs, and females (primary spermatocyte death). Do not distribute this strain; other labs should request it directly from the CGC.
JK1107 glp-1(q224) III. C. elegans Temperature sensitive - raise at 15C. Do not distribute this strain; other labs should request it directly from the CGC.
JK1129 unc-32(e189) qDf2/eT1 III; +/eT1 V. C. elegans Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
JK1153 fog-1(q372) ace-2(g202) dpy-5(e61)/unc-11(e47) I. C. elegans Heterozygotes are WT and segregate WT, Dpy Fogs, and Uncs. Do not distribute this strain; other labs should request it from the CGC.
JK1195 lin-12(q269) glp-1(q231)/unc-32(e189) III. C. elegans Heterozygotes are WT and segregate WT, Uncs, and Lags (ts). Do not distribute this strain; other labs should request it from the CGC.
JK1219 unc-34(e315) lag-2(q387) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc. [Note from Kimble lab: Min Han did a complementation test on this strain and found that unc-34(e315) is lost from this strain.] Do not distribute this strain; other labs should request it from the CGC.
JK1223 lag-2(q411) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc. [Used to be listed in Kimble lab as unc-5(e53); lag-2(q411 dpy-11(e224)/DnT1. Needs to be checked.] Do not distribute this strain; other labs should request it from the CGC.
JK1227 lag-1(q385)/dpy-13(e184) unc-24(e138) IV. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and early larval lethals. Received new stock 5/98. Check carefully for segregation of Dpy Unc progeny; dpy-13 can be lost easily. Do not distribute this strain; other labs should request it from the CGC.
JK1277 lag-2(q420) V. C. elegans Temperature sensitive. Maintain at 15C. Do not distribute this strain; other labs should request it from the CGC.
JK1313 lin-12(n941) glp-1(q46)/dpy-19(e1259) unc-69(e587) III. C. elegans Heterozygotes are WT and segregate WT, Dpy(ts) Uncs, and Lag L1 lethals (not ts). Do not distribute this strain; other labs should request it from the CGC.
JK1346 cyn-4(q465)/dpy-10(e128) unc-4(e120) II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and sterile hermaphrodites. Maintain by picking fertile WT hermaphrodites. q465 previously called mog-6. cyn-4 previously called cyp-4. Do not distribute this strain; other labs should request it from the CGC.
JK1389 mog-1(q223) unc-69(e587)/eT1 III; +/eT1 V. C. elegans Heterozygotes are wild-type and segregate wild-type, Unc-36 (eT1 homozygotes), homozygous Mog (Unc, weak coiler). Maintain by picking wild-type. Do not distribute this strain; other labs should request it from the CGC.
JK1403 fog-3(q470)/unc-13(e1091) lin-11(n566) I. C. elegans Heterozygotes are WT and segregate WT, Unc Egls and females. Do not distribute this strain; other labs should request it from the CGC.
JK1443 lag-1(q476) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc. Do not distribute this strain; other labs should request it from the CGC.
JK1466 gld-1(q485)/dpy-5(e61) unc-13(e51) I. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and steriles with a tumorous germline. Pick WT to maintain. Do not distribute this strain; other labs should request it from the CGC.
JK1499 mog-2(q75)/sqt-1(e1350) II; him-8(e1489) IV. C. elegans At 15C heterozygotes are Rollers and segregate Rollers, Sqt and Steriles. Not a healthy strain; recombination occurs, too. Do not distribute this strain; other labs should request it from the CGC.
JK1505 unc-32(e189) glp-1(e2072) III/eT1 (III;V). C. elegans Heterozygotes are WT and segregate WT, Sterile Unc coilers, Unc-36s (eT1 homozygotes) and dead eggs. Pick WT to maintain. Do not distribute this strain; other labs should request it from the CGC.
JK1521 fog-2(q71) pha-4(q490)/stu-3(q265) rol-9(sc148) V. C. elegans Heterozygotes are WT and segregate WT, Females which lack a pharynx (arrest as embryos or L1) and Sterile Unc Rollers. Do not distribute this strain; other labs should request it from the CGC. See also WBPaper00003770.
JK1534 ces-1(n703) qDf5/unc-29(e193) mec-8(e398) blmp-1(s71) I. C. elegans Heterozygotes are Ces and grow slowly. Hets segregate DpyUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.
JK1542 ces-1(n703) qDf7/dpy-5(e61) srf-2(yj262) unc-75(e950) I. C. elegans Heterozygotes are Srf and grow slowly. Hets segregate Srf, DpyUncSrf and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. CGC rec'd new stock 10/99.
JK1545 ces-1(n703) qDf8/unc-13(e1091) lin-11(n566) I. C. elegans Heterozygotes are Ces and segregate VulUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.
JK1547 ces-1(n703) qDf10/unc-13(e1091) lin-11(n566) I. C. elegans Heterozygotes are Ces and segregate VulUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.
JK1548 ces-1(n703) qDf11/unc-13(e1091) lin-11(n566) I. C. elegans Heterozygotes are Ces and segregate Ces, UncVul and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.
JK1550 ces-1(n703) qDf12/unc-13(e1091) lin-11(n566) I. C. elegans Heterozygotes are Ces and segregate VulUnc and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.
JK1556 ces-1(n703) qDf14/unc-13(e1091) lin-11(n566) I. C. elegans Heterozygotes are Ces and segregate Ces, UncVul and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.
JK1557 ces-1(n703) qDf13/unc-13(e1091) lin-11(n566) I. C. elegans Heterozygotes are Ces and segregate VulUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.
JK1561 ces-1(n703) qDf15/unc-29(e193) mec-8(e398) lin-11(n566) I. C. elegans Heterozygotes are Ces and segregate VulUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.
JK1726 qDf16/dpy-5(e61) unc-15(e1402) I. C. elegans Heterozygotes are WT and segregate WT, dead eggs and DpyUncs. Maintain by picking WT. Do not distribute this strain; other labs should request it directly from the CGC.
JK1743 gld-2(q497)/dpy-5(e61) unc-13(e51) I. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Steriles. Do not distribute this strain; other labs should request it directly from the CGC.
JK1774 eef-1A.1(q145)/sma-3(e491) unc-36(e251) III. C. elegans Heterozygotes are WT and segregate WT, SmaUnc and Steriles. Do not distribute this strain; other labs should request it from the CGC. eft-3(q145) previously called glp-3(q145).
JK1973 fem-3(q96) IV. C. elegans Semi-dominant Mog. Temperature-sensitive sterile. Maintain at 15C. Masculization of germline (Mog) at 25C.
JK2009 gon-4(q519) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, dead eggs and Steriles with a small white patch. Do not distribute this strain; other labs should request it directly from the CGC.
JK2049 qIs19 V. C. elegans qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Rollers. Integration of qEx233. GFP expression in DTCs and other defined regions. Do not distribute this strain; other labs should request it directly from the CGC.
JK2157 lag-2(q411) V; qEx319. C. elegans qEx319 [lag-2::cMyc + rol-6(su1006)].  Rollers.  Extrachromosomal array carrying myc-tagged LAG-2 protein partially rescues lag-2(null).  About 70% of progeny are Lag.  Survivors are Rollers.  Reference: Crittenden et al., Mol Biol Cell. 2006 Jul;17(7):3051-61.
JK2176 sys-1(q544)/qIs23 I. C. elegans qIs23 [lag-2::GFP]. Heterozygous. Segregates fertile and rolling heterozygotes, sterile and non-rolling sys-1 homozygotes, and dead qIs23 homozygotes. Maintain by picking rollers. Do not distribute this strain; other labs should request it from the CGC.
JK2208 gld-2(dx40)/dpy-5(e61) unc-13(e51) I. C. elegans Segregates wild-type hets, Ste dx40 homozygotes, and Dpy Uncs. Maintain by picking wild-type and checking for correct segregation. Do not distribute this strain; other labs should request it directly from the CGC.
JK2321 mog-5(q449) unc-4(e120)/mIn1 [dpy-10(e128)] II. C. elegans Heterozygotes are WT and segregate WT, Dpys, and Uncs which make excess sperm, are elongated and tend to coil, are slow and have poor backing. Do not distribute this strain; other labs should request it from the CGC.
JK2505 cyd-1(q626) II; him-5(e1490) V. C. elegans Temperature-sensitive allele of cyd-1. Phenotypically wild-type at 15C. At 25C, approximately one-third of q626 hermaphrodites were missing one distal tip cell (DTC) and approximately one-half of q626 males were missing the linker cell (LC). q626 also feminizes the XO gonad. q626 affects the production of SGP daughters in both sexes. There is also a maternal component since the mutant phenotype is almost fully penetrant in offspring of homozygous mothers, but less penetrant in offspring of heterozygous mothers. Reference: Tilmann C & Kimble J. Dev Cell. 2005 Oct;9(4):489-99.
JK2532 gon-1(q518) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, sterile animals with a white patch, and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
JK2533 qC1 [dpy-19(e1259) glp-1(q339) qIs26] III/eT1 (III;V). C. elegans qIs26 [lag-2::GFP + rol-6(su1006)]. Throws heterozygous Rollers and Unc eT1 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. It was an integration of qEx233. Do not distribute this strain; other labs should request it directly from the CGC.
JK2589 nos-3(q650) II. C. elegans Grows well as a homozygote. 0.3% sterile at 20C (0.2% have masculinized germ lines). Do not distribute this strain; other labs should request it directly from the CGC.
JK2663 dpy-11(e224) mes-4(bn67) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). C. elegans qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine. Segregates non-glowing Dpys that are Mes (produce only sterile progeny) and glowing Unc heterozygotes. nT1[unc-?(n754) let-? qIs50] is also known as DnT1[qIs50]. qIs50 is apparently inserted on DnT1. qIs50 is somewhat dimmer than the similar qIs51. Do not distribute this strain; other labs should request it directly from the CGC.
JK2689 pop-1(q645) dpy-5(e61) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and glow, segregate non-glowing Dpy Steriles. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Do not distribute this strain; other labs should request it from the CGC. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
JK2729 dpy-18(ok162) III. C. elegans Medium Dpy. Robert Barstead deletion mutant in T28D6. Prolyl-4-hydroxylase alpha subunit. Do not distribute this strain; other labs should request it from the CGC.
JK2735 qIs54 X. C. elegans qIs54 [pes-10p::GFP + myo-2p::GFP + F22B7.9::GFP]. Superficially wild-type. GFP expression in pharynx, gut and early embryos. qIs54 males mate, but not as well as wild-type. Do not distribute this strain; other labs should request it directly from the CGC.
JK2736 ceh-22(q632) V. C. elegans Do not distribute this strain; other labs should request it directly from the CGC.
JK2739 mcm-4(e1466) dpy-5(e61) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Segregates WT glowing hets, non-glowing sterile Dpys, very rare homozygous hT2 glowing animals, and dead eggs. Do not distribute this strain; other labs should request it directly from the CGC. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
JK2751 sys-1(q544) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT. q544 is homozygous embryonic lethal. hT2[qIs48] homozygotes are inviable. PIck GFP+ wild-type to maintain. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC.
JK2757 phy-2(ok177) IV. C. elegans WT. Deletion mutant in F35G2.4. Prolyl 4 hydroxylase #2 deletion. Do not distribute this strain; other labs should request it from the CGC.
JK2761 sys-1(q544)/unc-29(e1072) fog-3(q470) I. C. elegans Heterozygotes are WT and segregate WT, Unc Fogs and Sterile Spfs (white patch) phenotype. Do not distribute this strain; other labs should request it from the CGC.
JK2782 pop-1(q645) unc-11(e47) I/hT2 (I;III). C. elegans Heterozygotes are WT and segregate WT, Dpys (hT2 homozygotes) and Unc Steriles. Do not distribute this strain; other labs should request it from the CGC.
JK2785 unc-4(e120) II; qIs55. C. elegans qIs55 [hnd-1::GFP + unc-4(+)] integrated on IV or V. Do not distribute this strain; other labs should request it from the CGC.
JK2810 mcm-4(e1466) dpy-5(e61)/hT2 I; dpy-18(e364) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are medium Dpy and glowing. Hets throw small, sterile DpyUncs and dead eggs. hT2[bli-4(e937) qIs48] is homozygous lethal. qIs48 is an insertion of ccEx9747 with markers myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and gut promoter F22B7.9 driving GFP in the intestine. Do not distribute this strain; other labs should request it directly from the CGC. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
JK2868 qIs56 V. C. elegans qIs56 [lag-2p::GFP + unc-119(+)]. Non-unc; might still have unc-119(ed3) in background. Do not distribute this strain; other labs should request it directly from the CGC.
JK2878 fog-1(q325) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Segregates WT green-glowing heterozygotes and non-glowing Fogs. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Do not distribute this strain; other labs should request it from the CGC. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
JK2879 gld-2(q497) gld-1(q485)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Segregates WT GFP+ heterozygotes, non-GFP sterile gld-2 gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC.
JK289 glp-1(e2142) III. C. elegans Temperature sensitive. Maintain at 15C.
JK2906 mep-1(q660) IV/nT1 [qIs51] (IV;V). C. elegans M04B2.1 Heterozygotes are wild-type and GFP+. Heterozygotes segregate WT GFP+, non-GFP q660 homozygotes (sterile), and arrested nT1[qIs51] aneuploids. Pick WT GFP and check for correct segregation of progeny to maintain. [NOTE: Crosses with this nT1[qIs51] chromosome reportedly generate an excess of male progeny.] Do not distribute this strain; other labs should request it from the CGC.
JK2933 gon-14(q12) V/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+. q12 homozygotes have a white-patch phenotype. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK2944 pop-1(q645) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Segregates WT green-glowing heterozygotes and non-glowing steriles. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Do not distribute this strain; other labs should request it from the CGC. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
JK2945 pop-1(q624) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans q624 has variable gonad defects and can be maintained as a homozygote. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Do not distribute this strain; other labs should request it from the CGC. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
JK2958 nT1 [qIs51] (IV;V)/dpy-11(e224) unc-42(e270) V. C. elegans Segregates glowing heterozygotes and DpyUncs. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK2979 fbf-1(ok224) II. C. elegans Homozygous. No obvious phenotype by dissecting scope. Do not distribute this strain; other labs should request it from the CGC.
JK3022 fbf-1(ok91) II. C. elegans Low percent sterile, more sperm than WT, delayed oogenesis, larger broods than WT. PCR amplify: WT band is about 3 kb, deletion band is about 1.2 kb. Oligos used: outer: 201A and 202S; inner: 203A and 204S. Do not distribute this strain; other labs should request it from the CGC.
JK3025 gld-1(q485) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Segregates WT GFP+ heterozygotes, non-GFP sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Jeong J, et al. PLoS Genet. 2011 Mar;7(3):e1001348.
JK3051 qEx454. C. elegans qEx454 [gon-1::GFP + rol-6(su1006)]. Pick Rollers. GFP expressed in muscle, pharynx and DTC. Do not distribute this strain; other labs should request it from the CGC.
JK3072 gon-16(q568) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+. q568(ts) homozygotes are sterile and can exhibit a white-patch phenotype. The severity of the white-patch increases with increasing temperature. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK3073 gon-15(q574) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+. q574 homozygotes are sterile at all temperatures and exhibit a white-patch phenotype at 25C. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK3087 ehn-3(q689) unc-5(e53) IV. C. elegans Unc. About 20% have single gonad arm. Do not distribute this strain; other labs should request it from the CGC.
JK3091 ehn-1(q690) rol-6(e187) II. C. elegans Rollers. About 15% have a one-armed gonad or are WP. Do not distribute this strain; other labs should request it from the CGC.
JK3101 fbf-2(q738) II. C. elegans Grows well as a homozygote, possibly small percent Fog. Do not distribute this strain; other labs should request it from the CGC.
JK3107 fbf-1(ok91) fbf-2(q704)/mIn1 [dpy-10(e128) mIs14] II. C. elegans Heterozygotes are non-Dpy with a green pharynx and a WT germ line. fbf-1 fbf-2 homozygotes are non-Dpy, GFP-, and have small germ lines containing only sperm. mIn1[mIs14 dpy-10(e128)] homozygotes are Dpy, GFP+ and have a WT germ line. Do not distribute this strain; other labs should request it from the CGC.
JK3140 gon-1(e2551) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+. Segregate Gon worms which are GFP-. nT1[qIs51] homozygotes are inviable. Do not distribute this strain; other labs should request it from the CGC.
JK3172 mig-5&cct-1(ok280)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans T05C12.6, T05C12.7. Heterozygotes are WT and GFP+ in the pharynx. mIn1[mIs14 dpy-10(e128)] homozygotes are Dpy and GFP+ in the pharynx. Homozygous mig-5&cct-1(ok280) worms arrest at about L2/L3. Strong loss of function for cct-1 and weak for mig-5. mig-5 is a dishelved homologue. External left primer: CGGCCTAAACGTTGATTGTT. External right primer: CAGAGTGAGTCGTGAACCGA. Internal left primer: TAATCCTGAATCCGGACGAG. Internal right primer: TACGAGATTTCGGTCCCTTG. Internal WT amplicon: 3284 bp. Deletion size: 987 bp. Deletion left flank: GCTGCAGTCTGATGTGCATGGCGGCTCCAT. Deletion right flank: TTGGTGTTGTCTATGCTTCAAGAAAATTGA. Do not distribute this strain; other labs should request it from the CGC.
JK3182 gld-3(q730) nos-3(q650)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. Do not distribute this strain; other labs should request it from the CGC.
JK3203 puf-7(ok397) IV. C. elegans B0273.2. External left primer: AAGCATACAGGCGCAGAGAT. External right primer: TACCGTATTGTGGTGCGAAA. Internal left primer: AACGGTTGCTCATCTGACTT. Internal right primer: AAAATTGCGTCGATTTTTGG. Internal WT amplicon: 2701 bp. Deletion size: 1751 bp. Deletion left flank: TTAAAACTTCTAATTTAAATAAAAAATATA. Deletion right flank: TATGTCGTTCAGCAAATGATTTCGATTTGC. Do not distribute this strain; other labs should request it from the CGC.
JK3221 sys-1(q736) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT, but frequently sterile when balanced by hT2[qIs48]. q736 is homozygous embryonic lethal. (Approx. 5% of hets are Sterile when balanced by WT.) hT2[qIs48] homozygotes are inviable. q736 is a deletion of sys-1 deleting from nucleotide 1803 to nucleotide 3992 of the genomic sequence (A of start ATG is position 1). Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC.
JK323 qDf3/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans Heterozygotes are WT and grow slowly. Segregates Lon males. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC.
JK3231 puf-8(q725) II. C. elegans Low penetrance (<10%) Mog. Do not distribute this strain; other labs should request it from the CGC.
JK3263 gon-14(q686) V. C. elegans Temperature sensitive. At 25C, q686 have 0-2 gonad arms and are sterile. Some are Pvl. The strongest phenotype is a spf-1-like gonad. At 15C, q686 is 100% fertile. Do not distribute this strain; other labs should request it from the CGC.
JK3276 hnd-1(q740) X. C. elegans q740 homozygotes throw about 50% gonadogenesis defective worms (can be gonadless or have a single arm gonad). Do not distribute this strain; other labs should request it from the CGC.
JK3297 fbl-1(q750) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+ and segregate q750 homozygotes which are GFP- sterile adults, and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
JK3345 gld-3(q741)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Heterozygotes are WT with major GFP signal in pharynx. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and GFP- gld-3 homozygotes. Do not distribute this strain; other labs should request it from the CGC.
JK3361 qIs76 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans qIs76 [tra-1::GFP::beta-GAL + rol-6(su1006)]. Pick Rollers with GFP+ pharynx to maintain. Rollers express TRA-1::GFP in Z1/Z4, intestine, etc. qIs76 homozygotes are lethal. Heterozygotes are Rol GFP+ (pharynx). Reference: Chang W., et al. Development. 2004 Mar;131(6):1425-36.
JK3363 qIs69 V. C. elegans qIs69 [hnd-1::GFP::lacZ + rol-6(su1006)] V. GFP expression in MS, C, and D lineages, then Z1/Z4. Rollers. Do not distribute this strain; other labs should request it from the CGC.
JK3375 gld-3(q730)/mIn1 [mIs14 dpy-10(e128)] II; him-5(e1490) V. C. elegans Heterozygotes are WT with major GFP signal in pharynx. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and GFP- gld-3 homozygotes. Do not distribute this strain; other labs should request it from the CGC.
JK3437 him-5(e1490) V; qIs74. C. elegans qIs74 [sys-1p::GFP::pop-1 + unc-119(+)]. Probably on LG X. May have unc-119 in background. Throws 30% males. Do not distribute this strain; other labs should request it from the CGC.
JK3447 fog-1(q250)/sep-1(e2406) I; fbf-1(ok91) fbf-2(q704)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans To maintain, check individual fertile worms for both Sep and Fog offspring. sep-1 homozygotes are sterile at 20C and 25C (Sterile and Unc at 25C), and mostly normal at 15C. fog-1; fbf-1 fbf-2 homozygotes have small germ lines and are often Muv. Best to maintain at 25C for scoring. Do not distribute this strain; other labs should request it from the CGC.
JK3476 ceh-22(q632) sma-1(e30) V/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+. Segregates Sma, GFP- worms which have partially penetrant gonadogenesis defects. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK3501 pop-1(q772) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. q772 is embryonic lethal.
JK3528 qEx500. C. elegans qEx500 [hs::sys-1 + rol-6(su1006)]. Pick Rollers to maintain. Do not distribute this strain; other labs should request it from the CGC.
JK3695 qIs87. C. elegans qIs87 contains [UAS::fkh-6::GFP + rol-6(su1006)]. Rollers. Do not distribute this strain; other labs should request it from the CGC.
JK3743 fog-1(q785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC.
JK3744 qIs89. C. elegans qIs89 [gon-14::gon-14::VENUS + S. cerevisiae DNA]. gon-14::VENUS is broadly expressed in cell nuclei starting at the 50-100 cell stage of embryogenesis and throughout larval development. Partially concentrated in nuclear speckles. qIs89 rescues the 25C Gon and Ste defects of q686. Low penetrance of sterility and lethality in the strain. Do not distribute this strain; other labs should request it from the CGC.
JK3776 qIs90. C. elegans qIs90 [ceh-22b::VENUS (pJK1082) + influenza viral DNA]. qIs90 is an integrated complex array; integration site not mapped. ceh-22b::VENUS can be easily identified by its expression in the pharynx. Do not distribute this strain; other labs should request it directly from the CGC.
JK3782 qIs56 him-5(e1490) V; qEx557. C. elegans qIs56 [lag-2p::GFP + unc-119(+)] V. qEx557 [hsp-16p::ceh-22b + ttx-3::DsRed]. Him. Pick DsRed+ animals to maintain qEx557 array. Heat-shock can be used to drive the ectopic expression of CEH-22B (derived from Fire Lab vector pPD49.78). LAG-2::GFP is expressed the embryo, nerve cord, Z1/Z4, and DTCs. Reference: Lam N. et al. Curr Biol. 2006 Feb 7;16(3):287-95. doi: 10.1016/j.cub.2005.12.015. PMID: 16461282
JK3791 sys-1(q544) I; qIs95 III. C. elegans qIs95 [(sys-1p::Venus::sys-1 + pttx-3::DsRed]. The DsRed marker is very dim and might be difficult to see it under the dissecting scope. Do not distribute this strain; other labs should request it directly from the CGC.
JK3826 mut-16(mg461) I; larp-1(q783) III. C. elegans Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC.
JK3934 gld-1(q93) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). C. elegans Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (hT2 homozygotes) and non-GFP gld-1(q93) homozygotes with masculinized germlines. Some heterozygotes will also have a masculinized germline. Maintain by picking GFP worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. gld-1(q93) was isolated as a dominant suppressor of fem-1(hc17).
JK3961 puf-8(q725)/mIn1[mIs14 dpy-10(e128)] II; lip-1(zh15) IV. C. elegans Pick wild-type GFP+ to maintain. q725 heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ q725 heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP puf-8(q725) II; lip-1(zh15) IV double homozygotes. Homozygous puf-8(q725) II; lip-1(zh15) IV double mutants are ~100% Mog at 20C and ~100% Tumerous at 25C. Reference: Morgan CT, et al. Nat Chem Biol. 2010 Feb;6(2):102-4.
JK3965 fbf-1(ok91) fbf-2(q704)/mIn1 [mIs14 dpy-10(e128)] II; fem-3(e1996)/qIs24 IV. C. elegans qIs24 [lag-2p::GFP]. Maintain by picking individual animals with green DTCs and green pharynx and scoring offspring for Fems and Fbfs. fem-3 is not well balanced by qIs24. fbf-1 fbf-2 homozygotes are germline proliferation defective and make only sperm. fem-3 homozygotes make only oocytes. fbf-1 fbf-3; fem-3 proliferates more than fbf-1 fbf-2 and makes only oocytes; also Muv. qIs24 contains lag-2::GFP; Distal Tip Cells are green; homozygotes are Rollers and heterozygotes Roll weakly. mIn1 is Dpy and GFP+ in the pharynx. Do not distribute this strain; other labs should request it from the CGC.
JK4087 rnp-8(q784) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. rnp-8 homozyotes are GFP- and look like WT. Slow L4 to Adult transition.
JK4099 hlh-2(tm1768) I. C. elegans Temperature sensitive sterile. Partially sterile at 20 C; completely sterile at 25 C. Maintain at <20 C. Do not distribute this strain; other labs should request it directly from the CGC.
JK4143 qIs57 II; rde-1(ne219) V; qIs140. C. elegans qIs57 [lag-2p::GFP] II. qIs140 [lag-2p::rde-1 + rol-6(su1006)]. Rollers. qIs140 rescues rde-1 in lag-2-expressing cells (as tested by GFP RNAi). qIs57 GFP expression in DTCs. Do not distribute this strain; other labs should request it directly from the CGC.
JK4174 K10D2.2(q792) III. C. elegans Superficially wild-type. K10D2.2 is a gld-2 paralog.
JK4177 pup-3(q793) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q793 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
JK4220 puf-6(q759) II. C. elegans Superficially wild-type.
JK4278 puf-12(q810) II. C. elegans Superficially wild-type.
JK4299 gld-2(q497) gld-1(q361) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. gld-1(q361) is a missense allele but phenotypically null, which allows the detection of gld-1 mRNA and protein by single molecule FISH or antibody staining. Reference: Hansen et al (2004) Dev. Biol. 2004;268(2):342-57. Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK4307 rnp-8(tm2435) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. PCR using 3 primers: primer A: TCA GCC GAC AAT CTC CGA; primer B: GTA CTG ATT GTA TCC ACC GGC; primer C: GCT CAT AGA AAA GCG ATG G. WT band = 0.5 kb; heterozygote bands = 0.8 and 0.5 kb (double bands), tm2435 bands = 0.8 kb.
JK4472 qIs154 V. C. elegans qIs154 [lag-2p::MYR::tdTomato + ttx-3p::GFP] V. Myristylated tdTomato localizes to plasma membrane of DTC and other lag-2-expressing cells. Reference: Byrd DT, et al. PLoS One. 2014 Feb 19;9(2):e88372.
JK4475 qIs153 V. C. elegans qIs153 [lag-2p::MYR::GFP + ttx-3p::DsRed] V. Myristylated GFP localizes to plasma membrane of DTC and other lag-2-expressing cells. Reference: Byrd DT, et al. PLoS One. 2014 Feb 19;9(2):e88372.
JK4545 larp-1(q783) III. C. elegans Derived by outcrossing JK3826 to remove mut-16 deletion. Do not distribute this strain; other labs should request it directly from the CGC.
JK4563 gld-1(q126) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Segregates WT GFP+ heterozygotes, non-GFP sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC.
JK4619 tra-1(q106) III/eT1[qIs60](III;V). C. elegans qIs60 [pes-10::GFP + gut specific promoter::GFP + myo-2::GFP]. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP males, and dead eggs (eT1 homozygotes). Pick wild-type GFP+ and check for proper segregation of progeny to maintain. Reference: Schedl T, et al. Genetics. 1989 Dec;123(4):755-69. doi: 10.1093/genetics/123.4.755. PMID: 2612895.
JK4626 cku-80(ok861) unc-119(ed3) III; qIs170. C. elegans qIs170 [gld-1p::gld-1::GFP::FLAG + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. Reference: Jeong J, Verheyden JM, Kimble J. PLoS Genet. 2011 Mar;7(3):e1001348.
JK4774 lst-1(ok814) sygl-1(tm5040) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kershner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK4832 gld-1(q485) gld-2(q497) lst-1(ok814) sygl-1(tm5040) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. Reference: Kershner et al. (2014) PNAS 111: 3739-3744.
JK4842 qSi29 II; unc-119(ed3) III. C. elegans qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK4862 glp-1(q46) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99.
JK4864 qIs147 IV. C. elegans qIs147 [sur-5::GFP] IV. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007. The sur-5::GFP reporter is described in Yochem J, et al. Genetics. 1998 Jul;149(3):1323-34. PMID: 9649523.
JK4871 fog-3(q520) I; qSi41 II. C. elegans qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK4930 lag-1(q426) IV/nT1[qIs51](IV; V). C. elegans Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP q426 homozygotes (variable phenotypes including sterile, L1 lethal, and small sterile adults with rectal protrusion and occasional bent pharynx). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kadyk LC & Kimble J. Development. 1998 May;125(10):1803-13. doi: 10.1242/dev.125.10.1803. PMID: 9550713.
JK4942 sygl-1(tm5040) I; qSi49 II; unc-119(ed3) III. C. elegans qSi49 [sygl-1p::3xFLAG::sygl-1::sygl-1 3’UTR + unc-119(+)]. Superficially wild-type. Unknown whether or not unc-119(ed3) is still present in the background. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK4996 lst-1(ok814) I; qSi69 II; unc-119(ed3) III C. elegans qSi69 [lst-1p::lst-1::3xFLAG::lst-1 3’UTR + unc-119(+)]. Superficially wild-type. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK5008 qSi44 II; glp-1(q46) III. C. elegans qSi44 [glp-1::6xMyc6xHis + Cbr-unc-119(+)] II. Homozygous viable. Variable body length. May still carry unc-119(ed3) in the background. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK5018 qSi26 II; unc-119(ed3) III; teIs1 IV. C. elegans qSi26 [sygl-1p::H2B::GFP::sygl-1 3' end + unc-119(+)]. GFP expression in distal germ cell nuclei. teIs1 [oma-1::GFP + unc-119(+)]. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK5020 glp-1(q172) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q172 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Crittenden SL, et al. Development. 1994 Oct;120(10):2901-11. doi: 10.1242/dev.120.10.2901. PMID: 7607080.
JK5028 qSi77 II; unc-119(ed3) III. C. elegans qSi77 [mex-5p::eGFP::3xFLAG::tbb-1 3'utr::gpd-2 SL2 splice site::mCherry::3xMyc::pgl-1 RGG repeat::tbb-1 3'utr and intergenic region + unc-119(+)] inserted into ttTi5605 on LG II. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5072 qSi29 II; unc-119(ed3) III; teIs1 IV. C. elegans qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. teIs1 [oma-1::GFP + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK509 glp-1(q231) III. C. elegans Temperature sensitive. Sterile at 25C. Fertile at 15C. Do not distribute this strain; other labs should request it from the CGC.
JK5187 fog-1(q785) I; qSi140 IV. C. elegans qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5200 fog-1(q785) fog-3(q520) I; qSi41 II; qSi140 IV. C. elegans qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5226 glp-1(q46) III; qSi156 IV. C. elegans qSi156 [glp-1::Halotag + Cbr-unc-119(+)] IV. Mos insertion of Halo tagged GLP-1 in glp-1(null) background. qSi156 mostly rescues glp-1(q46) sterility; partially penetrant embryonic lethality, early larval lethality and dumpiness. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK5250 pole-1(q831)/hIn1[unc-54(h1040)] I. C. elegans Heterozygotes are fertile WT (non-Unc) and segregate fertile WT (q831/hIn1), fertile Unc (hIn1/hIn1), and sterile non-Uncs (q831/q831). Pick fertile WT and check for correct segregation of progeny to maintain. Reference: Robinson-Thiewes S, et al. G3 (Bethesda). 2022 Mar 4;12(3):jkab439. doi: 10.1093/g3journal/jkab439. PMID: 35100350.
JK5305 lst-1(q827) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q827 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Robinson-Thiewes S, et al. G3 (Bethesda). 2022 Mar 4;12(3):jkab439. doi: 10.1093/g3journal/jkab439. PMID: 35100350.
JK5455 q833 V/nT1[qIs51](IV; V). C. elegans hets are green pharynx WT and segregate green pharynx WT, fertile non-green pharynx and dead eggs (nT1 homozygotes). q833 is a 472 bp deletion into the intergenic region between mir-61/ mir-250 and F55A11.4.
JK5500 sygl-1(q828) I; qSi150 II. C. elegans qSi150 [sygl-1p::3X flag::sygl-1::tbb-2 3' UTR + Cbr-unc-119(+)] II. Phenotypically gravid, grows as a homozygote. Increased SYGL-1 protein expression, expanded progenitor zone, expanded GSC pool. Reference: Shin H. et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK551 unc-5(e53) fem-3(q22) IV. C. elegans Temperature sensitive. At 25C, XX germline makes only sperm; at 15C, germline makes oocytes and excess sperm. Unc. Do not distribute this strain; other labs should request it from the CGC.
JK5535 glp-1(q46) III; qSi246 IV. C. elegans qSi246 [glp-1::sfGFP + Cbr-unc-119(+)] IV. Mos insertion of sfGFP tagged GLP-1 in glp-1(0) background. qSi246 rescues glp-1(q46) sterile phenotype. Animals are fertile, superficially wild-type with GFP+ distal germ-lines. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK554 dpy-17(e164) glp-1(q224) III; unc-1(e1598) X. C. elegans Raise at 15C. Dpy Unc. unc-102(e1598) changed to unc-1(e1598). Do not distribute this strain; other labs should request it from the CGC.
JK5556 F17E5.2(q864) X. C. elegans 350 bp deletion in F17E5.2
JK5596 lst-1(q867) I. C. elegans CRIPSR-engineered mutation of the lst-1M71 longform start codon (ATG to AT, deletion of G). Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205
JK560 fog-1(q253) I. C. elegans Temperature sensitive - raise at 15 or 20C. Do not distribute this strain; other labs should request it directly from the CGC.
JK5657 tra-1(q183) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). C. elegans Maintain at 15C. Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (hT2 homozygotes) and non-GFP tra-1(q183) homozygous females. Raise strain at 15C; at 20C many heterozygotes are also feminized. tra-1(q183) is temperature-sensitive for its XX, but not its XO mutant phenotype. At 25C, both q183/q183 and q183/+ are female. At 15C, q183/q183 is still always female, but q183/+ can be hermaphroditic. Maintain by picking fertile GFP worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies.
JK5687 pgl-1(q894[pgl-1::SNAP]) IV. C. elegans SNAP tag inserted into endogenous pgl-1 locus between G713 and G714.
JK5731 cya-1(q903[cya-1::3xMyc]) III. C. elegans Internal 3xMyc tag inserted into endogenous cya-1 locus.
JK5736 cyb-2.1(q908[3xMyc::cyb-2.1]) IV. C. elegans 3xMyc tag inserted at N-terminus of endogenous cyb-2.1 locus.
JK5739 cyb-2.2(q911[3xMyc::cyb-2.2]) I. C. elegans 3xMyc tag inserted at N-terminus of endogenous cyb-2.2 locus.
JK574 fog-2(q71) V. C. elegans Male-female strain. Maintain by mating. Do not distribute this strain; other labs should request it from the CGC.
JK5742 cyb-3(q914[cyb-3::3xMyc]) V. C. elegans Internal 3xMyc tag inserted into endogenous cyb-3 locus.
JK5745 cyd-1(q917[cyd-1::3xMyc]) II. C. elegans Internal 3xMyc tag inserted into endogenous cyd-1 locus.
JK5748 cye-1(q920[3xMyc::cye-1]) I. C. elegans 3xMyc tag inserted at N-terminus of endogenous cye-1 locus.
JK5751 cdk-1(q923[3xMyc::cdk-1]) III. C. elegans 3xMyc tag inserted at N-terminus of endogenous cdk-1 locus.
JK5758 lst-1(q895[lst-1(long)::3xFLAG]) I. C. elegans 3xFLAG tag inserted at the C terminus of the endogenous lst-1 locus, after V398 of the long isoform. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205
JK5760 lst-1(ok814) sygl-1(q828) gld-2(q497) gld-1(q361) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5796 lst-1(q869) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. q869 is a deletion of the entire lst-1 coding sequence as well as 139 bp upstream of M71 start codon and 228 bp downstream of the coding sequence. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205
JK5800 qSi364 IV. C. elegans qSi364 [3xFLAG::fbf-2(R7/R8 loop deletion) + unc-119(+)] IV. Single-copy MosSCI insertion into oxTi177 IV. R7/R8 loop deletion removes a critical protein-to-protein interface. qSi364 is phenotypically wild-type on its own, but Mog when crossed into fbf-1(ok91) fbf-2(q704) background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. C. elegans 3xFLAG tag inserted at N-terminus of endogenous fbf-2 locus. Generated in N2 background. Reference: Ferdous AS, et al. 2023 May 1;150(9):dev201705. doi: 10.1242/dev.201705. PMID: 37070766.
JK5842 fbf-2(q932[3xV5::fbf-2]) II. C. elegans q932 is 3xV5::fbf-2 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5848 nos-3(q958[nos-3::1xOLLAS]) II. C. elegans 1xOLLAS tag inserted into endogenous nos-3 locus via CRISPR/Cas9 engineering.
JK5868 cpb-1(q967[nos-3::1xOLLAS]) III. C. elegans 1xOLLAS tag inserted into endogenous nos-3 locus after L141 within a non-conserved region near the N-terminus.
JK5893 sygl-1(q983[3xOLLAS::sygl-1]) I. C. elegans q983 is a 3xOLLAS::sygl-1 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5896 qSi369 II; unc-119(ed3) III; qSi370 V. C. elegans qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK590 glp-1(q35)/eT1 III; him-5(e1490)/eT1 V. C. elegans Heterozygotes are wild-type and segregate wild-type heterozygotes, glp-1(q35) homozygotes (Muv steriles), eT1 homozygotes (Unc-36), and males. glp-1(q35) has a semi-dominant multi-vulva phenotype as well as the loss-of-function Glp phenotype (sterility and embryonic lethality). The q35 mutation is a nonsense mutation that eliminates 122 C-terminal amino acids including a PEST sequence. The C terminus was thought to contain a negative regulatory domain that inactivates glp-1 in the VPCs; the inappropriate glp-1(q35) activity can substitute for lin-12 vulval fate determination. References: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99. Mango S, et al. Nature. 1991 Aug 29;352(6338):811-5.
JK5915 puf-3(q966) IV. C. elegans Superficially wild-type.
JK5929 lst-1(q1004[lst-1::V5]) I. C. elegans q1004 is lst-1::V5 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5932 sygl-1(q828) I; qSi369 II; qSi370 V. C. elegans qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superfically wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5933 glp-1(q1000[glp-1::4xV5]) III. C. elegans Endogenous glp-1 locus tagged with 4xV5. Tagged GLP-1 rescues: glp-1(q1000) is fertile and progenitor zone looks wild-type. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK5935 fbf-1(ok91) fbf-2(q973[3xFLAG::fbf-2]) II. C. elegans 3xFLAG tag inserted at N-terminus of endogenous fbf-2 locus in fbf-1 null background (parental strain JK3022). Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK5942 fog-3(q873[fog-3::3xFLAG]) I; qSi375 II. C. elegans q873[fog-3(1-262)::GGS::3xFLAG::fog-3(263 Phe)] I. qSi375 [mex-5p::eGFP::linker::his-58::3xboxb::tbb-2 3’UTR] II. The tethering assay allows this strain to be used for determining FOG-3 levels in different genetic backgrounds. Similar fertility to N2 wild type. Reference: Aoki S, et al. Cell Rep. 2018 Jun.26; 23(13):3769-3775
JK5943 qSi369 II; glp-1(q224) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qSi370 V. C. elegans qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5964 lst-1(q1008[lst-1::3xOLLAS]) I. C. elegans q1008 is lst-1::3xOLLAS tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5973 glp-1(q997[glp-1::2xOLLAS]) III. C. elegans Endogenous glp-1 locus tagged with 2x OLLAS. Tagged GLP-1 rescues: glp-1(q997) is fertile and progenitor zone looks wild-type. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK5984 fbf-2(q1011[*q945]) II. C. elegans q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK5986 fbf-1(ok91) fbf-2(q1023[*q973])/mIn1[mIs14 dpy-10(e128)] II. C. elegans q1023 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5935 fbf-2(q945[3xFLAG::fbf-2]) II. Pick GFP+ t maintain. Homozygous sterile (Mog) mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok91 q1023 homozygotes (sterile Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK5996 puf-11(q971) IV. C. elegans Superficially wild-type.
JK6002 sygl-1(q1015[sygl-1::V5]) I. C. elegans q1015 is a sygl-1::V5 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK6011 lst-1(q1032[*q1004]) I. C. elegans q1004[LST-1::3xV5] is the CRISPR-engineered insertion of a 3xV5 tag at the C-terminus of the endogenous lst-1 locus. q1032 is the CRISPR-engineered mutation C260S & C263S in the Zn finger domain of LST-1 (Haupt et al., 2019) in the q1004 background. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205.
JK6022 pgl-1(q842) IV. C. elegans pgl-1 (q842) is a (Q342A) missense mutation. This is a homozygous strain; replaced JK5481. Reference: Aoki ST, et al. Proc Natl Acad Sci U S A. 2016 Feb 2;113(5):1279-84.
JK6045 glp-1(q1036) III. C. elegans Maintain at 15C. Germline tumor formation at 25C. A mix of fertile wild-type and proximal tumorous animals at 20C. glp-1(ar202) V5 CRISPR/Cas9 gene editing was used to insert a 3xV5 tag into C-terminus of GLP-1 between amino acids K(1209) and S(1210) using the same reagents as described for tagging wild-type GLP-1 (Sorensen et al., 2020). GLP-1 ar202V5 germlines express GLP-1 in membranes.
JK6059 glp-1(q1035[*q1000]) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick GFP+ to maintain. CRISPR-engineered RAM mutations in endogenous glp-1 locus with C-terminal 4xV5 tag. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1035 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Derived by modification of parental strain JK5933 glp-1(q1000).
JK6063 puf-8(q1048[3xV5::puf-8]) II. C. elegans 3xV5 tag inserted into endogenous puf-8 locus via CRISPR/Cas9 engineering. Reference: Ferdous AS, et al. Development. 2023 May 1;150(9):dev201705. PMID: 37070766.
JK6070 lst-1(q826) I. C. elegans Slightly smaller germline mitotic region than wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK6080 puf-3(q1058[3xV5::puf-3]) IV. C. elegans 3x V5 epitope tags inserted into endogenous puf-3 locus. Expresses functional 3x V5-tagged PUF-3. Reference: Haupt KA, Genetics. 2020 Jan;214(1):147-161. PMID: 31740451
JK6091 gld-3(q1065[gld-3L::1xV5]) II. C. elegans 1xV5 tag inserted into endogenous gld-3 locus, specifically tagging GLD-3L isoform, via CRISPR/Cas9 engineering.
JK6099 lag-2(q1049[lag-2::3xV5]) V. C. elegans CRISPR/Cas9 gene editing was used to insert a 3xV5 tag at the C-terminus of the endogenous lag-2 locus immediately upstream of stop codon. Animals are fertile and express LAG-2 V5 in adult DTCs.
JK6111 sygl-1(q1054[*q943]) I. C. elegans C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory element LBS D (Yoo et al., 2004). Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6140 nos-3(q902) II; qSi380 IV. C. elegans qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JK6154 lst-1(q1086 [*q1004]) I. C. elegans 3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif B disrupted (PIM B mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6179 gld-2(q1100[gld-2::2xV5]) I. C. elegans 2xV5 tag inserted into endogenous gld-2 locus via CRISPR/Cas9 engineering.
JK6188 lst-1(q1115[*q1004]) I. C. elegans GGSGG linker::3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with a deletion removing a portion of the lst-1 locus. q1115 retains the N-terminal 1-210) region of LST-1. Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6203 lst-1(q1125[*q1086]) I. C. elegans 3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motifs A&B disrupted (PIM AB mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6251 apx-1(q1148[apx-1::3xV5]) V. C. elegans CRISPR/Cas9 gene editing was used to insert a 3xV5 tag inserted at the C-terminus of the endogenous apx-1 locus immediately upstream of STOP codon. Animals are fertile and express low levels of APX-1 V5 in adult DTCs.
JK6268 qSi380 IV. C. elegans qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3’utr::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem–loops in its 3′UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The gfp reporter RNA has three functional boxB stem–loops in its 3′UTR; the mCherry reporter 3′UTR has three mutated boxB stem–loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JK6280 puf-11(q1128[3xV5::puf-11]) IV. C. elegans 3x V5 epitope tags inserted into endogenous puf-11 locus. Expresses functional 3x V5-tagged PUF-11. Reference: Haupt KA, Genetics. 2020 Jan;214(1):147-161. PMID: 31740451
JK6319 lst-1(q1004[lst-1::3xV5]) sygl-1(q828) I. C. elegans 3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus.
JK6321 puf-3(q966) puf-11(q971) IV/ nT1[qIs51] (IV;V). C. elegans Homozygous maternal effect lethal double mutant balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested GFP+ nT1[qIs51] aneuploids, and non-GFP puf-3(q966) puf-11(q971) homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain.
JK633 unc-32(e189) glp-1(q46)/eT1 III; +/eT1 V. C. elegans Heterozygotes are wild-type and segregate wild-type, Unc-36 eT1 homozygotes, UncSteriles, and arrested eT1 aneuploid progeny (dead eggs). Maintain by picking wild-type and check for correct segregation of progeny to maintain. eT1 previously known as unc-36(e873). Do not distribute this strain; other labs should request it from the CGC.
JK6381 lst-1(q1124[*q1004]). C. elegans 3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif A disrupted (PIM A mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6389 sygl-1(q1167[*q1135])) I. C. elegans C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory elements LBS BCD (Yoo et al., 2004). Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6399 lst-1(q1198[*q867]) I. C. elegans 3xV5 epitope tag inserted into endogenous lst-1 locus with a 1 bp deletion in lst-1L-specific first exon tospecifically disrupt LST-1L isoform. Synthetically sterile in combination with sygl-1(lf). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6401 lst-1(q869) sygl-1(q828) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6410 fbf-2(q1078[*q945]) II. C. elegans q1078 is an engineered insertion of LambdaN peptide near the C-terminus of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6412 fbf-2(q1080[*q1011]) II. C. elegans q1080 is an engineered insertion of LambdaN peptide near the C-terminus of 3xFLAG-tagged FBF-2 with a Y479A point mutation in the R7/R8 loop. Derived by modification of parental strain JK5984 fbf-2(q1011[*q945]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6432 mpk-1(q1190)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. C. elegans Heterozygous animals Roll and have GFP(+) distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes which are sterile and vulvaless. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. q1190 is a deletion in mpk-1 that removes 2221bp between axons 2-7 (based on mpk-1b annotation). Sequence is shared between mpk-1a and mpk-1b. The deletion is in frame and leaves 27bp of coding sequence.Reference: Robinson-Thiewes S, et al. Cell Rep. 2021 May 25;35(8):109162. doi: 10.1016/j.celrep.2021.109162.
JK6468 gld-3(q1215[*q1065]) II. C. elegans 1xV5 tag inserted into endogenous gld-3 locus containing K864A & L867A engineered mutations, specifically tagging GLD-3L isoform. GLD-3L::1xV5 (K864A, L867A) animals are 30% Fog. Derived by CRISPR-engineered mutation of parental strain JK6091.
JK6509 fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2])/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes. fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2]) homozygotes are partially sterile, ~50% make excess sperm and delay oogenesis resulting in delayed egg laying when compared to wild-type animals. Pick WT dim GFP and check for correct segregation of progeny to maintain. q1227 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5810.
JK6510 fbf-1(q1228) fbf-2(q1011[*q945])/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2 derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. q1228 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5984.
JK6516 lst-1(q869) sygl-1(q1054) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1054 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6526 let-711(q1238[let-711::3xV5]) III. C. elegans GSS linker and 3xV5 tag inserted at C-teminus of endogenous let-711 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6531 gld-1(q1234) I. C. elegans CRIPSR-engineered modification of gld-1 FBEa* in gld-1 3'UTR.  Homozygotes are fertile with a slight increase in distal GLD-1 protein levels. Reference: Qiu et al., In preparation.
JK654 fem-3(q23) IV. C. elegans Maintain at 15C. Do not distribute this strain; other labs should request it from the CGC.
JK6540 gld-1(q1242) I. C. elegans q1242 is an engineered TGT to ACA substitution in FBEa1 of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6541 gld-1(q1243) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick GFP+ to maintain. CRIPSR-engineered modification of gld-1 FBEa and FBEa* in gld-1 3'UTR.  Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1243 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Increase in distal GLD-1 protein levels and decrease in proximal GLD-1 protein levels. Qiu et al., in preparation.
JK6547 fbf-1(q1250) fbf-2(q738)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1250 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK3101.
JK6548 fbf-1(q1251) fbf-2(q738)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1251 is an engineered H324A point mutation in FBF-1 derived by modification of parental strain JK3101.
JK6550 fbf-2(q1264[*q1011])/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H326A, Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6563 daz-1(q1254[1xV5::daz-1]) II. C. elegans 1xV5 tag inserted at N-teminus of endogenous daz-1 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6568 gld-1(q1257) I. C. elegans q1257 is an engineered TGT to ACA substitution in FBEb of the endogenous gld-1 locus. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6578 fbf-1(ok91) fbf-2(q1261[*q973])/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK659 mog-3(q74)/unc-93(e1500) dpy-17(e164) III. C. elegans Heterozygotes are wild-type and segregate wild-type heterozygotes, sterile Mog, and Unc Dpy. Pick wild-type and check for proper segregation of progeny. Do not distribute this strain; other labs should request it from the CGC.
JK6593 fbf-2(q1262[*q945]) II. C. elegans 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A) substitutions.
JK6594 ife-3(q1259[1xV5::ife-3]) V. C. elegans 1xV5 tag inserted at N-teminus of endogenous ife-3 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6596 fbf-1(ok91) fbf-2(q1272[*q1023])/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6600 lst-1(q869) sygl-1(q1167) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick GFP+ to maintain. C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory elementa LBS BCD (Yoo et al., 2004). Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1167 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6602 gld-1(q1271[*q1242]) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Engineered TGT to ACA substitutions in FBEa1 and FBEb of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP q1271 homozygotes (sterile Mog). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by modification of gld-1(q1242) homozygotes from parental strain JK6540. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6607 fbf-1(ok91) fbf-2(q1263[*q973])/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479F substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6658 fbf-1(ok91) fbf-2(q1285[*q1261])/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (N415A Y416A Q419A S453A H454A E457A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6673 fzr-1(q1290[3xV5::fzr-1]) II. C. elegans Endogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp.
JK6678 fbf-1(ok91) fbf-2(q1291[*q973])/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479E substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6690 qSi422 [*rajSi50] II. C. elegans qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6691 qSi423 II. C. elegans qSi423 [gld-1p::GFP::H2B::gld-1 3'UTR(FBEa TGT to ACA & FBEa* TGT to ACA)[*rajSi50] + Cbr-unc-119(+)] II. Modification of gld-1 FBEa and FBEa* in gld-1 3'UTR of single-copy insertion transgene.  Qiu et al., in preparation.
JK6692 qSi424 [*rajSi50] II. C. elegans qSi424 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter and GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6693 qSi425 [*rajSi50] II. C. elegans qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6694 rajSi50 II; unc-119(ed3) III. C. elegans rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6721 lst-1(q1086) sygl-1(q828) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick GFP+ to maintain. PUF-interacting motif B (PIM B) disrupted in endogenous lst-1 locus. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1086 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock.
JK6722 lst-1(q1124) sygl-1(q828) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick GFP+ to maintain. PUF-interacting motif A (PIM A) disrupted in endogenous lst-1 locus. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1124 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock.
JK6736 gld-1(q1297[*q1234]) I. C. elegans CRIPSR-engineered modification of gld-1 FBEa* and FBEb in gld-1 3'UTR.  Homozygotes are fertile and 20C. Qiu et al., in preparation.
JK6737 fbf-2(q1295[*q1011]) II. C. elegans 3xFlag tag inserted into endogenous fbf-2 locus with engineered (S453A H454A E457A Y479A) substitutions.
JK726 tra-2(q122) II. C. elegans tra-2(q122) is a gain-of-function allele. Do not distribute this strain; other labs should request it directly from the CGC.
JK816 fem-3(q20) IV. C. elegans Gain of function. Temperature sensitive. XX germline makes only sperm at 25C; XX germline makes oocytes and excess sperm at 15C. Do not distribute this strain; other labs should request it from the CGC.
JK860 fem-3(q20) IV; fog-2(q71) V. C. elegans Temperature-sensitive. Maintain at 15 C. Do not distribute this strain; other labs should request it from the CGC.
JK867 dpy-17(e164) ncl-1(e1865) unc-36(e251) III; qDp3 (III;f). C. elegans Animals which have the Duplication are Dpy. Animals which have lost the Duplication are DpyUncNcl. qDp3 homozygotes are lethal. Maintain by picking Dpy non-Unc. Do not distribute this strain; other labs should request it from the CGC.
JK892 unc-32(e189) glp-1(q231)/eT1 III; +/eT1 V. C. elegans Balanced temperature-sensitive allele of glp-1. Maintain at 20-25C. At restrictive temperature (25C), heterozygotes are wild-type and segregate wild-type, Unc-36 eT1 homozygotes, UncSteriles, and arrested eT1 aneuploid progeny (dead eggs). At permissive temperature (15C), heterozygotes are wild-type and segregate wild-type, Unc-36 eT1 homozygotes, fertile Unc-32 (can be maintained as a homozygous stock at 15C), and arrested eT1 aneuploid progeny (dead eggs). Maintain by picking wild-type and check for correct segregation of progeny to maintain. eT1 previously known as unc-36(e873). Do not distribute this strain; other labs should request it from the CGC.
JK907 mog-4(q233)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Do not distribute this strain; other labs should request it from the CGC.
MT15488 lin-35(n4760) I. C. elegans Class B SynMuv. Reduced fertility. Maintain at 20C or cooler. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RE249 qDf4/szT1 I; +/szT1 [lon-2(e678)] X. C. elegans Heterozygotes are WT. Segregates Lon males. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
q782
q71 Allele substitution nonsense
q339 Allele
q267 Allele substitution
q266 Allele
q485 Allele
q497 Allele substitution
q175 Allele substitution nonsense
eg33 Allele
q443 Allele
q145 Allele
qSi26 Transposon insertion insertion
qSi29 Transposon insertion insertion
q425 Allele
q484 Allele
q362 Allele substitution
q231 Allele substitution
q294 Allele
q46 Allele substitution nonsense
q738 Allele deletion
q180 Allele substitution
q158 Allele substitution
q347 Allele deletion
q224 Allele substitution
q372 Allele substitution nonsense
q269 Allele
q387 Allele deletion
q411 Allele substitution nonsense
q385 Allele substitution nonsense
q420 Allele substitution splice_site
q465 Allele deletion
q223 Allele substitution nonsense
q470 Allele
q476 Allele substitution
q75 Allele deletion splice_site
q490 Allele
q265 Allele
q96 Allele substitution
q519 Allele substitution nonsense
q544 Allele substitution slient
q449 Allele substitution
q518 Allele
q650 Allele
q645 Allele substitution
q632 Allele insertion
q325 Allele deletion
q660 Allele deletion
q12 Allele substitution nonsense
q624 Allele substitution
q568 Allele
q574 Allele
q689 Allele substitution
q690 Allele
q704 Allele substitution nonsense
q730 Allele deletion
q736 Allele deletion
q725 Allele deletion
q686 Allele substitution
q740 Allele deletion
q750 Allele deletion
q741 Allele deletion
q766 Allele deletion
q250 Allele substitution
q772 Allele
q785 Allele insertion
q783 Allele deletion
q784 Allele deletion
q520 Allele deletion frameshift
q22 Allele substitution
q253 Allele substitution
q23 Allele substitution
q74 Allele
q122 Allele deletion
q20 Allele
q162 Allele
q233 Allele substitution
q304 Allele
q297 Allele
q298 Allele
q306 Allele
q276 Transposon insertion insertion
q373 Allele
q89 Allele substitution